LsrK attenuates the pathogenicity of both the Gram negative bacterium Escherichia coli O157:H7 and Gram positive Staphylococcus aureus

doi:10.21203/rs.3.rs-4931544/v1

Download PDF

Research Article

LsrK attenuates the pathogenicity of both the Gram negative bacterium Escherichia coli O157:H7 and Gram positive Staphylococcus aureus

https://doi.org/10.21203/rs.3.rs-4931544/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

The Escherichia coli LsrK gene encoding a phosphorylase acting on AI-2 quorum sensing signal molecules was recombinantly expressed in the E. coli BL21(DE3). Its role on affecting the pathogenicity of both Gram negative and positive pathogens was investigated using two representative enterohemorrhagic bacteria, the E. coli O157:H7 and Staphylococcus aureus. The recombinant LsrK catalyzed degradation of the typical AI-2 signal molecule 4,5-dihydroxy-2,3-pentanedione and decreased the transcript levels of multiple virulence factors in the two bacteria (fliC, ycgR, eaeA, ompX, ycgR, and eaeA in E. coli O157:H7 and sea, eta, hlα, sdrE, bbp, and cna in S. aureus, respectively). Interestingly, LsrK inhibited formation of the biofilm in E. coli but promoted this process in S. aureus, which might be partially related to transcription repression of SaaR involved in biofilm generation. LsrK also reduced the swimming motility, hemolytic ability, cytotoxicity, and the acid-tolerating ability of the two pathogenic bacteria. These collectively suggested that LsrK could serve as a promising enzyme in combating Gram negative and positive pathogenic bacteria infection.

LsrK

quorum quenching

AI-2

pathogenic bacteria

enterohemorrhagic

Escherichia coli

Staphylococcus aureus

During invasion of their hosts, the pathogenic bacteria release signal molecules that mediate information transmission among individual bacterial cells, synchronizing expression of specific groups of genes and resultantly dictating the community phenotype such as the virulence. This phenomenon is called quorum sensing (QS) and the different types of signal molecules in the QS system can be divided into three major categories, which are AI-1, AI-2, and AI-3 [1]. The signal molecules of the AI-1 QS system are the fatty acid derivative N-acyl homoserine lactones (AHL), which are produced and sensed by Gram negative bacteria. AI-1 signal molecules are mainly for intra species communication [2]. The AI-2 quorum sensing system is present in both Gram-negative and Gram-positive bacteria. Although the structures of the signal molecules are variable, they all bear a cyclized core of 4,5-dihydroxy-2,3-pentanedione (DPD) [3]. The AI-3 quorum sensing system relies on complex peptide signal molecules [4]. Interfering with this cell-cell communication by blocking or destructing such signaling molecules (i.e. quorum quenching, QQ) commonly does not have a significant effect on bacterial growth, but it has been observed that such interference can limit the pathogenicity of the bacteria [5].

For quorum quenching, using signal molecule analogues to compete with natural signaling processes and exploiting synthetase-specific inhibitors to limit signal generation are both effective strategies [6]. In addition, there are also enzymes effective in catalyzing degradation of the signal molecules. The most extensively studied example of quorum quenching in bacteria may be represented by targeting the AI-1 AHL signal molecules for degradation. For example, the AiiD enzyme from the Ralstonia genus was the first identified AHL acyltransferase with strong quorum quenching ability [7]. The PVdQ gene of Pseudomonas aeruginosa also encodes an acyl homoserine lactone (AHL) acylase, which can degrade AHL by cleaving the amides [8].

Compared to the enzymes targeting AI-1 signaling molecules for degradation, there is much less known about the enzymes that destruct AI-2 signaling molecules. The AI-2 signaling system is closely related to many cellular processes including the pathogenicity [9], biofilm generation [10], and toxin secretion [11]. In Escherichia coli, an AI-2 kinase LsrK is known to phosphorylate the AI-2 signaling molecule intracellularly, which induces the LsrR gene transcription and subsequently initiating the expression of a series of downstream genes [12]. The phosphorylated AI-2 signaling molecule is unstable and undergoes autonomous degradation to 2-phosphoethanolic acid (PG) [13]. When LsrK-treated AI-2 is added to the E. coli population, the natural QS response is significantly reduced [14].

Unlike Gram negative pathogenic bacteria, the role of LsrK in affecting the quorum sensing in Gram positive bacteria is not known. Therefore, in this study, the LsrK from E. coli was first recombinantly expressed and its catalytic activity against DPD and natural AI-2 signaling molecules was demonstrated. Then its effect on the pathogenicity of a Gram positive bacterium was compared to a Gram negative bacterium. The Gram negative pathogen used in this research was the enterohemorrhagic E. coli (EHEC) O157:H7, which is a well-known zoonotic pathogen leading to hemorrhagic colitis, hemolytic uremia, and thrombotic thrombocytopenic purpura [15]. The Gram negative pathogen used was Staphylococcus aureus, which causes food poisoning, skin infections, and other related symptoms including fatalities [16]. These representative Gram negative and positive bacteria were treated with LsrK and the expression of their virulence factors, biofilm formation, motility and hemolytic ability, acid resistance, and invasion and pathogenicity to Caco-2 cells were determined.

Bacterial strains and growth conditions. The enterohemorrhagic E. coli O157:H7 (CVCC1491) and S. aureus (CVCC1884) were purchased from the China Veterinary Culture Collection Center. The E. coli Trans1-T1 and BL21(DE3) (Vazyme, Nanjing, China) were used for plasmid construction and recombinant protein production, respectively. The E. coli and S. aureus strains were cultured in the Luria-Bertani (LB) medium at 37°C with shaking at 220 rpm. When necessary, 50 µg/mL of kanamycin were added to the culture media of Trans1-T1 and E. coli BL21 (DE3). Caco-2 primary cells were purchased from Cas9X Biotechnology Co., Ltd. (Suzhou,China)and maintained in our laboratory.

