Formononetin protects against sepsis-induced lung injury by directly inhibiting receptor for advanced glycation end products signaling pathway

doi:10.21203/rs.3.rs-4928958/v1

Download PDF

Article

Formononetin protects against sepsis-induced lung injury by directly inhibiting receptor for advanced glycation end products signaling pathway

https://doi.org/10.21203/rs.3.rs-4928958/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Excessive inflammatory response is the pathological basis of septic lung injury. Although formononetin (FMN) exerts an anti-inflammatory activity, its effect on sepsis-induced lung injury and the associated mechanisms remain unknown. Hence, in this study, we explored how FMN affected septic lung injury and the underlying mechanisms. We constructed mouse model of sepsis-induced lung injury through cecal ligation and puncture (CLP) in vivo, and utilized lipopolysaccharide (LPS) to stimulate RAW 264.7 cells for simulating inflammatory environment during septic condition in vitro. Specifically, FMN treatment significantly suppressed the generation of inflammatory factors, such as TNF-α, IL-1β, and IL-6. In addition, FMN treatment alleviated lung pathological damage, inhibited apoptosis, and improved lung barrier dysfunction. Moreover, FMN administration markedly reduced the protein level of RAGE, and inhibited the phosphorylation levels of NF-κB (p65), IκBα, JNK, ERK, and p38. Surface plasmon resonance imaging (SPRi) and molecular docking revealed that FMN could bind to RAGE protein and form a stable connection with RAGE. Meanwhile, silencing RAGE significantly abolished FMN’s activity against inflammation in RAW 264.7 cells. FMN combined with RAGE inhibitor treatment did not further increase FMN’s protective effect against septic lung injury mice. In conclusion, FMN protects against septic lung injury through directly suppressing RAGE signaling pathway. These results suggest that FMN exhibits potential as a viable drug candidate for treating septic lung injury.

Health sciences/Diseases/Immunological disorders

Health sciences/Diseases/Infectious diseases

Sepsis-induced lung injury

Inflammation

Formononetin

RAGE

Being a life-threatening clinical disorder, sepsis contributes a lot to multiple organ failure in patients of intensive care unit [1, 2]. Typically, the lung is the most easily affected organ in septic condition. It is reported that approximately half the patients with sepsis develop lung injury [3, 4], and these septic patients have high mortality and dismal prognosis, regardless of advance in symptomatic treatment and machine support ventilation. Until now, the precise mechanism underlying septic lung injury remains uncertain. Consequently, investigating the pathogenesis of septic lung injury and developing relevant treatments are of great importance.

Sepsis is induced by the complicated host response to the intruding pathogenic microorganisms [5]. When pathogens such as microorganisms and endotoxins invade the lung tissue, numerous genes encoding inflammatory cytokines will be activated to initiate transcription, causing production and release of various pro-inflammatory factors, thus activating the inflammatory effector cells, including alveolar macrophages, epithelial cells, multinucleated leukocytes, and endothelial cells, finally causing out-of-control inflammatory cascade. Such pathological changes will impair vascular endothelial cells and alveolar epithelial cells, later affect intrapulmonary gas exchange, cause serious lung injury and decrease lung function [6, 7], eventually lead to organ failure. At present, sepsis-induced lung injury can not be effectively treated, suggesting that the identification of anti-inflammatory agents as well as its therapeutic targets are of great importance.

The natural flavonoid formononetin (FMN) is an effective component of Astragalus membranaceus, a Chinese herbal medicine, which can be used for treating diverse inflammatory disorders [8–10]. FMN is widely suggested to possess distinct pharmacological activities, such as neuroprotection [11], antioxidation [12], anti-fibrosis [13], anti-inflammation [14], anti-tumor [15], and barrier function regulation [16]. In recent years, FMN is applied in managing pulmonary disorders pharmacologically. For example, the delivery of FMN by an albumin-based nanoformulation to the impaired lesion dramatically improves lung function and extends the survival in the animal model of bleomycin-mediated lung injury and fibrosis [17]. Treatment of FMN can attenuate cigarette smoke-mediated chronic obstructive pulmonary disease of mice through inhibiting inflammation, apoptosis as well as endoplasmic reticulum stress [18]. Additionally, FMN can be used to attenuate oxidative stress and airway inflammation during asthma [19]. We can see that the efficacy of FMN in protecting the lungs and reducing inflammation has been proved in multipul studies. However, whether FMN exerts an anti-inflammatory property so as to inhibits sepsis-mediated lung injury and its underlying molecular mechanisms require further investigations.

Receptor for advanced glycation end-products (RAGE) is extensively suggested to initiate inflammatory response [20]. Being a multi-ligand pattern recognition receptor (PRR), RAGE not only mediates cellular responses to various damage-associated molecular pattern molecules (DAMPs) including HMGB1, AGEs, DNA, and S100s, but also plays an important role as the innate immune sensor for microbial pathogen-associated molecular pattern molecules (PAMPs) such as bacterial endotoxin, microbial DNA and respiratory viruses [21]. In septic condition, RAGE has been shown to take part in the occurrence of lung injury [22, 23]. Activating RAGE signaling pathway is able to initiate multiple downstream signaling pathways, such as nuclear factor-κB (NF-κB) signaling pathway and mitogen-activated protein kinase (MAPK) signaling pathway [24], which are illustrated to induce the generation and secretion of the pro-inflammatory factors, like interleukin−6 (IL−6), interleukin−1β (IL−1β), and tumor necrosis factor-α (TNF-α) [25]. These pathological processes result in damages to alveolar epithelial cells and vascular endothelial cells, subsequently lead to the decreased organ function, and ultimately result in organ failure. Consequently, RAGE-targeting treatments for suppressing inflammation can effectively alleviate septic lung injury.

In the present research, the mouse model of septic lung injury conducted by cecal ligation puncture (CLP), as well as the inflammatory cell model established by lipopolysaccharide (LPS) stimulation, were applied to assess FMN’s protection from lung injury in septic mice, and to explore the underlying mechanisms. Our results shed more lights on the septic lung injury-suppressing mechanism of FMN, and FMN may be potentially used to treat lung injury in septic condition.

Materials

FMN (CAS# 52250-35-8, HPLC ≥ 98%) was acquired in CHENGDU MUST BIO-TECHNOLOGY CO., LTD (Chengdu, China). Dexamethasone (DEX) and LPS were obtained in Sigma-Aldrich (St. Louis, MO, USA). The RAGE selective inhibitor FPS-ZM1 was bought in MedChemExpress (Monmouth Junction, NJ, USA). The following primary antibodies were obtained in Affinity Biosciences (Ohio, OH, USA), including NF-κB p65 (AF5006), phospho-NF-κB p65 (Ser536) (AF2006), IκBα (AF5002), phospho-IκBα (Ser32/Ser36) (AF2002), ERK1/2 (AF0155), phospho-ERK1/2 (Thr202/Tyr204) (AF1015), JNK1/2/3 (AF6318), phospho-JNK1/2/3 (Thr183 + Tyr185) (AF3318), p38 MAPK (AF6456), phospho-p38 MAPK (Thr180/Tyr182) (AF4001), IL-1β (AF5103), IL-6 (DF6087), TNF-α (AF7014), and GAPDH (AF7021). Antibodies including ZO-1 (13663) and Occludin (91131) were provided by Cell Signaling Technology (Beverly, MA, USA), whereas those including BAX (50599-2-Ig) and Bcl-2 (68103-1-Ig) were acquired in Proteintech (Chicago, IL, USA).

