Analysis of Brucella melitensis wbkC protein affecting the lncRNA expression profiles of RAW264.7 cells and mining of autophagy pathway lncRNAs

doi:10.21203/rs.3.rs-4932800/v1

Download PDF

Research Article

Analysis of Brucella melitensis wbkC protein affecting the lncRNA expression profiles of RAW264.7 cells and mining of autophagy pathway lncRNAs

https://doi.org/10.21203/rs.3.rs-4932800/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Brucellosis is a veterinary and human disease caused by Brucella, which not only causes serious public safety but also affects the development of animal husbandry and international trade. The formyl transferase encoded by the wbkC gene plays an important role in the synthesis of lipopolysaccharide (LPS), an important virulence factor of Brucella melitensis. Long-stranded non-coding RNAs (lncRNAs), as an emerging regulatory molecule, are thought to be extensively involved in the regulation of cellular activities. In this paper, by studying the analysis of Brucella melitensis. wbkC protein affecting the lncRNA expression profile of RAW264.7 cells and the mining of autophagy pathway lncRNAs in the sheep species, the aim of this study was to reveal the mechanism by which B. melitensis affects macrophage autophagy and intracellular survival.

Methods

In this study, B. melitensis wbkC protein was obtained by prokaryotic expression, and polyclonal antibody to wbkC protein was prepared by immunizing rabbits. Recombinant adenovirus for wbkC gene overexpression was prepared to mediate wbkC overexpression in RAW264.7 cells with Ad_wbkC. The wbkC protein was analyzed to affect the lncRNA expression profile of RAW264.7 cells by transcriptomics sequencing technology to mine the autophagy pathway-related lncRNAs.

Results

The results showed that Ad_wbkC successfully mediated the overexpression of wbkC in RAW264.7 cells, and a total of 32 expression up-regulated lncRNAs versus 30 expression down-regulated lncRNAs were identified in the Ad_wbkC group as compared with the control group. By analyzing the functional enrichment of the lncRNA target genes GO and KEGG, the lncRNAs with TOP15 expression related to autophagy were screened for qRT-PCR validation. The validation results showed that lncRNA 4933430A20Rik and lncRNA B930036N10Rik were consistent with the sequencing results.

Conclusions

B. melitensis wbkc protein further affects macrophage autophagy and intracellular survival by influencing lncRNA expression.

B. melitensis

wbkC

autophagy

lncRNA

Brucellosis is a virulent zoonotic infection caused by Brucella melitensis. Brucellosis mainly affects the reproductive tract, causing abortions and reduced fertility in humans and animals, and its clinical signs include endometritis, orchitis, epididymitis, etc.[1, 2] Brucellosis not only causes serious public safety and health problems, but also affects the livestock industry and international trade [3, 4]. Vaccination is by far the most effective measure to prevent brucellosis.[5, 6] Brucella is a Gram-negative, parthenogenetic intracellular parasitic bacterium, which has so far been classified into 12 species depending on the host [7]. B. melitensis has been isolated mainly from sheep and goats, and it is the most prevalent and virulent species of Brucella, whose infection of both humans and animals leads to serious diseases with a high morbidity rate [8, 9].

Lipopolysaccharide (LPS) is an important virulence factor of Brucella, which consists of lipid A, core oligosaccharide and O-side chain, and the presence or absence of O-side chain in LPS is a criterion for distinguishing smooth Brucella from rough Brucella [10]. It has been shown that the O-side chain of Brucella abortus can be involved in resistance to damage by non-immune serum, has the ability to regulate cellular autophagy and host immune response, and is an important protein for immune escape from Brucella melitensis [11–13]. wbkC gene encodes a formyltransferase, which plays an important role in the synthesis of the O-side chain in Brucella [14–16]. The Brucella ΔwbkC mutant changes from a smooth to a rough phenotype and is significantly less virulent, so wbkC is considered a potential target for brucellosis vaccine development[17].