Construction of the plasmid for expressing LsrK. The LsrK gene was amplified from the genomic DNA of BL21(DE3) using the FastPfu DNA Polymerase (Vazyme). The primers used in this study were listed in Table 1. The PCR product was analyzed on an agarose gel and the gel containing the expected 1,479 bp DNA fragment was collected. The DNA was purified from the gel using the gel extraction kit (Vazyme). The DNA fragment was then inserted into the NcoⅠ and Bpu1102Ⅰ restriction sites of pET-28a(+) (Merck, Shanghai, China), which features the encoding of a hexa-histidine tag at the N-terminus. The obtained expression plasmid pET28-LsrK was sequenced for integrity of the insert.

Table 1

**The primers used in this study**
Primer	Sequence(5′- 3′)	Usage
LsrK-F	TTTAAGAAGGAGATATACCATGG	Cloning of LsrK
LsrK-R	GATCCAGAGCTGGTCGAATGCGC	Cloning of LsrK
fliC-F	GCGAAGTTAAACACCACGAC	RT-qPCR determination of the fliC abundance
fliC-R	ACCCGTACCAGCAGTAGATT	RT-qPCR determination of the fliC abundance
hlyE-F	TAAACCAAATGGACCGGCGA	RT-qPCR determination of the hlyE abundance
hlyE-R	CGGCATCACGAAGCTGAATG	RT-qPCR determination of the hlyE abundance
ompX-F	CACCAGCGACTACGGTTTCT	RT-qPCR determination of the ompX abundance
ompX-R	TAACCAACACCGGCAATCCA	RT-qPCR determination of the ompX abundance
ycgR-F	GAAAAACACCCCATTGCCCC	RT-qPCR determination of the ycgR abundance
ycgR-R	ACGCCGATATTTCCGCATCT	RT-qPCR determination of the ycgR abundance
stx2-F	TACCACTCTGCAACGTGTCG	RT-qPCR determination of the stx2 abundance
stx2-R	AGGCTTCTGCTGTGACAGTG	RT-qPCR determination of the stx2 abundance
eaeA-F	GTAAGTTACACTATAAAAGCAC	RT-qPCR determination of the eaeA abundance
eaeA-R	TCTGTGTGGATGGTAATAAATTT	RT-qPCR determination of the eaeA abundance
sea-F	GAAAAAAGTCTGAATTGAGGGAAC	RT-qPCR determination of the sea abundance
sea-R	CAAATAAATCGTAATTAACCGAAGG	RT-qPCR determination of the sea abundance
eta-F	TGGATACTTTTGTCTATCTTTTTCATC	RT-qPCR determination of the eta abundance
eta-R	ATGCCAGCGCTCAAGGC	RT-qPCR determination of the eta abundance
hlα-F	AGTTTATAGCGAAGAAGG	RT-qPCR determination of the hlα abundance
hlα-R	TTGTTAGGGTCAAGGAAG	RT-qPCR determination of the hlα abundance
sdrE-F	GCAGCAGCGCATGACGGTAAAG	RT-qPCR determination of the sdrE abundance
sdrE-R	GICGCCACCGCCAGTGTCATTA	RT-qPCR determination of the sdrE abundance
bbp-F	TCAAAAGAAAAGCCAATGGCAAAC	RT-qPCR determination of the bbp abundance
bbp-R	ACCGTTGGCGTGTAACCTGC	RT-qPCR determination of the bbp abundance
cna-F	TTCACAAGCTTGGTATCAAGAGCAT	RT-qPCR determination of the cna abundance
cna-F	GAGTGCCTTCCCAAACCTTTTGAGC	RT-qPCR determination of the cna abundance
TNF-α-F	TATGGCTCAGGGTCCAACTC	RT-qPCR determination of the TNF-α abundance
TNF-α-R	GGAAAGCCCATTTGAGTCCT	RT-qPCR determination of the TNF-α abundance
IL-1β-F	GTTGACGGACCCCAAAAGAT	RT-qPCR determination of the IL − 1β abundance
IL-1β-R	CCTCATCCTGGAAGGTCCAC	RT-qPCR determination of the IL − 1β abundance
IL-10-F	TGTGAGAATAAAAGCAAGGCAGTG	RT-qPCR determination of the IL − 10 abundance
IL-10-R	CATTCATGGCCTTGTAGACACC	RT-qPCR determination of the IL -10 abundance
NF-κB-F	CAAGATCTGCCGAGTAAACC	RT-qPCR determination of the NF-κB abundance
NF-κB-R	TCGGAACACAATGGCCACTT	RT-qPCR determination of the NF-κB abundance
IFN-γ-F	GCTCTAGAGATTTCAACTTCTTTGGC	RT-qPCR determination of the IFN- γ abundance
IFN-γ-R	TTGTCGACGCAGGCAGGACAACCAT	RT-qPCR determination of the IFN- γ abundance
β-actin-F	CAACACAGTGCTGTCTGGGGTA	RT-qPCR (Internal reference gene)
β-actin-R	ATCGTACTCCTGCTIGCTGATCC	RT-qPCR (Internal reference gene)

Expression and purification of the recombinant LsrK. The expression plasmid pET28a-LsrK was transformed into E. coli BL21(DE3) and selected on an agar plate containing 50 µg/mL kanamycin. A single colony was randomly selected and inoculated into 50 mL of LB supplemented with 50 µg/mL kanamycin and the culture was carried out at 37°C with shaking at 220 rpm. Expression of LsrK was induced by addition of IPTG to a final concentration of 100 µM. The induction was continued at 16°C for 12 h and the bacterial cells were collected. The recombinant LsrK protein was subsequently purified using a Nickel column from the supernatant of cell lysates. The elution fractions were resolved on an SDS-PAGE gel and the purified LsrK collections were pooled and the buffer was changed to PBS (100 mM Na₂HPO₄, 50 mM NaCl, pH 7.0).