Animals

Male C57BL/6 mice (6-8-week-old, 18–20 g) were bought in Laboratory Animal Management Center of Southern Medical University (Guangzhou, China) and raised under a specific pathogen-free environment. Animal treatment throughout this experimental period followed Guidelines of the Animal Care and Use Committee of Southern Medical University.

Mouse modelling and grouping

Experimental animals were randomized into 5 groups (4 mice each), including sham, cecal ligation and puncture (CLP), FMN (10 and 20 mg/kg), and DEX (5 mg/kg) groups. Mice of sham and CLP groups received distilled water treatment, while those of FMN and DEX groups received FMN or DEX pretreatment by gavage 3 days preoperatively, prior to induction of severe sepsis through CLP.

First of all, mouse anesthesia was achieved through intraperitoneally injecting using 0.3% sodium pentobarbital, and later put on the laboratory bench in the supine position for preparation and sterilization of surgical area. Thereafter, the cecum was separated and totally exposed through making an abdominal incision. Then, the cecum was ligated with sterile sewing silk at 1 cm away from the tail, followed by perforation of the blind end to collect fecal samples into the 18-gauge needle. Later, the cecum was returned to abdomen, prior to suture of abdominal incision. Mice of sham group received identical treatment, except for CLP.

Later, the efficacy of FMN in mice exposed to RAGE inhibitor (FPS-ZM1) treatment was determined. To this end, mice were randomized into 4 groups (4 mice each), including sham, CLP, 20 mg/kg FMN, and 20 mg/kg FMN + 1 mg/kg FPS-ZM1 (intraperitoneal injection) groups.

Animal Ethics Committee of Southern Medical University approved our animal procedures (L2019147).

Hematoxylin and eosin (HE) staining

We harvested mouse lung tissues of diverse groups and fixed them within 4% paraformaldehyde for 2 days. Thereafter, lung tissues were dehydrated using gradient ethanol and infiltrated with xylene, prior to paraffin embedding and preparation to 4-µm sections. HE staining was strictly conducted following corresponding instructions. Finally, the optical microscope was utilized for section observation and photographing.

Enzyme-linked immunosorbent assay (ELISA)

IL-6 and TNF-α contents in serum were detected using ELISA kits (ELK Biotechnology; Wuhan, China) strictly following specific instructions.

Immunohistochemical (IHC) analysis

RAGE, BAX, and Bcl-2 protein expression within lung tissues was detected through IHC. Briefly, tissue sections were treated with deparaffinage, rehydration and antigen retrieval through heating within the citrate buffer. After 10-min incubation using 3% H₂O₂ in dark, sections were further incubated using 5% goat serum for a 1-h period for blocking nonspecific binding. Then, sections were collected for primary antibody incubation, which included RAGE, BAX, and Bcl-2, overnight under 4℃, and later additional 1-h incubation using biotinylated secondary antibody under ambient temperature. Positive staining was visualized using diaminobenzidine (DAB). Finally, an optical microscope was employed for section observation and photographing.

TUNEL staining

CF488 Tunel Cell Apoptosis Assay Kit (Servicebio; Wuhan, China) was applied in detecting apoptotic cells within lung tissues of various groups. In brief, after deparaffinage and rehydration, we incubated tissue sections within Proteinase K working solution for 20-min under 37℃, and permeabilized them for another 30-min in 0.3% Triton X-100 at ambient temperature. Subsequently, labeling solution (Equilibration Buffer: CF488-dUTP Labeling Mix: Recombinant TdT enzyme = 50: 5: 1) was prepared and used to incubate tissue sections under 37℃ for a 1-h duration. Next, sections were stained using DAPI, and cell apoptosis was analyzed through fluorescence microscopy. Green-fluorescent cells were defined as apoptotic cells.

Molecular docking

The RAGE protein 3D structure was acquired based on RCSB PDB, while crystal structure of FMN was obtained in PubChem database. By adopting AutoDockTools, water molecules were eliminated out of bound ligands, nonpolar hydrogen molecules were introduced, and bound ligands were separated. After water removal, hydrogen addition and utilization as a ligand, the drug setup was similar in AutoDockTools. The molecule docking with the protein molecule can detect protein size and insert the protein. Later, docking parameters and approaches were configured. Finally, PyMOL and LigPlot software were employed for visualization of docking results.

Surface plasmon resonance imaging (SPRi)

Interactions of FMN with RAGE were measured by PlexArray HT A100 SPR equipment according to previous description [26]. Briefly, to load samples, we assembled a chip with a plastic flow cell. FMN was diluted with PBS at 2.5, 5, 10, 20, and 40 µM concentrations. We obtained a representative binding curve through FMN at 2 ml/s for 300-s association, later flowing running buffer for 300-s dissociation, and finally at 3 ml/s for 200-s regeneration buffer. Kinetic curves and parameters were determined with BIA evaluation software (version 3.0).

RAW 264.7 cell culture and viability

In this experiment, we cultivated RAW 264.7 cells with DMEM supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin, prior to incubation under 37°C with 5% CO₂. Following 24-h FMN treatment (2.5, 5, 10, 20 and 40 µg/mL), we evaluated cell viability through MTT assay in line with specific protocols.

Immunofluorescence (IF) staining

Following deparaffinage, rehydration, and paraffin embedding of tissue sections, antigen retrieval was performed. Those obtained sections were later treated with 30-min permeabilization using 0.3% Triton X-100 and additional 1-h blocking using 5% BSA. Then, primary antibodies (ZO-1, 1:100; Occludin, 1:100) were added for incubating sections overnight under 4℃, whereas secondary antibody (Fluor 594-combined IgG, 1:250) was applied to incubate the sections on the following day in dark for a 1-h period. Sections were then stained using DAPI for a 10-min duration, then the fluorescence microscope was employed for section observation and photographing.

After 15-min fixation within 4% paraformaldehyde as well as 30-min permeabilization with 0.3% Triton X-100, we blocked RAW 264.7 cells using 5% BSA. Thereafter, primary antibodies (RAGE, 1:100; NF-κB p65, 1:100) were added to incubate cells overnight under 4℃, before additional 1-h incubation using Fluor 594-combined IgG secondary antibody (1:250) and 10-min DAPI staining. A confocal microscope was applied in observing fluorescence.