Long stranded non-coding RNAs (lncRNAs) play a regulatory role in cellular activities, and they regulate a variety of cellular life activities such as autophagy, apoptosis, and cell differentiation [18–20]. It has been shown that Brucella can regulate the level of autophagy in target cells to promote its own survival and replication, which is key to its immune escape [21]. However, the molecular mechanism by which wbkC affects Brucella-mediated autophagy in target cells remains unclear. Therefore, in this study, we obtained melitensis wbkC protein by prokaryotic expression and analyzed the lncRNA expression profile of RAW264.7 cells affected by B. melitensis wbkC protein to further mine the autophagy pathway-related lncRNAs.This helps to reveal the molecular mechanism of B. melitensis affecting cellular autophagy and provides a theoretical basis for brucellosis treatment and prevention.

2.1 cell culture

The RAW264.7 macrophage cell line was purchased from the Cell Bank of the Chinese Academy of Sciences, and the 293A cell line was purchased from Wuhan Purcellino. Cells were cultured in Dulbecco's modified eagle medium (DMEM; Gibco, USA) containing 10% fetal bovine serum (Gibco, USA) at 5% CO₂, 37°C. The cells were incubated in the Dulbecco's modified eagle medium (DMEM; Gibco, USA).

2.2 Prokaryotic expression and characterization of wbkC

The wbkC gene was amplified and purified from the B. melitensis M5-90 genome as a template using the primers wbkC-F: GCGCGGATCCATGGCGATTGCACCAAATACA (bold underlined BamH Ⅰ cleavage site); wbkC-R: CGCGAAGCTTCGAGGGAATACCCCTCATAAG (Hind Ⅲ cleavage sites are boldly underlined). The wbkC gene fragment was ligated into the pET-28a vector to construct the recombinant plasmid pET-28a-wbkC, which was subsequently transfected into the receptor E.coli BL21 (DE3). The concentration and time of IPTG-induced expression were optimized separately, and the optimized conditions were used to induce protein expression to obtain the recombinant fusion protein His-wbkC. The recombinant fusion protein His-wbkC was identified by Western blot, the primary antibody was Mouse-Anti-His Tag (Thermo Fisher Scientific, USA) and the secondary antibody was Goat-Anti-Mouse, HRP (Thermo Fisher Scientific, USA).

2.3 Preparation of polyclonal antibodies to wbkC protein

The recombinant fusion protein His-wbkC was purified using a Ni²⁺-NTA purification column (QIAGEN, Germany), and the purified recombinant fusion protein His-wbkC was used for the preparation of animal immune antigens. Primary immunizing antigen was prepared by emulsifying 678 µL His-wbkC (442.4 µg/mL) with an equal amount of Fuchs' complete adjuvant, and secondary and tertiary immunizing antigens were prepared by emulsifying 542 µL His-wbkC (442.4 µg/mL) with an equal amount of Fuchs' incomplete adjuvant. Six New Zealand male rabbits were randomly divided into a control group and a test group. The test group was immunized for the first time with a subcutaneous injection of 1,356 µL of immune antigen, and then the second and third immunizations were carried out 14 and 28 d later with a subcutaneous injection of 1,084 µL of immune antigen, while the control group was injected with an equal amount of physiological saline subcutaneously. The sera of animals were collected on 38d, and the polyclonal antibody potency was determined using indirect ELISA, and the polyclonal antibody specificity was detected by Western blot, and the secondary antibody was Goat Anti-Rabbit HRP (Abcam, Britain). The experimental animals were purchased from the Experimental Animal Center of Chongqing Medical University, and all procedures of animal testing were reviewed and approved by the Animal Care and Use Committee of Southwest University.

2.4 Preparation of Ad_wbkC recombinant adenovirus

The wbkC gene was amplified and purified from the B. melitensis M5-90 genome as a template using the primers wbkC-F: GCGCGAATTCATGGCGATTGCACCAAATACA (EcoR Ⅰ cleavage site in bold underline); wbkC-R: CGCGAAGCTTCGAGGGAATACCCCTCATAAG (Hind Ⅲ cleavage sites are boldly underlined). The wbkC gene fragment was ligated into the ADV4 vector to construct the shuttle expression plasmid ADV4-wbkC. Recombinant adenovirus was prepared and amplified and purified by cotransfection of ADV4-wbkC or ADV4 with the backbone plasmid pGP-Ad-Pac into 293A cells.