Determination of the activity of LsrK on AI- 2 signal molecules and its effect on bacterial growth. The activity of the recombinant LsrK was determined by incubating it with the substrate DPD. Subsequently, 2,3-diaminonaphthalene (DAN) was used to react with DPD to produce a new fluorescent substance with a specific excitation wavelength at 271 nm and emission at 503 nm. To determine the activity of LsrK against AI- 2 signal molecules in bacterial solution, the experimental group was the E. coli (OD₆₀₀ = 0.6) treated with 0.2 µM LsrK and 80 µM ATP for 3 h, while the control group was the cells treated with inactivated LsrK. Then, the concentration of fluorescent molecule was detected using HPLC-FLD [17].

In order to ascertain the impact of LsrK on the growth of two distinct bacterial strains, two separate bacterial cultures were inoculated into 24-well plates. In the enzyme group, 0.2 µM LsrK (containing 80 µM ATP) was added, while in the control group, an equivalent volume of inactivated enzyme solution was employed. The bacteria were cultivated at 37°C and 220 rpm, and the OD₆₀₀ value of the bacterial liquid was determined at two-hour intervals.

Determining the transcript levels of selected virulence factors in E. coli O157:H7 and S. aureus treated with LsrK. The E. coli O157:H7 and S. aureus were cultured in the LB medium at 37°C with a shaking at 220 rpm until the optical density at OD₆₀₀ reached 0.6. Then the bacterial cells were treated with LsrK in presence of 80 µM of ATP. As a control, cells were also incubated with equal amounts of inactivated enzyme and ATP. The treatment was carried out at 37 ℃ for 3 h. The cells were collected and total RNA was extracted essentially the same as above-mentioned. Reverse transcription quantitative PCR was performed to determine the transcript levels of selected virulence factors (sea, eta, hla, sdrE, bbp, and can in S. aureus, fliC, hlyE, ompX, ycgR, stx2, and eaeA in E. coli O157:H7). Equivalent amounts of cDNA from each sample (200 ng) were used in the amplification. The PCR reactions were carried out as the following: 95°C for 3 min, then 40 cycles of 95°C×30 sec, 95°C×10 sec and 60°C×30 sec. A 2^−ΔΔCt method was used to compare the expression level of selected genes. Primer sequences are listed in Table 1. The description of selected virulence factors and their toxicity was listed in Table 2.

Table 2

The selected genes encoding virulence factors and inflammatory factors in *E. coli* O157:H7 and *S. aureus*
Gene	Function	Reference
fliC	The flagellin gene is linked to exercise and adhesion.	[46]
hlyE	Hemolysin synthesis gene.	[47]
ompX	Participating in both the adhesion and invasion of cells while simultaneously resisting the host's immune defenses.	[48]
ycgR	Encoding a flagellar motor immobilization protein	[49]
stx2	Shiga-like toxin synthesis gene	[50]
eaeA	Tight adhesin synthesis gene	[51]
sea	Enterotoxin α	[52]
eta	Epidermal exfoliative toxin	[53]
hlα	Hemolysin synthesis gene	[25]
sdrE	Cell adhesion gene	[54]
bbp	Cell adhesion gene
cna	Cell adhesion gene
IL-1β	Promoting inflammation and programmed cell death (apoptosis)	[26]
TNF-α	Promoting inflammation, improving permeability, and destroying barriers	[27]
IL-10	Anti-inflammatory reaction and maintaining cell morphology	[30]
NF-κB	Activation of pro-inflammatory genes, leading to the overproduction of inflammatory factors and mediators and causing their excessive accumulation.	[28]
IFN-γ	Immunomodulatory factors collaborating with inflammatory factors to trigger an immune response during episodes of inflammation.	[29]

Assay of biofilm formation. The assay of biofilm disruption was carried out essentially the same as that described in a published protocol [18]. Crystal violet can be used to stain adherent cells in a biofilm, with the number of stained cells being directly proportional to the biofilm production. The biofilm can be quantified by measuring the absorbance of the stained system at 570 nm. Briefly, 10⁷ CFU/mL each of the virulent E. coli strain O157:H7 and S. aureus were individually inoculated into the wells of a 48-well flat-bottom polystyrene tissue culture plate containing 1 mL of the LB medium. The bacterial cells were treated with 0.15 µM active LsrK or equal amount of heat-inactivated LsrK in presence of 80 µM ATP. Biofilms were allowed to form by culturing the bacteria for 48 h at 37°C with gentle shaking at 120 rpm. The cells were then decanted and biofilms were cleansed twice using phosphate-buffered saline (PBS, 100 mM Na₂HPO₄, 50 mM NaCl, pH 7.0) and treated with 250 µL anhydrous methanol. Subsequently, each well was washed twice with aseptic saline and stained for 10 min with 0.05% (wt/vol) crystal violet. The biofilm was then washed three times again. The residual crystal violet stained with the biofilm and resultantly retained in each well was dissolved in 2 mL of 33% (vol/vol) glacial acetic acid and photographed to determine biofilm formation quantitatively. The assay was repeated five times for each sample.

Determination of the swimming and hemolysis ability of the bacteria. To determine the swimming ability of E. coli, a soft agar method was used. The soft agar (0.3%, wt/vol) was melted and cooled to 40°C before addition of 0.2 µM LsrK plus 80 µM ATP. Five µL of the overnight bacterial culture were carefully spotted to the center of the agar plate. The plate was allowed to air-dry completely and the culture was incubated at 37°C for 24 h, allowing monitoring the migration and diffusion of E. coli.

To evaluate the hemolytic properties of E. coli and S. aureus, the two bacteria were first streaked on LB agar plates. A single colony was spotted to the center of the Colombian sheep blood plate. After 12 h of anaerobic incubation, a colony became evident. Twenty µL of a mixture consisting of 0.1 µM LsrK plus 80 µΜ ATP were then carefully added to the colonies, while the control colonies received an equivalent amount of ATP in presence of inactivated LsrK. The plate was incubated at 37°C for 48 h. The diameter of the hemolysis halo was measured.