Western blot (WB)

Briefly, RIPA lysis (Beyotime) including protease inhibitors (Beyotime) and phosphatase inhibitors (KeyGen Biotech; Nanjing, China) was added to lyse RAW 264.7 cells and lung tissues. Later, 15-min sample centrifugation was performed at 12,000 g and 4℃ for collecting supernatants in preparing protein samples. Thereafter, protein separation was achieved through 10–12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, before transfer on PVDF membranes. Following 1-h blocking using 5% BSA within TBST, membranes were subjected to overnight (12–16 h) primary antibody (1:1000) incubation under 4℃ and further 1-h incubation using secondary antibody (1:3000) on the following day. Primary antibodies utilized in this assay included RAGE, NF-κB p65, phospho-NF-κB p65 (Ser536), IκBa, phospho-IκBa (Ser32/Ser36), ERK1/2, phospho-ERK1/2 (Thr202/Tyr204), JNK1/2/3, phospho-JNK1/2/3 (Thr183 + Tyr185), p38 MAPK, phospho-p38 MAPK (Thr180/Tyr182), TNF-α, IL-6, IL-1β, and GAPDH. SYSTEM GelDoc XR + IMAGELAB (Bio-Rad; Richmond, CA, USA) was adopted to detect protein bands, whereas Image J software was applied in measuring protein band intensities.

Quantitative reverse transcription polymerase chain reaction (qRT-PCR)

Trizol reagent (Accurate Biology; Changsha, China) was utilized for extracting total tissue and cellular RNAs. Thereafter, cDNA was prepared with the Evo M-MLV RT Kit with gDNA clean (Accurate Biology), whereas qRT-PCR was conducted with SYBR Green Premix Pro Taq HS qPCR Kit (Accurate Biology) strictly following specific instructions. Primer sequences included: IL-1β forward (F): TCAAATCTCGCAGCAGCACATC, IL-1β reverse (R): CGTCACACACCAGCAGGTTATC; IL-6 F: CCCCAATTTCCAATGCTCTCC, R: CGCACTAGGTTTGCCGAGTA; TNF-α F: TGGAACTGGCAGAAGAGGCAC, R: AGGGTCTGGGCCATAGAACTGA; GAPDH F: AGGTCGGTGTGAACGGATTTG, R: TGTAGACCATGTAGTTGAGGTCA. We adopted 2 ^−△△Ct approach in determining mRNA levels, and GAPDH was an endogenous control.

Statistical analysis

Data were represented by mean ± SD. Among-group differences were compared through one-way analysis of variance (ANOVA) upon homogeneity of variance, while Welch’s test was adopted for heterogeneity of variance, and Tamhane’s T2 test was utilized in multiple comparisons. Besides, student’s t-test was conducted in detecting between-group differences in the comparison of two group. P value below 0.05 stood for significant difference.

FMN inhibited lung injury and inflammation within septic mice

To explore FMN’s protection against sepsis-induced lung injury, we firstly assessed the histopathological damage to lung tissue by HE staining. Relative to sham group, CLP operation obviously induced pathological changes, including extensive alveolar wall thickening, interstitial edema, and inflammatory cell infiltration (Fig. 1A). However, FMN and DEX treatments markedly improved these pathological changes. In addition, histological analysis was conducted to semi-quantitatively assess lung injury, as a result, FMN and DEX remarkably reduced lung injury score (Fig. 1B). To investigate whether FMN affected pro-inflammatory cytokines, ELISA and qPCR assays in vivo were performed for detecting levels of TNF-α, IL-6, and IL-1β. Transcription levels of the above proinflammatory cytokines remarkably increased within lung tissues of septic mice, whereas FMN administration evidently decreased these pro-inflammatory cytokines induced by CLP (Fig. 1C-E). Likewise, as suggested by the result of ELISA assay, FMN markedly suppressed TNF-α and IL-6 secretion (Fig. 1F-G). Moreover, we selected DEX as the positive control drug, and found thay High-dose FMN had comparable anti-inflammatory effect to DEX. Collectively, FMN inhibits the sepsis-mediated lung histopathological injury and decreases the levels of proinflammatory cytokines during septic condition.

FMN inhibited apoptosis and improved lung barrier dysfunction of septic lung injury mice

For septic lung injury mice, out-of-control inflammatory cascade impaired alveolar epithelial cells and vascular endothelial cells, resulting in serious lung injury and declined lung function. We therefore conducted TUNEL staining to detect cell apoptosis within lung tissue in mice with sepsis. TUNEL staining showed that the apoptotic cell number elevated within pulmonary region because of CLP operation. However, FMN mitigated CLP-mediated lung tissue apoptosis dose-dependently (Fig. 2D). In addition, IHC staining was performed for detecting apoptotic proteins BAX and Bcl-2. Consistent with TUNEL staining, BAX was markedly increased, whereas Bcl-2 was dramatically decreased in septic lung injury mice. And FMN administration dramatically down-regulated BAX and up-regulated Bcl-2 dose-dependently (Fig. 2A-C).

Apart from apoptosis, tight junctions also exert key effects on regulating the lung barrier function, among which, Occludin and ZO-1 account for the main determining factors for maintaining barrier permeability [27]. As verified by IF staining of tight junctions in lung sections, Occludin and ZO-1 expression markedly declined in septic lung injury mice, besides, FMN administration markedly abolished such decline (Fig. 2E-H).

The above results reveal that FMN treatment dramatically inhibit apoptosis and improve lung barrier dysfunction in septic lung injury mice.

FMN inhibited NF-κB and MAPKs signaling pathways of sepsis-induced lung injury mice

NF-κB accounts for the dimeric transcription factor family responsible for regulating inflammatory responses. IκBa phosphorylation activates NF-κB signaling pathway, as demonstrated by p65 subunit phosphorylation and nuclear translocation [28]. Consequently, we analyzed whether FMN affected NF-κB signaling pathway among septic lung injury mice. From Fig. 3A-C, p65 and IκBa phosphorylation levels markedly elevated within lung tissues in septic mice. Surprisingly, we found that FMN administration remarkably inhibited p65 and IκBa phosphorylation levels.

After tissue injury or pathogen infection, PRR stimulation can activate members of major MAPK subfamilies, namely, p38, extracellular signal-regulated kinase (ERK), and Jun N-terminal kinase (JNK) subfamilies. NF-κB activation combined with MAPKs activation can trigger relevant gene expression, thus jointly regulating inflammatory responses [29]. Hence, we also detected the activation of MAPKs signaling pathway in lung tissue of septic mice. As a result, JNK, p38, and ERK phosphorylation levels markedly increased within lung tissues in septic mice, while FMN administration significantly reversed these changes (Fig. 3D-G). These data suggest that treatment with FMN significantly inhibits NF-κB and MAPKs signaling pathways within lung tissued in sepsis.