Assay of acid tolerance. The E. coli O157:H7 and S. aureus were cultured in the LB medium at 37 ℃ with shaking at 220 rpm for 12 h until the optical density at OD₆₀₀ reached 0.6. This culture was transferred into two LB media, one with the pH adjusted to 7.2 (representing the non-stress condition) and another with the pH of 4.5 (representing the acid stress condition). In the medium with pH of 4.5, the bacteria were also added with a mixture of 80 µΜ ATP and 0.2 µM LsrK or its inactivated form. Samples were periodically collected at 0 h, 2 h, 4 h, and 6 h from the cells. The samples were appropriately diluted and spread onto an LB agar plates and incubated at 37 ℃ for 24 h. The numbers of viable bacteria were determined by counting the colonies.

Assay of cytotoxicity. The epithelial Caco-2 cells grown in the Dulbecco's modified eagle medium (DMEM, Sigma, Louis, MO) which was supplemented with 10% fetal bovine serum were cultured at 37 ℃ inside a 5% CO₂ incubator. Once the cells reached the logarithmic growth phase, they were digested with Trypsin-EDTA solution (Yuanye, Shanghai, China). Thereafter, the dissociated cells were collected and then re-introduced into a Transwell chamber (Corning, NY) that was equipped with a polycarbonate membrane with a 0.4 µm pore diameter.

To assay the cytotoxicity of the pathogenic bacteria, the Caco-2 cells were incubated with 10⁷ CFU of E. coli O157:H7 or S. aureus for 3 h [19]. LsrK was then added to a final concentration of 0.5 µM. After incubation, the culture medium was replaced with 100 µL of fresh one. Ten µL of the Cell Counting Kit-8 (CCK-8, the active ingredient in this product is tetrazolium salt WST-8, chemically named 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2-magne4-disulfonphenyl)-2H-tetrazolium monosodium salt) determination solution were added to each well. Within living cells, dehydrogenase in mitochondria can reduce WST-8 to a water-soluble orange methylene dye. The number of living cells can be indirectly determined by measuring the absorbance of 450 nm using an enzyme labelling instrument. After another incubation at 37°C for 1 h, the optical density at a wavelength of 450 nm (OD₄₅₀) for each cell was monitored using a Spectrophotometer (Shimadzu, Kyoto). The viability of the cells was calculated as the following: OD₄₅₀(LsrK)/OD₄₅₀(non-treatment)×100%.

Statistical Analysis. The data were analyzed using one-way analysis of variance (ANOVA) and Duncan’s multiple range test in SPSS 14.0 software. Statistical significance was considered when p < 0.05. Additionally, data visualization graphs were created using Origin 2023 software.

LsrK is active on AI-2 signal molecules and has no effect on growth of selected E. coli and S. aureus.

The Lsrk gene was overexpressed in the E. coli BL21(DE3) strain and the recombinant protein was purified to near homogeneity using immobilized affinity chromatography (IMAC) (Fig. 1A). The recombinant LsrK had no effect on growth of the two selected bacteria, i.e. E. coli and S. aureus (Fig. 1B). LsrK could catalyze transformation of the model signaling compound DPD, as could be visualized by the decreased peak height in the HPLC analysis (Fig. 1C). The E. coli O157:H7 cultured in LB was detected to excrete the AI-2 type signaling molecule. Treating the bacterium with LsrK for 3 h considerably decreased the concentration of the AI-2 signaling molecule in the supernatant (Fig. 1D). These collectively confirmed that LsrK is active on AI-2 signaling molecules.

LsrK down-regulated transcription of virulence factors in both E. coli and S. aureus but differed in affecting biofilm formation

Then, LsrK at four different concentrations (0.05 mM, 0.1 mM, 0.15 mM, and 0.2 mM) was incubated with E. coli and S. aureus for 6 h. Six representative genes in E. coli O157:H7 (fliC, ycgR, and eaeA, which are related to mobility and adhesion; the hemolysin synthesis-related gene hlyE; the cell invasion gene ompX; and the Shiga toxin synthesis gene stx2) and S. aureus (the enterotoxin A synthesis gene sea, the epidermal exfoliative toxin synthesis gene eta, the hemolysin synthesis gene hlα, and the cell adhesion-related genes sdrE, bbp, and can) were selected for analysis of their transcript abundance. For both pathogenic bacteria, adding incrementing amounts of LsrK had a similarly dose-dependent inhibitory effect on transcription of all these genes. For E. coli, the most significant inhibitory effect was observed for eaeA, with transcript levels decreasing to as low as 38.6 % at 0.1~0.2 mM of LsrK (Fig. 2A). For S. aureus, the inhibition was most prominent for bbp and cna, whose transcript levels were downregulated to 36.9% and 38.9% at 0.2 mM of LsrK (Fig. 2B). Biofilm formation is a phenotype controlled by the bacterial quorum sensing [6]. As expected, in E. coli, there was an inhibition rate of 27.6% when 0.1 mM of LsrK was used. This rate gradually increased to 48.7% when the concentration of LsrK was increased to 0.15 mM. There was no further increase in the inhibition rate in E. coli when the concentration of LsrK was increased to 0.2 mM or higher (Fig. 2C).

Surprisingly, adding LsrK to the E. coli culture stimulated formation of biofilm. A stimulating rate of 21.5% was observed when 0.15 mM of LsrK was used and the stimulation was slightly increased to 26.6% when 0.3 mM of LsrK was used (Fig. 2C, Fig. S1). In S. aureus, SaaR gene is crucial in directing the synthesis of polysaccharides within biofilm. The gene iacR represses SaaR expression, which in turn impedes the formation of biofilm [20]. Therefore, these two genes were selected as representative genes responsible for biofilm formation and their transcript abundance was measured in S. aureus treated with LsrK. Interestingly, SaaR was up-regulated and iacR was down-regulated in LsrK-treated S. aureus, suggesting that LsrK treatment promoted biofilm formation at least in part by affecting transcription of these two key genes (Fig. 2D).