FMN targeted RAGE directly

RAGE has been widely suggested to participate in progression of sepsis-induced lung injury [22, 23, 30]. Administration of HMGB1, a ligand of RAGE, can cause acute lung injury in mice, indicating that RAGE may contribute a lot to the pathogenesis of lung injury. Anti-HMGB1 antibody administration ameliorates the pathological effects of lung injury [31]. Moreover, deletion of RAGE has also been found to ameliorate lung injury caused by pulmonary ischemia and reperfusion [32]. Considering that NF-κB and MAPKs are signaling pathway regualted by RAGE, and that FMN could modulate NF-κB and MAPKs signaling pathways, we speculated that FMN probably specifically targeted RAGE, further attenuating the sepsis-induced lung injury through both pathways. Firstly, we examined whether FMN administration regulated the protein level of RAGE. Surprisingly, through WB assay, we found that RAGE protein expression markedly increased within lung tissues in septic mice, and that FMN treatment significantly down-regulated RAGE protein expression (Fig. 4A and B). Additionally, IHC staining also came to similar results (Fig. 4C and D). To further confirm whether FMN directly targeted RAGE, molecular docking and SPRi biosensing method were applied. According to molecular docking, a method extensively utilized for observing protein-ligand interactions, the FMN-RAGE complex had the−5.2 kcal/mol binding energy. Figure 4E exhibits the FMN molecular formula. Figure 4F-G present the two-dimensional and three-dimensional pharmacophores of the FMN-RAGE complex separately. As suggested by molecular docking results, FMN interacted with multiple amino acid residues in RAGE binding pocket, which included 1 hydrogen bond (with Met1−1.9 Å) together with 8 hydrophobic bond interactions (with Ala14, Arg4, Arg5, Arg12, Glu16, Lys13, Pro15, and Trp2). Moreover, we utilized SPRi for assessing affinity and interaction kinetics of RAGE with FMN in vitro. The KD of FMN-RAGE was 6.74 × 10−8 M, confirming the direct targeting of FMN to RAGE dose-dependently (Fig. 4H). These findings suggest the stable interaction of FMN with RAGE, and the direct targeting of FMN to RAGE.

FMN suppressed LPS-mediated inflammation within RAW 264.7 cells

Macrophage activation is the pathological marker for inflammatory and immune responses in septic lung injury [7]. Herein, we used LPS for stimulating RAW 264.7 cell activation to further analyze FMN’s anti-inflammatory effect. We firstly examined cytotoxic effect induced by FMN on RAW 264.7 cells. According to MTT assay results from Fig. 5A, FMN did not show any toxicity towards RAW 264.7 cells at < 10 µM. Therefore, FMN at 2.5, 5, and 10 µM was selected in subsequent experiments. To confirm activity of FMN against inflammation, FMN at varying concentrations (2.5, 5, and 10 µM) was adopted for 24-h cell treatment, later, 1 µg/mL LPS was introduced for an additional 6-h cell treatment. Through WB assay, we found that the protein expression levels of proinflammatory factors TNF-α, IL−6, and IL−1β were apparently elevated after LPS stimulation, whereas intervention of FMN significantly decreased their protein levels dose-dependently (Fig. 5B-E). As suggested by further investigation by qPCR assay, their transcription levels markedly elevated within LPS-exposed RAW 264.7 cells. Consistently, FMN markedly decreased their transcription levels (Fig. 5F-H). Therefore, our data show that FMN suppresses LPS-mediated inflammation within RAW 264.7 cells.

FMN inhibited RAGE/NF-κB/MAPKs signaling pathway within LPS-exposed RAW 264.7 cells

This study further investigated impacts of RAGE/NF-κB/MAPKs signaling pathway on FMN’s anti-inflammatory effect in vitro. According to WB assay and IF staining, RAGE protein expression dramatically increased within RAW 264.7 cells after LPS treatment, while FMN intervention significantly down-regulated RAGE protein expression (Fig. 6A-C). As the downstream of RAGE, NF-κB and MAPKs signaling pathways were also detected. According to our results, key proteins in both pathways, like p65, IκBα, JNK, p38, and ERK, had dramatically elevated phosphorylation levels following LPS stimulation. And FMN treatment significantly decreased their phosphorylation levels (Fig. 6D-F and H-K). Activation of NF-κB causes the p65 cytoplasmic-to-nuclear translocation, we therefore detected the p65 subunit subcellular localization through IF staining. As found, LPS exposure caused p65 cytoplasmic-to-nuclear translocation, whereas FMN treatment apparently reversed this change (Fig. 6F). These data indicate that FMN inhibits RAGE/NF-κB/MAPKs signaling pathway within LPS-exposed RAW 264.7 cells.

RAGE silencing markedly abolished FMN’s inhibition against NF-κB and MAPKs signaling pathways

For determining RAGE’s effect on FMN’s inhibition against LPS-exposed RAW 264.7 cells, siRNA was applied to silence RAGE expression. From Fig. 7A-C, RAGE mRNA and protein expression significantly decreased, indicating that RAGE-silenced RAW 264.7 cells were successfully established. Next, this study detected wthether silencing RAGE would affect FMN’s inhibitory abilities against NF-κB and MAPKs signaling pathways. Through WB assay, key proteins in NF-κB and MAPKs signaling pathways had significantly suppressed phosphorylation levels after silencing RAGE. Consistent with our previous findings, FMN treatment dramatically inhibited p65, IκBα, JNK, p38, and ERK phosphorylation levels. Besides, FMN’s inhibition against NF-κB and MAPKs signaling pathways was markedly abolished (Fig. 7D-J). Moreover, we detected if FMN’s inhibition against pro-inflammatory cytokines were affected. From WB assay in Fig. 7K-N, FMN’s inhibition against TNF-α, IL-6, and IL-1β was markedly abolished. These above data strongly demonstrate that RAGE mediates FMN’s effect against inflammation within LPS-exposed RAW 264.7 cells.

RAGE inhibition failed to promote FMN’s inhibition against NF-κB and MAPKs signaling pathways in sepsis-induced lung injury mice

In subsequent experiments, we applied FPS-ZM1, an inhibitor of RAGE, to further confirm that RAGE was associated with the anti-inflammatory impact of FMN against sepsis-related lung injury in mice. Critical proteins in NF-κB and MAPKs signaling pathways, such as p65, IκBα, p38, ERK, and JNK, had markedly suppressed phosphorylation levels after FMN intervention. However, co-treatment of FMN with RAGE inhibitor FPS-ZM1 did not further increased FMN’s suppression against the NF-κB and MAPKs signaling pathways (Fig. 8). Our results firmly reveal that the suppressive effects of FMN against NF-κB and MAPKs signaling pathways are associated with inhibiting RAGE signaling pathway.

Inhibition of RAGE did not promote the inhibition of FMN against apoptosis and its ameliorative effect on lung barrier dysfunction in septic lung injury mice

We also detected the apoptosis and lung barrier function in septic lung injury mice. IHC staining demonstrated that FMN treatment alone markedly reduced BAX (Pro-apoptotic protein) but elevated Bcl-2 (Anti-apoptotic protein) expression. However, FMN plus FPS-ZM1 treatment failed to further increase the the anti-apoptotic ability of FMN (Fig. 9A-C). TUNEL staining also came to the same results (Fig. 9D). Consistent with our previous results, IF staining for ZO-1 and Occludin showed that FMN intervention markedly improved the lung barrier dysfunction within lung tissues of septic mice, according to elevated ZO-1 and Occludin expression. However, FMN combined with FPS-ZM1 treatment did not further promote FMN’s ability to improve the lung barrier dysfunction in septic lung injury mice (Fig. 9E-H). Based on the above findings, FMN exerts its effects on apoptosis and lung barrier dysfunction through inhibiting RAGE signaling.

Inhibition of RAGE did not promote the inhibition of FMN against lung injury and inflammation among septic lung injury mice

We further detected whether FMN exerted its effect against inflammation through inhibiting RAGE by measuring lung injury score and detecting transcription levels and secretion levels of pro-inflammatory cytokines. Figure 10A showed that, HE staining results revealed that lung tissue pathological changes of lung tissues of septic mice, such as excessively thickened alveolar wall, interstitial edema, as well as inflammatory cell infiltration, were remarkably alleviated after FMN treatment. However, the protective effect of co-treatment of FMN with FPS-ZM1 was similar to that of FMN treatment alone. Measurement of lung injury score also revealed the same results (Fig. 10B). We also detected pro-inflammatory factors in terms of their transcription levels and secretion levels. According to the results, mRNA levels of TNF-α, IL-6, and IL-1β markedly declined among lung tissues of septic mice after FMN treatment. And FMN combined with FPS-ZM1 treatment did not further promote FMN’s inhibition against pro-inflammatory cytokines (Fig. 10C-E). ELISA results also suggested that the proinflammatory cytokines in FMN combined with FPS-ZM1 treatment group were not further reduced relative to FMN treatment alone group (Fig. 10F and G). These data strongly indicate that FMN exerts its effect against inflammation in septic lung injury mice through inhibiting RAGE signaling.

Global health priority has been designated by the World Health Organization as sepsis. Sepsis shows the typical feature of excess inflammation upon infection, and the mortality among inpatients is estimated to be 30–45% [4, 33]. The lung is highly susceptible to inflammation-induced injury caused by inflammatory factors in sepsis, making it the organ most prone to being affected [7]. The septic lung injury is associated with the cytokine storm, which is the hyperactive inflammatory process [34], identified as the prominent factor for severe COVID−19 [35]. Management of excess inflammation is of great importance to treat septic lung injury and COVID−19. Although great progress is made in detecting sepsis early and assisting in organ function of septic patients, sepsis still shows higher prevalence and fatality rates [36–39]. As discovered recently in the LPS-induced acute lung injury animal model, down-regulating inflammatory cytokines and decreasing inflammatory cell infiltration can mitigate lung injury while improving animal survival [40, 41]. Dex, a glucocorticoid, has been extensively adopted for treating septic shock. Dex is found to efficiently modulate inflammatory response, mitigate septic lung injury, reduce hospital stays, and decrease the mortality. Nonetheless, the extensive utilization of DEX in septic patients often leads to adverse reactions that significantly impact the post-sepsis survivors' overall well-being. Consequently, it is imperative to explore alternative therapeutic approaches promptly.

Traditional Chinese medicine is widely demonstrated to be effective on treating inflammatory diseases [42–44], and on inhibiting cytokine storm under the septic condition [45, 46]. Astragalus membranaceus, a traditional Chinese medicinal herb, exhibits numerous pharmacological activities [8, 10, 47], and finds extensive usage in the clinical management of various ailments. Astragalus membranaceus and its various active ingredients have been reported to exert anti-inflammatory capacity [48–51]. From our results, FMN, an effective component of Astragalus membranaceus, significantly inhibited inflammation of mice in septic condition. Additionally, the pathological damages of lung tissues in septic mice, including the excessive alveolar wall thickening, interstitial edema, and inflammatory cell infiltration, were markedly alleviated following FMN treatment dose-dependently. Results of the in-vitro experiment also revealed that FMN markedly inhibited the pro-inflammatory cytokine levels within LPS-exposed RAW 264.7 cells. Therefore, we further explored the specific mechanism underlying FMN’s action on inhibiting inflammation in subsequent experiments.

Apart from inflammatory response, apoptosis of cells in lung tissue also contributed a lot to the pathogenic mechanism of sepsis-induced lung injury [52]. The death of epithelial cells, vascular endothelial cells, and immune cells resulting from the diverse inflammatory factors generation is also a critical pathological process. Therefore, in this study, we tested the apoptosis level within lung tissues of septic mice. According to our results, CLP markedly induced apoptosis, whereas FMN treatment significantly reversed this trend. In addition, IHC staining was conducted to detect apoptotic proteins including BAX and Bcl−2, and the results also showed the same trend. In septic condition, both hypoxia and pro-inflammatory factor production will injure pulmonary epithelial barrier in lung tissue [54], resulting in the dysfunction lung barrier, and causing the leakage of proteins and fluid into the alveolar space. In our study, we measured the tight junctions (ZO−1 and Occludin) within lung tissues in septic condition using IF staining. As a result, expression levels of ZO−1 and Occludin markedly decreased in lung tissue of septic mice, and FMN treatment markedly increased their expression levels. Consequently, this study suggests that FMN not only possesses the anti-inflammatory effect, but also exerts anti-apoptotic and lung barrier protective effects in lung tissue of septic mice.

Multiple signaling pathways are previously reported to possess important regulative effects on inflammatory response in septic lung injury, such as NF-κB and MAPKs signaling pathways [55, 56]. Notably, these two signaling pathways have been identified to govern proinflammatory factors’ generation [57]. Conforming to prior results, these two signaling pathways were activated within lung tissues in septic mice. FMN treatment markedly suppressed their activation, as demonstrated by the reduced phosphorylation of critical proteins in NF-κB and MAPKs signaling pathways, including p65, IκBα, p38, JNK, and ERK.

RAGE, a multi-ligand PRR, shows high expression in diverse lung cells, including immune cells and non-immune cells [26]. Involvement of the RAGE signaling pathway has been documented in the development of septic lung damage [30]. In sepsis, DAMPs (AGEs, HMGB1, S100s, and DNA) and PAMPs (bacterial endotoxin, microbial DNA, and respiratory viruses) interact with RAGE, which transmits pathogen substrate signals for cell activation in inflammation occurrence and persistence [23]. Once activated, RAGE initiates diverse intracellular signaling pathways, like NF-κB and MAPKs signaling pathways, which are of great significance for amplification of inflammatory response in lung tissue during septic condition [23]. It has been reported that mice with AGER deficiency are prevented from CLP-induced sepsis [58]. Furthermore, for CLP modeled mice, RAGE blockage with the neutralizing antibody or RAGE silencing using the corresponding siRNA suppresses pro-inflammatory factor production and improves mouse survival [58, 59]. Therefore, we hypothesized that RAGE might mediate the role of FMN in inhibiting septic lung injury. In subsequent experiments, WB assay and IHC staining were conducted to confirm our hypothesis. As a result, RAGE protein expression remarkably elevated within injured lung tissues in septic mice. Surprisingly, we found that FMN treatment markedly inhibited the RAGE protein level. As revealed by further study using molecular docking, FMN interacted with multiple amino acid residues in RAGE binding pocket, which included 1 hydrogen bond (with Met1−1.9 Å) together with 8 hydrophobic bond interactions (with Ala14, Arg4, Arg5, Arg12, Glu16, Lys13, Pro15, and Trp2). SPRi analysis also found that FMN exhibited strong binding affinity for RAGE, strongly suggesting that FMN might target RAGE directly.