The swimming motility of E. coli and the hemolytic ability of both pathogenic bacteria were decreased by LsrK

E. coli, but not S. aureus, has a character of swimming motility. Several virulence factors have been identified to be involved in the pathogenicity of E. coli, among which the swimming motility is one major factor [21]. Importantly, there are accumulating pieces of evidence indicating that quorum sensing could play an important role in conferring the swimming motility of E. coli [22]. In this study, it was discovered that incubating LsrK with E. coli decreased the swimming motility of E. coli on agar plates, as reflected by the measured colony diameters [23](Fig. 3A).

The hemolytic ability is an important virulence factor for both E. coli O157:H7 and S. aureus, which appears also to be influenced by the quorum sensing of bacterial cells [24]. Using the hemolytic halo as an indicator, it was discovered that treating E. coli O157:H7 and S. aureus on the agar plates largely diminished the hemolytic ability of the two bacteria, indicating that the corresponding quorum sensing was quenched by LsrK (Fig. 3B).

LsrK decreased the infiltration and inflammation-triggering ability of the pathogens

Another important character of pathogenic bacteria is their ability to infiltrate the host cells, e.g. the gut epithelial cells for E. coli and S. aureus [15, 25]. Similar to the swimming motility and hemolytic ability, the ability to infiltrate gut epithelial cells and trigger inflammation has been reported to be influenced by the quorum sensing. The study assessed the ability of these two pathogenic bacteria, commonly present in the intestines of patients and diseased animals, to invade Caco-2, a model intestinal epithelial cell line. As shown in Fig. 4A, incubation of LsrK with E. coli for 3 h decreased its ability to infiltrate Caco-2 cells by 13.6%. When the incubation time was extended to 12 h, the change of infiltration ability was not significant, likely because the enzyme was not stable and became inactive in the prolonged incubation. A similar pattern was also discovered for S. aureus infiltrating Caco-2 (Fig. 4B). The transcription of cytokines excreted by the Caco-2 cells to be involved in triggering inflammation was also determined. It was discovered that incubation of Lsrk with E. coli largely reduced its ability to stimulate Caco-2 cells to transcribe the genes coding for IL-1β [26], TNF-α [27], NF-κB [28], and IFN-γ [29], which were known factors triggering inflammation. On the contrary, the ability of Caco-2 to excrete IL-10 was stimulated (Fig. 4C). Unlike the former four cytokines, IL-10 is known to be beneficial for inflammation [30]. A similar response was also discovered for S. aureus infiltrating the Caco-2 cells (Fig. 4D).

LsrK decreased the acid-tolerating ability of both pathogenic bacteria

To reach and colonize in the intestine, the pathogenic gut bacteria have to pass the stomach, where the pH can be as low as 2.0 [31]. The ability to survive this extremely acidic environment is the first prerequisite for E. coli and S. aureus to exert their pathogenicity. The effect of quorum sensing on acid tolerance has been reported for the probiotic bacteria lactobacilli [4], but not known for gut pathogenic bacteria. For the two pathogens investigated, if the same quorum sensing mechanism exists, then quorum quenching using a responsive enzyme could down-regulate their ability to survive in the acidic pH. Indeed, treating E. coli with LsrK for 2, 4, and 6 h lowered the colony forming units of this bacterium from 1.8×10¹⁰ to 1.3×10⁷, 1.1×10⁸to 8.5×10⁶, and 6.3×10⁷to 4.5×10⁴ CFU/mL, respectively (Fig. 5A). With the same time scale, this enzyme could similarly decreased the forming units of S. aureus from 3.5×10¹¹ to 1.1×10⁸, 9.1×10⁹to 1.5×10⁷, and 9.3×10⁷to 5.5×10⁵ CFU/mL, respectively (Fig. 5B).

Unlike AI-1, the QS system mediated by AI-2 signal molecules is found in both Gram-positive and Gram-negative bacteria. In addition, a strong association has been observed between AI-2-mediated QS and the generation of virulence factors, pathogenicity, and biofilm formation [32–34]. Specifically, in E. coli and Salmonella, the LSR AI-2 signaling pathway involves the kinase LsrK, which phosphorylates the AI-2 signal molecules inside the cells to activate the QS response. On the other hand, using LsrK to phosphorylate AI-2 signal molecules in vitro can prevent them from entering the cells [14]. This suggests that LsrK can potentially be used for quorum quenching in both Gram positive and negative bacteria, leading to reduction of their pathogenicity and stress resistance.

Note that LsrK requires ATP for phosphorylation. While this can be added in the in vitro analyses, there exists the concern about the cost of this enzymatic method of quorum quenching. However, given that E. coli and S. aureus are intestinal pathogens, LsrK could be used in preventing their infection in the digestive tract. In the gut of the humans and animals, L-cells (a kind of intestinal secretory cells) can secrete ATP [35]. In addition, gut bacteria also discharge non-negligible amounts of ATP to accomplish bacteria-bacteria and bacteria-host interaction [36]. Indeed, ATP has been determined to exist at a concentration of 0.8 mM within the intestinal lumen [37]. Further experiments are needed to determine if the ATP in the intestinal tract is sufficient for in situ phosphorylation by LsrK.

Herein, LsrK was demonstrated to have divergent effects on biofilm development in the two pathogenic bacteria. Such a phenomenon has also been recorded in previous investigations [20]. These findings were in accordance with the fact that AI-2 signal molecules are widely present. Interestingly, an opposing trend of regulation was observed for E. coli, indicating that eliminating the signal molecules could incite very different signal transduction pathways and resultant phenotypes. Such divergence may be of physiological relevance, as the differed phenotypes might confer a competitive advantage for specific bacteria during inter-species competition or colonization of the host. For example, Salmonella (and some other bacteria, as well) can fortify their immune evasion and colonization abilities by dampening their own pathogenicity [38]. This may be an evolutionary tactic employed by specific bacteria.