For verifying RAGE’s effect on the inhibitory impact of FMN against inflammation in sepsis-induced lung injury, siRNA was used to silence RAGE expression within RAW 264.7 cells. According to the experimental observations, RAGE silencing reversed FMN’s inhibition against NF-κB and MAPKs signaling pathways, and pro-inflammatory cytokines levels. Our in vivo experiment was further performed using FPS-ZM1 (the RAGE inhibitor) to compare effects of FMN treatment alone and co-treatment of FMN with FPS-ZM1. We found that FMN combined with FPS-ZM1 did not further increase the effects of FMN on inhibiting NF-κB and MAPKs signaling pathways, suppressing apoptosis, improving lung barrier dysfunction, and restraining inflammatory response.

However, certain limitations should be noted in the present work. LPS treatment of RAW 264.7 in vitro may not be totally equal to every pathological damage in sepsis-induced lung injury in vivo. In addition, applying RAGE knockdown mice would make our conclusions more convincing. Moreover, the pharmacokinetics of FMN were not performed in this study, which should be further explored in subsequent research.

Taken together, FMN attenuates inflammatory response in lung tissue of septic mice through directly suppressing RAGE pathway. In vivo, inhibiting RAGE fails to further increase FMN’s inhibition against inflammation. In vitro, FMN inhibits inflammatory response within LPS-exposed RAW 264.7 cells via inhibiting RAGE. The suppressive effect of FMN on inflammation is abolished by silencing RAGE. Such results shed more lights on effects of FMN on treating septic lung injury and its mechanisms.

Declaration of Competing Interest

The authors declare no conflicts of interest to this research.

Funding

This research was supported by the following grants: National Natural Science Foundation of China (Nos. 82204959, 82274417, 82305110, 82305225, 82104968), Guangdong Basic and Applied Basic Research Foundation (Nos. 2021A1515110786, 2022A1515011630, 2021A1515220010, 2022A1515110870), China Postdoctoral Science Foundation (Nos. 2021M691480, 2022M711538, 2024M750664), Dongguan Science and Technology of Social Development Program (No. 20231800932382), Science and Technology Project of Guangzhou City (No. 202201011196).

Author Contribution

Z.G.: Conceptualization, Investigation, Methodology, Writing the original draft; H.X.: Visualization, Investigation, Methodology, Validation;X.H.: Funding acquisition, Methodology, Validation, Formal analysis; J.X.: Investigation, Methodology, Validation, Formal analysis; X.L.: Funding acquisition, Investigation, Methodology; H.Y.: Funding acquisition, Methodology, Validation, Formal analysis; X.T.: Methodology, Validation, Formal analysis; C.G.: Funding acquisition, Methodology, Validation; P.M.: Validation, Formal analysis, Data curation; H.C.: Software, Formal analysis, Data curation; Z.J.: Software, Data curation; W.Y.: Funding acquisition, Project administration, Supervision, Validation; L.B.: Project administration, Methodology, Supervision, Validation; Z.Y.: Conceptualization, Funding acquisition, Project administration, Supervision, Validation.

Data Availability

Data is provided within the manuscript.

Bruno RR, Wernly B, Mamandipoor B, Rezar R, Binnebossel S, Baldia PH, et al. ICU-Mortality in Old and Very Old Patients Suffering From Sepsis and Septic Shock. Front Med (Lausanne). 2021;8:697884. doi:10.3389/fmed.2021.697884.
van der Poll T, Shankar-Hari M, Wiersinga WJ. The immunology of sepsis. Immunity. 2021;54:2450–2464. doi:10.1016/j.immuni.2021.10.012.
Kuiper JW, Plotz FB, Groeneveld AJ, Haitsma JJ, Jothy S, Vaschetto R, et al. High tidal volume mechanical ventilation-induced lung injury in rats is greater after acid instillation than after sepsis-induced acute lung injury, but does not increase systemic inflammation: an experimental study. BMC Anesthesiol. 2011;11:26. doi:10.1186/1471-2253-11-26.
Singer M, Deutschman CS, Seymour CW, Shankar-Hari M, Annane D, Bauer M, et al. The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA. 2016;315:801–810. doi:10.1001/jama.2016.0287.
Angus DC, van der Poll T. Severe sepsis and septic shock. N Engl J Med. 2013;369:840–851. doi:10.1056/NEJMra1208623.
Mohsin M, Tabassum G, Ahmad S, Ali S, Ali SM. The role of mitophagy in pulmonary sepsis. Mitochondrion. 2021;59:63–75. doi:10.1016/j.mito.2021.04.009.
Wang Z, Wang Z. The role of macrophages polarization in sepsis-induced acute lung injury. Front Immunol. 2023;14:1209438. doi:10.3389/fimmu.2023.1209438.
Auyeung KK, Han QB, Ko JK. Astragalus membranaceus: A Review of its Protection Against Inflammation and Gastrointestinal Cancers. Am J Chin Med. 2016;44:1–22. doi:10.1142/S0192415X16500014.
D'Avino D, Cerqua I, Ullah H, Spinelli M, Di Matteo R, Granato E, et al. Beneficial Effects of Astragalus membranaceus (Fisch.) Bunge Extract in Controlling Inflammatory Response and Preventing Asthma Features. Int J Mol Sci. 2023;24:10954. doi:10.3390/ijms241310954.
Hou M, Leng Y, Shi Y, Tan Z, Min X. Astragalus membranaceus as a Drug Candidate for Inflammatory Bowel Disease: The Preclinical Evidence. Am J Chin Med. 2023;51:1501–1526. doi:10.1142/S0192415X23500684.
Ma X, Wang J. Formononetin: A Pathway to Protect Neurons. Front Integr Neurosci. 2022;16:908378. doi:10.3389/fnint.2022.908378.
Li H, Jiang R, Lou L, Jia C, Zou L, Chen M. Formononetin Improves the Survival of Random Skin Flaps Through PI3K/Akt-Mediated Nrf2 Antioxidant Defense System. Front Pharmacol. 2022;13:901498. doi:10.3389/fphar.2022.901498.
Qian L, Xu H, Yuan R, Yun W, Ma Y. Formononetin ameliorates isoproterenol induced cardiac fibrosis through improving mitochondrial dysfunction. Biomed Pharmacother. 2024;170:116000. doi:10.1016/j.biopha.2023.116000.
Zhang L, Wu Q, Huang Y, Zheng J, Guo S, He L. Formononetin ameliorates airway inflammation by suppressing ESR1/NLRP3/Caspase-1 signaling in asthma. Biomed Pharmacother. 2023;168:115799. doi:10.1016/j.biopha.2023.115799.
Wang JY, Jiang MW, Li MY, Zhang ZH, Xing Y, Ri M, et al. Formononetin represses cervical tumorigenesis by interfering with the activation of PD-L1 through MYC and STAT3 downregulation. J Nutr Biochem. 2022;100:108899. doi:10.1016/j.jnutbio.2021.108899.
Yang J, Sha X, Wu D, Wu B, Pan X, Pan LL, et al. Formononetin alleviates acute pancreatitis by reducing oxidative stress and modulating intestinal barrier. Chin Med. 2023;18:78. doi:10.1186/s13020-023-00773-1
Ouyang B, Deng L, Yang F, Shi H, Wang N, Tang W, et al. Albumin-based formononetin nanomedicines for lung injury and fibrosis therapy via blocking macrophage pyroptosis. Mater Today Bio. 2023;20:100643. doi:10.1016/j.mtbio.2023.100643.
Li X, Jiang X, Zeng R, Lai X, Wang J, Liu H, et al. Formononetin attenuates cigarette smoke-induced COPD in mice by suppressing inflammation, endoplasmic reticulum stress, and apoptosis in bronchial epithelial cells via AhR/CYP1A1 and AKT/mTOR signaling pathways. Phytother Res. 2024;38:1278–1293. doi:10.1002/ptr.8104.
Yi L, Cui J, Wang W, Tang W, Teng F, Zhu X, et al. Formononetin Attenuates Airway In fl ammation and Oxidative Stress in Murine Allergic Asthma. Front Pharmacol. 2020;11:533841. doi:10.3389/fphar.2020.533841.
Guarneri F, Custurone P, Papaianni V, Gangemi S. Involvement of RAGE and Oxidative Stress in Inflammatory and Infectious Skin Diseases. Antioxidants (Basel). 2021;10:82. doi:10.3390/antiox10010082.
Hudson BI, Lippman ME. Targeting RAGE Signaling in Inflammatory Disease. Annu Rev Med. 2018;69:349–364. doi:10.1146/annurev-med-041316-085215.
He Q, Zuo Z, Song K, Wang W, Yu L, Tang Z, et al. Keratin7 and Desmoplakin are involved in acute lung injury induced by sepsis through RAGE. Int Immunopharmacol. 2023;124:110867. doi:10.1016/j.intimp.2023.110867.
Li K, Yang J, Han X. Ketamine attenuates sepsis-induced acute lung injury via regulation of HMGB1-RAGE pathways. Int Immunopharmacol. 2016;34:114–128. doi:10.1016/j.intimp.2016.01.021.
Xie J, Mendez JD, Mendez-Valenzuela V, Aguilar-Hernandez MM. Cellular signalling of the receptor for advanced glycation end products (RAGE). Cell Signal. 2013;25:2185–2197. doi:10.1016/j.cellsig.2013.06.013.
Weber DJ, Allette YM, Wilkes DS, White FA. The HMGB1-RAGE Inflammatory Pathway: Implications for Brain Injury-Induced Pulmonary Dysfunction. Antioxid Redox Signal. 2015;23:1316–1328. doi:10.1089/ars.2015.6299.
Xie L, Zhang G, Wu Y, Hua Y, Ding W, Han X, et al. Protective effects of Wenqingyin on sepsis-induced acute lung injury through regulation of the receptor for advanced glycation end products pathway. Phytomedicine. 2024;129:155654. doi:10.1016/j.phymed.2024.155654.
Li X, Jamal M, Guo P, Jin Z, Zheng F, Song X, et al. Irisin alleviates pulmonary epithelial barrier dysfunction in sepsis-induced acute lung injury via activation of AMPK/SIRT1 pathways. Biomed Pharmacother. 2019;118:109363. doi:10.1016/j.biopha.2019.109363.
Zandi E, Rothwarf DM, Delhase M, Hayakawa M, Karin M. The IkappaB kinase complex (IKK) contains two kinase subunits, IKKalpha and IKKbeta, necessary for IkappaB phosphorylation and NF-kappaB activation. Cell. 1997;91:243–252. doi:10.1016/s0092-8674(00)80406-7.
Arthur JS, Ley SC. Mitogen-activated protein kinases in innate immunity. Nat Rev Immunol. 2013;13:679–692. doi:10.1038/nri3495.
Creagh-Brown BC, Quinlan GJ, Evans TW, Burke-Gaffney A. The RAGE axis in systemic inflammation, acute lung injury and myocardial dysfunction: an important therapeutic target?. Intensive Care Med. 2010;36:1644–1656. doi:10.1007/s00134-010-1952-z.
Abraham E, Arcaroli J, Carmody A, Wang H, Tracey KJ. HMG-1 as a mediator of acute lung inflammation. J Immunol. 2000;165:2950–2954. doi:10.4049/jimmunol.165.6.2950.
Sternberg DI, Gowda R, Mehra D, Qu W, Weinberg A, Twaddell W, et al. Blockade of receptor for advanced glycation end product attenuates pulmonary reperfusion injury in mice. J Thorac Cardiovasc Surg. 2008;136:1576–1585. doi:10.1016/j.jtcvs.2008.05.032.
Fleischmann C, Scherag A, Adhikari NK, Hartog CS, Tsaganos T, Schlattmann P, et al. Assessment of Global Incidence and Mortality of Hospital-treated Sepsis. Current Estimates and Limitations. Am J Respir Crit Care Med. 2016;193:259–272. doi:10.1164/rccm.201504-0781OC.
Chousterman BG, Swirski FK, Weber GF. Cytokine storm and sepsis disease pathogenesis. Semin Immunopathol. 2017;39:517–528. doi:10.1007/s00281-017-0639-8.
Fajgenbaum DC, June CH. Cytokine Storm. N Engl J Med. 2020;383:2255–2273. doi:10.1056/NEJMra2026131.
DeMerle KM, Angus DC, Baillie JK, Brant E, Calfee CS, Carcillo J, et al. Sepsis Subclasses: A Framework for Development and Interpretation. Crit Care Med. 2021;49:748–759. doi:10.1097/CCM.0000000000004842.
Fowler AR, Truwit JD, Hite RD, Morris PE, DeWilde C, Priday A, et al. Effect of Vitamin C Infusion on Organ Failure and Biomarkers of Inflammation and Vascular Injury in Patients With Sepsis and Severe Acute Respiratory Failure: The CITRIS-ALI Randomized Clinical Trial. JAMA. 2019;322:1261–1270. doi:10.1001/jama.2019.11825.
Jarczak D, Kluge S, Nierhaus A. Sepsis-Pathophysiology and Therapeutic Concepts. Front Med (Lausanne). 2021;8:628302. doi:10.3389/fmed.2021.628302.
Scheer CS, Kuhn SO, Fuchs C, Vollmer M, Modler A, Brunkhorst F, et al. Do Sepsis-3 Criteria Facilitate Earlier Recognition of Sepsis and Septic Shock? A Retrospective Cohort Study. Shock. 2019;51:306–311. doi:10.1097/SHK.0000000000001177.
Zhang Y, Yu W, Han D, Meng J, Wang H, Cao G. L-lysine ameliorates sepsis-induced acute lung injury in a lipopolysaccharide-induced mouse model. Biomed Pharmacother. 2019;118:109307. doi:10.1016/j.biopha.2019.109307.
Zhu J, Feng B, Xu Y, Chen W, Sheng X, Feng X, et al. Mesenchymal stem cells alleviate LPS-induced acute lung injury by inhibiting the proinflammatory function of Ly6C⁺ CD8⁺ T cells. Cell Death Dis. 2020;11:829. doi:10.1038/s41419-020-03036-1.
Huang Y, Cai T, Xia X, Cai Y, Wu XY. Research Advances in the Intervention of Inflammation and Cancer by Active Ingredients of Traditional Chinese Medicine. J Pharm Pharm Sci. 2016;19:114–126. doi:10.18433/J3SG7K.
Xuan X, Zhang J, Fan J, Zhang S. Research progress of Traditional Chinese Medicine (TCM) in targeting inflammation and lipid metabolism disorder for arteriosclerosis intervention: A review. Medicine (Baltimore). 2023;102:e33748. doi:10.1097/MD.0000000000033748.
Yu X, Yang R, He Z, Zeng P. Construction and validation of a nomogram for hepatocellular carcinoma patients treated by traditional Chinese medicine based on inflammation, nutrition, and blood lipid indicators. J Cancer Res Clin Oncol. 2023;149:8969–8979. doi:10.1007/s00432-023-04830-y.
Fan TT, Cheng BL, Fang XM, Chen YC, Su F. Application of Chinese Medicine in the Management of Critical Conditions: A Review on Sepsis. Am J Chin Med. 2020;48:1315–1330. doi:10.1142/S0192415X20500640.
Li YF, Sheng HD, Qian J, Wang Y. The Chinese medicine babaodan suppresses LPS-induced sepsis by inhibiting NLRP3-mediated inflammasome activation. J Ethnopharmacol. 2022;292:115205. doi:10.1016/j.jep.2022.115205.
Fu J, Wang Z, Huang L, Zheng S, Wang D, Chen S, et al. Review of the botanical characteristics, phytochemistry, and pharmacology of Astragalus membranaceus (Huangqi). Phytother Res. 2014;28:1275–1283. doi:10.1002/ptr.5188.
Adesso S, Russo R, Quaroni A, Autore G, Marzocco S. Astragalus membranaceus Extract Attenuates Inflammation and Oxidative Stress in Intestinal Epithelial Cells via NF-κ Activation and Nrf2 Response. Int J Mol Sci. 2018;19:800. doi:10.3390/ijms19030800.
Chen Y, Wang J, Li J, Zhu J, Wang R, Xi Q, et al. Astragalus polysaccharide prevents ferroptosis in a murine model of experimental colitis and human Caco-2 cells via inhibiting NRF2/HO-1 pathway. Eur J Pharmacol. 2021;911:174518. doi:10.1016/j.ejphar.2021.174518.
He J, Li X, Yang S, Shi Y, Dai Y, Han S, et al. Protective effect of astragalus membranaceus and its bioactive compounds against the intestinal inflammation in Drosophila. Front Pharmacol. 2022;13:1019594. doi:10.3389/fphar.2022.1019594.
Zhou X, Sun X, Gong X, Yang Y, Chen C, Shan G, et al. Astragaloside IV from Astragalus membranaceus ameliorates renal interstitial fibrosis by inhibiting inflammation via TLR4/NF-κB in vivo and in vitro. Int Immunopharmacol. 2017;42:18–24. doi:10.1016/j.intimp.2016.11.006.
Wang Y, Deng F, Zhong X, Du Y, Fan X, Su H, et al. Dulaglutide provides protection against sepsis-induced lung injury in mice by inhibiting inflammation and apoptosis. Eur J Pharmacol. 2023;949:175730. doi:10.1016/j.ejphar.2023.175730.
Walter JM, Wilson J, Ware LB. Biomarkers in acute respiratory distress syndrome: from pathobiology to improving patient care. Expert Rev Respir Med. 2014;8:573–586. doi:10.1586/17476348.2014.924073.
Ko IG, Hwang JJ, Chang BS, Kim SH, Jin JJ, Hwang L, et al. Polydeoxyribonucleotide ameliorates lipopolysaccharide-induced acute lung injury via modulation of the MAPK/NF-κB signaling pathway in rats. Int Immunopharmacol. 2020;83:106444. doi:10.1016/j.intimp.2020.106444.
Ren Q, Guo F, Tao S, Huang R, Ma L, Fu P. Flavonoid fisetin alleviates kidney inflammation and apoptosis via inhibiting Src-mediated NF-κB p65 and MAPK signaling pathways in septic AKI mice. Biomed Pharmacother. 2020;122:109772. doi:10.1016/j.biopha.2019.109772.
Chen X, Han R, Hao P, Wang L, Liu M, Jin M, et al. Nepetin inhibits IL-1β induced inflammation via NF-κB and MAPKs signaling pathways in ARPE-19 cells. Biomed Pharmacother. 2018;101:87–93. doi:10.1016/j.biopha.2018.02.054.
Lutterloh EC, Opal SM, Pittman DD, Keith JJ, Tan XY, Clancy BM, et al. Inhibition of the RAGE products increases survival in experimental models of severe sepsis and systemic infection. Crit Care. 2007;11:R122. doi:10.1186/cc6184.
Liliensiek B, Weigand MA, Bierhaus A, Nicklas W, Kasper M, Hofer S, et al. Receptor for advanced glycation end products (RAGE) regulates sepsis but not the adaptive immune response. J Clin Invest. 2004;113:1641–1650. doi:10.1172/JCI18704.