One important finding in this study is that the pathogenicity of both E. coli and S. aureus can be reduced by LsrK-catalyzed quorum quenching. Nonetheless, there are also many pathogenic bacteria not relying on the AI-2 QS system or having yet-to-be-discovered QS pathways. This necessitates the testing of more pathogenic bacteria for the usefulness of Lsrk in quorum quenching. Moreover, for intestinal symbiotic bacteria, the AI-2 QS system could play an important role in their colonization and resistance against microbiome disorders. For example, some probiotics such as Lactobacillus spp. use AI-2 QS to enhance their colonization, antioxidant capacity [38], and production of probiotics such as phenyllactic acid [39]. Within the intestinal tract of animals, there exist millions of bacteria that coexist to maintain intestinal homeostasis. The invasion or outbreak of pathogenic bacteria can disrupt this homeostasis [40]. The homeostasis of the intestinal microbiota and their engaging with the host appear to be, at least partially, maintained through quorum sensing [41]. In addition, AI-2-mediated interspecific and intraspecific communication appears to be more common in rumen microflora [42]. These facts suggest that the use of AI-2 signal molecules-degrading enzymes could potentially harm the initial microflora. Therefore, it is crucial to further conduct more detailed investigations on the disparity of the QS systems in the pathogenic and symbiotic bacteria and decipher how they would respond differently to the LsrK treatment.

In EHEC, the principal genes responsible for their pathogenicity can be mainly ascribed to a virulence island encoding adhesion factor, Shiga toxin, and hemolysin [43]. S. aureus has the capability to produce pathogenic factors such as exotoxins, enterotoxins, and agglutination factors [44]. Herein, LsrK was discovered to affect the virulence factors, swimming ability, hemolysis, acid tolerance, and cytotoxicity in both E. coli and S. aureus. However, it is important to note that the pathogenicity of these bacteria can be far beyond these. Therefore, further investigation is necessary to explore potential genes regulated by AI-2 signaling molecules. It is also important to note that multiple QS systems (such as AI-1) can co-exist in a pathogenic bacterium. In that case, simultaneous quenching of multiple QS signals is a potential method for maximal reduction of the pathogenicity through QS quenching. Indeed, there are successful examples in quorum quenching of other QS signals such as the AI-1 molecule in the fish pathogenic bacterium Aeromonas hydrophila [45]. In addition, it is also important to note that manipulation of the QS system alone does not impede the growth of the pathogenic bacteria. Nevertheless, quorum quenching can substantially change the bacterial phenotype and reduce their resistance to drugs and ability to colonize. This means that in the endeavors to use enzyme-catalyzed quorum quenching to replace antibiotics, other enzymes or active substances may also have to be supplemented.

In summary, by quenching the AI-2 QS system, LsrK offers a new approach to treating the infection of both Gram negative and positive pathogenic bacteria. This method can potentially reduce the over-reliance on antibiotics. Moving forward, it is crucial to gain more insights on the QS signaling pathways, which will be helpful to design effective and safe quorum-quenching enzymes in combatting the drug-resistant pathogenic bacteria.

CRediT authorship contribution statement

Daoxin Yang: Conducted experimental operations, analyzed data, and wrote the article. Wenjing Zhang, Zhenzhen Hao, and Kairui Guo: Provided project support and jointly completed part of the experiment. Huiying Luo and Bin Yao: Provided project funding support. Xiaoyun Su: Provided experimental design, financial support, and guidance, as well as article revision. Huoqing Huang: Provided financial support and also revised the article.

Declaration of Competing Interest

The authors declare no conflict of interest.

Data Availability

The datasets analyzed during the current study may be available from the corresponding author on reasonable request.

Funding

This research was funded by National Key R&D Program of China (2022YFC2104805), National Natural Science Foundation of China (32222082), the Strategic Priority Research Program of the National Center of Technology Innovation for Pigs (NCTIP-XD/C07) and the Strategic Priority Research Program of the National Center of Technology Innovation for Pigs (NCTIP-XD/C07).

Ethics Approval

This study did not involve ethical review

Consent to Participate

Informed consent was obtained from all individual participants included in the study.

Consent for Publication

This study is not applicable.

Conflicts of Interest

The authors declare no competing interests.

Haque S, Ahmad F, Dar SA, Jawed A, Mandal RK, Wahid M, Lohani M, Khan S, Singh V, Akhter N. Developments in strategies for Quorum Sensing virulence factor inhibition to combat bacterial drug resistance. Microb Pathog. 2018;121:293–302.
Cui X, Harling R. N-acyl-homoserine lactone-mediated quorum sensing blockage, a novel strategy for attenuating pathogenicity of Gram-negative bacterial plant pathogens. Eur J Plant Pathol. 2005;111(4):327–39.
Schauder S, Shokat K, Surette MG, Bassler BL. The LuxS family of bacterial autoinducers: biosynthesis of a novel quorum-sensing signal molecule. Mol Microbiol. 2001;41(2):463–76.
Qian X, Tian PJ, Zhao JX, Zhang H, Wang G, Chen W. Quorum sensing of lactic acid bacteria: progress and insights. Food Rev Int. 2023;39(7):4781–92.
Rasko DA, Moreira CG, Li DR. Targeting QseC signaling and virulence for antibiotic development. Science. 2008;321(5892):1078–80.
Rasmussen TB, Givskov M. Quorum-sensing inhibitors as anti-pathogenic drugs. Int J Med Microbiol. 2006;296(2–3):149–61.
Lin YH, Xu JL, Hu JY, Wang LH, Ong SL, Leadbetter JR, Zhang LH. Acyl-homoserine lactone acylase from Ralstonia strain XJ12B represents a novel and potent class of quorum-quenching enzymes. Mol Microbiol. 2003;47(3):1592.
Papaioannou E, Wahjudi M, Nadal-Jimenez P, Koch G, Setroikromo R, Quax WJ. Quorum-quenching acylase reduces the virulence of Pseudomonas aeruginosa in a Pseudomonas aeruginosa infection model. Antimicrob Agents Ch. 2009;53(11):4891–7.
Ahmed NA, Petersen FC, Scheie AA. AI-2/LuxS is involved in increased biofilm formation by Streptococcus intermedius in the presence of antibiotics. Antimicrob Agents Ch. 2009;53(10):4258–63.
Yadav MK, Vidal JE, Go YY, Kim SH, Chae SW, Song JJ. The LuxS/AI-2 Quorum-Sensing System of Streptococcus pneumoniae is required to cause disease, and to regulate virulence- and metabolism-related genes in a rat model of middle ear infection. Front Cell Infect Mi. 2018;8:138.
Caicedo JC. Quorum Sensing, its role in virulence and symptomatology in bacterial citrus canker. Citrus Pathology 2017, Chap. 4:Chapter4.
Wang L, Hashimoto Y, Tsao CY, Valdes JJ, Bentley WE. Cyclic AMP (cAMP) and cAMP receptor protein influence both synthesis and uptake of extracellular autoinducer 2 in Escherichia coli. J Bacteriol. 2005;187(6):2066–76.
Pereira CS, Santos AJ, Bejerano-Sagie M, Correia PB, Marques JC, Xavier KB. Phosphoenolpyruvate phosphotransferase system regulates detection and processing of the quorum sensing signal autoinducer-2. Mol Microbiol. 2012;84(1):93–104.
Roy V, Fernandes R, Tsao CY, Bentley WE. Cross species quorum quenching using a native AI-2 processing enzyme. Acs Chem Biol. 2010;5(2):223–32.
Vidovic S, Korber DR. Escherichia coli O157: Insights into the adaptive stress physiology and the influence of stressors on epidemiology and ecology of this human pathogen. Crit Rev Microbiol. 2016;42(1):83–93.
Lam JC, Stokes W. The golden grapes of wrath -staphylococcus aureus bacteremia: a clinical review. Am J Med. 2023;136(1):19–26.
Song XN, Qiu HB, Xiao X, Cheng YY. Determination of autoinducer-2 in biological samples by high-performance liquid chromatography with fluorescence detection using pre-column derivatization. J Chromatogr A. 2014;1361:162–8.
Plyuta V, Zaitseva J, Lobakova E, Zagoskina N, Kuznetsov A, Khmel I. Effect of plant phenolic compounds on biofilm formation by Pseudomonas aeruginosa. Apmis. 2013;121(11):1073–81.
Gagnon MZB. Annina;: Comparison of the Caco-2, HT-29 and the mucus-secreting HT29-MTX intestinal cell models to investigate Salmonella adhesion and invasion. J Microbiol Meth. 2013;94(3):274–9.
Haipeng S. Study on binary signal system and LuxS/AI-2 quorum sensing function of Staphylococcus aureus. Univ Sci Technol China 2014.
Freter R, O'Brien PC. Role of chemotaxis in the association of motile bacteria with intestinal mucosa: chemotactic responses of Vibrio cholerae and description of motile nonchemotactic mutants. Infect Immun. 1981;34(1):222–33.
Laganenka L, Lee J-W, Malfertheiner L, Dieterich CL, Fuchs L, Piel J, von Mering C, Sourjik V, Hardt W-D. Chemotaxis and autoinducer-2 signalling mediate colonization and contribute to co-existence of Escherichia coli strains in the murine gut. Nat Microbiol. 2023;8(2):204–17.
Jahid IK, Mizan MF, Ha AJ, Ha SD. Effect of salinity and incubation time of planktonic cells on biofilm formation, motility, exoprotease production, and quorum sensing of Aeromonas hydrophila. Food Microbiol. 2015;49:142–51.
Wang H, Chu W, Ye C, Gaeta B, Tao H, Wang M, Qiu Z. Chlorogenic acid attenuates virulence factors and pathogenicity of Pseudomonas aeruginosa by regulating quorum sensing. Appl Microbiol Biot. 2018;103(2):903–15.
Surewaard BGJ, Thanabalasuriar A, Zeng ZT, Tkaczyk C, Cohen TS, Bardoel BW, Jorch SK, Deppermann C, Wardenburg JB, Davis RP, et al. Alpha-Toxin induces plateletaggregation and liver injury during Staphylococcus aureus sepsis. Cell Host Microbe. 2018;24(2):271–86.
Lopetuso LR, Chowdhry S, Pizarro TT. Opposing functions of classic and novel IL-1 family members in gut health and disease. Front Immunol. 2013;4:4.
Ciebiera M, Wlodarczyk M, Zgliczynska M, Lukaszuk K, Meczekalski B, Kobierzycki C, Lozinski T, Jakiel G. The role of tumor necrosis factor alpha in the biology of uterine fibroids and the related symptoms. Int J Mol Sci 2018, 19(12).
Christian F, Smith EL, Carmody RJ. The regulation of NF-kappaB subunits by phosphorylation. Cells. 2016;5(1):5.