No competing interests reported.

Download PDF

Editor assigned by journal
29 Aug, 2024
Submission checks completed at journal
22 Aug, 2024
First submitted to journal
17 Aug, 2024

You are reading this latest preprint version

Formononetin protects against sepsis-induced lung injury by directly inhibiting receptor for advanced glycation end products signaling pathway

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Materials

Animals

Mouse modelling and grouping

Hematoxylin and eosin (HE) staining

Enzyme-linked immunosorbent assay (ELISA)

Immunohistochemical (IHC) analysis

TUNEL staining

Molecular docking

Surface plasmon resonance imaging (SPRi)

RAW 264.7 cell culture and viability

Immunofluorescence (IF) staining

Western blot (WB)

Quantitative reverse transcription polymerase chain reaction (qRT-PCR)

Statistical analysis

Results

FMN inhibited lung injury and inflammation within septic mice

FMN inhibited apoptosis and improved lung barrier dysfunction of septic lung injury mice

FMN inhibited NF-κB and MAPKs signaling pathways of sepsis-induced lung injury mice

FMN targeted RAGE directly

FMN suppressed LPS-mediated inflammation within RAW 264.7 cells

FMN inhibited RAGE/NF-κB/MAPKs signaling pathway within LPS-exposed RAW 264.7 cells

RAGE silencing markedly abolished FMN’s inhibition against NF-κB and MAPKs signaling pathways

Discussion

Declarations

Declaration of Competing Interest

Funding

Author Contribution

Data Availability

References

Additional Declarations

Status:

Version 1