Dubrot J, Du PP, Lane-Reticker SK. In vivo CRISPR screens reveal the landscape of immune evasion pathways across cancer. Nat Immunol. 2022;23(10):1495–506.
Neumann C, Scheffold A, Rutz S. Functions and regulation of T cell-derived interleukin-10. Semin Immunol. 2019;44:101344.
Manners MJ. The development of digestive function in the pig. P Nutr Soc. 2007;35(1):49–55.
Li H, Li X, Wang Z, Fu Y, Ai Q, Dong Y, Yu J. Autoinducer-2 regulates Pseudomonas aeruginosa PAO1 biofilm formation and virulence production in a dose-dependent manner. BMC Microbiol. 2015;15(1):15192.
Wang Z, Xiang Q, Yang T, Li L, Yang J, Li H, He Y, Zhang Y, Lu Q, Yu J. Autoinducer-2 of Streptococcus mitis as a target molecule to inhibit pathogenic multi-species biofilm formation in vitro and in an endotracheal intubation rat model. Front Microbiol. 2016;7:88.
Duan K, Dammel C, Stein J, Rabin H, Surette MG. Modulation of Pseudomonas aeruginosa gene expression by host microflora through interspecies communication. Mol Microbiol. 2003;50(5):1477–91.
Lu VB, Rievaj J, O'Flaherty EA, Smith CA, Pais R, Pattison LA, Tolhurst G, Leiter AB, Bulmer DC, Gribble FM, et al. Adenosine triphosphate is co-secreted with glucagon-like peptide-1 to modulate intestinal enterocytes and afferent neurons. Nat Commun. 2019;10(1):1029.
Proietti M, Perruzza L, Scribano D, Pellegrini G, D'Antuono R, Strati F, Raffaelli M, Gonzalez SF, Thelen M, Hardt WD, et al. ATP released by intestinal bacteria limits the generation of protective IgA against enteropathogens. Nat Commun. 2019;10(1):250.
Malo MS, Moaven O, Muhammad N, Biswas B, Alam SN, Economopoulos KP, Gul SS, Hamarneh SR, Malo NS, Teshager A, et al. Intestinal alkaline phosphatase promotes gut bacterial growth by reducing the concentration of luminal nucleotide triphosphates. Am J Physiol-Gastr L. 2014;306(10):G826–838.
Tanner JR, Kingsley RA. Evolution of Salmonella within Hosts. Trends Microbiol. 2018;26(12):986–98.
Chai Y, Ma Q, Nong X, Mu X, Huang A. Dissecting LuxS/AI-2 quorum sensing system-mediated phenyllactic acid production mechanisms of Lactiplantibacillus plantarum L3. Food Res Int. 2023;166:112582.
James KR, Gomes T, Elmentaite R, Kumar N, Gulliver EL, King HW, Stares MD, Bareham BR, Ferdinand JR. Distinct microbial and immune niches of the human colon. Nat Immunol. 2020;21(3):343–53.
Zhang Y, Ma N, Tan P, Ma X. Quorum sensing mediates gut bacterial communication and host-microbiota interaction. Crit Rev Food Sci Nutr 2022:1–13.
Liu X, Liu Q, Sun S, Sun H, Wang Y, Shen X, Zhang L. Exploring AI-2-mediated interspecies communications within rumen microbial communities. Microbiome. 2022;10(1):167.
Asakura M, Hinenoya A, Alam MS, Shima K, Zahid SH, Shi L, Sugimoto N, Ghosh AN, Ramamurthy T, Faruque SM, et al. An inducible lambdoid prophage encoding cytolethal distending toxin (Cdt-I) and a type III effector protein in enteropathogenic Escherichia coli. Proc Natl Acad Sci U S A. 2007;104(36):14483–8.
Chessa D, Ganau G, Mazzarello V. An overview of Staphylococcus epidermidis and Staphylococcus aureus with a focus on developing countries. J Infect Dev Ctries. 2015;9(6):547–50.
Zhou S, Zhang A, Yin H, Chu W. Bacillus sp. QSI-1 modulate quorum sensing reduce Aeromonas hydrophila level and alter gut microbial community structure in fish. Front Cell Infect Mi. 2016;6:184.
Rossez Y, Wolfson EB, Holmes A, Gally DL, Holden NJ. Bacterial lagella: Twist and stick, or dodge across the Kingdoms. Plos Pathog. 2015;11(1):e1004483.
Oscarsson J, Mizunoe Y, Li L, Lai XH, Wieslander Å, Uhlin BE. Molecular analysis of the cytolytic protein ClyA (SheA) from Escherichia coli. Mol Microbiol. 1999;32(6):1226–38.
Otto K, Hermansson M. Inactivation of ompX causes increased interactions of type 1 fimbriated Escherichia coli with abiotic surfaces. J Bacteriol. 2004;186(1):226–34.
Hou YJ, Yang WS, Hong Y, Zhang Y, Wang DC, Li DF. Structural insights into the mechanism of c-di-GMP-bound YcgR regulating flagellar motility in Escherichia coli. J Biol Chem. 2020;295(3):808–21.
Bitzan M. Treatment options for HUS secondary to Escherichia coli O157:H7. Kidney Int. 2009;75:S62–6.
Xu XG, Zhao HN, Zhang Q, Ding L, Li ZC, Li W, Wu HY, Chuang KP, Tong DW, Liu HJ. Oral vaccination with attenuated salmonella entericaserovar typhimurium expressing Cap protein of PCV2 and its immunogenicity in mouse and swine models. Vet Microbiol. 2012;157(3–4):294–303.
Grumann D, Nübel U, Bröker BM. Staphylococcus aureus toxins - Their functions and genetics. Infect Genet Evol. 2014;21:583–92.
Kawada-Matsuo M, Shammi F, Oogai Y, Nakamura N, Sugai M, Komatsuzawa H. C55 bacteriocin produced by ETB-plasmid positive Staphylococcus aureus strains is a key factor for competition with S. aureus strains. Microbiol Immunol. 2016;60(3):139–47.
Sharp JA, Echague CG, Hair PS, Ward MD, Nyalwidhe JO, Geoghegan JA, Foster TJ, Cunnion KM. Surface protein SdrE binds complement regulator factor H as an Immune evasion tactic. PLoS ONE. 2012;7(5):1204.

No competing interests reported.

Supplementaryfile1.docx

Download PDF

Reviewers agreed at journal
26 Oct, 2024
Reviewers invited by journal
11 Sep, 2024
Editor invited by journal
03 Sep, 2024
Editor assigned by journal
03 Sep, 2024
Submission checks completed at journal
30 Aug, 2024
First submitted to journal
17 Aug, 2024

You are reading this latest preprint version

LsrK attenuates the pathogenicity of both the Gram negative bacterium Escherichia coli O157:H7 and Gram positive Staphylococcus aureus

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Results

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1