293A cells were inoculated in 96-well plates at a density of 1×104, and the recombinant adenovirus was diluted multiplicatively to 10 − 1, 10 − 2, 10 − 3, and 10 − 4, and the diluted recombinant adenovirus was added and incubated for 72 h according to 100 µL per well. The cytopathic effect (CPE) was recorded at each dilution, and the recombinant adenovirus Ad_wbkC and control recombinant adenovirus Ad_GFP titers were calculated according to the following formula.

2.5 Ad_wbkC target cell infection and validation

RAW264.7 cells were inoculated into 60 mm cell culture dishes at a density of 1 × 10⁶. After 6 h, the complete medium was replaced with fresh complete medium, and 2 µL of Polybrene was added to each dish, and the recombinant adenovirus Ad_wbkC was transfected at the multiplicity of infections (MOI) of 10:1, 50:1, and 100:1, respectively, or the transfection time of 24 h, 48 h, and 72 h, respectively. Observe the green fluorescent protein expression to optimize the transfection conditions. Ad_wbkC was transfected into RAW264.7 cells with optimized transfection conditions, and qRT-PCR was performed to verify the expression level of wbkC gene using GAPDH as an internal reference gene. The qRT-PCR primer sequences were wbkC-F: GATTGGCATGGGCGTAGAGA; wbkC-R: TAGGAAGCGACCCGGGGATTA. Western blot was performed to verify the wbkC protein expression level using β-actin as an internal reference protein. Primary antibody was polyclonal antibody to wbkC protein prepared in 2.3 and secondary antibody was Goat Anti-Rabbit HRP (Abcam, Britain).

2.6 RNA library construction and transcriptomics sequencing

Total cellular RNA was extracted, and the concentration and purity of RNA were detected using a NanoDrop 2000 spectrophotometer and RNA electrophoresis. Subsequently, RNA libraries were constructed, and rRNA was removed from total RNA, and all lncRNAs obtained were constructed according to strand-specific library construction. After the libraries were quality controlled and inspected, Illumina sequencing was performed according to Sequencing by Synthesis, and the Ensemble database was used for reference genome comparisons.

2.7 Differential lncRNA expression analysis

Quality filtering was performed on the sequenced raw data, including removing adapter sequences from reads; removing bases that do not contain AGCT in the 5' end; trimming the ends of reads with lower sequencing quality; removing reads that contain N up to 10%; and removing small fragments smaller than 25 bp. Fragments Per Kilobase Million (FMPK) was used to indicate the expression of lncRNA in the samples. The lncRNAs with an absolute value of differential expression fold change (log2 Fold Change) > 1 and a p-value (p-value) < 0.05 were considered to be differentially expressed in the samples, and the differential expression of lncRNAs in each sample was counted and visualized. Based on the expression pattern of lncRNAs, the differentially expressed lncRNAs were clustered and graphically presented.

2.8 Analysis of GO and KEGG functional enrichment of differential lncRNA target genes

The regulation of lncRNAs is mainly categorized into cis regulation (cis regulation) and trans regulation (trans regulation), and the target genes regulated by differentially expressed lncRNAs are predicted. Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) were used for functional enrichment analysis of differentially expressed genes. GO categorizes and annotates genes by three aspects: molecular function, cellular components, and biological processes, in order to enrich differentially expressed genes that may have the same function. KEGG categorizes and annotates genes according to signaling pathways to enrich differentially expressed genes that may be involved in the same signaling pathways. The results of statistical GO and KEGG enrichment analysis were analyzed and graphically presented.

2.9 Mining of lncRNAs associated with cellular autophagy signaling pathway

Based on the results of GO and KEGG enrichment analysis of lncRNA target genes, autophagy pathway-related target genes were screened, and differentially expressed lncRNAs related to autophagy pathway were further mined. TOP 15 lncRNAs with highly significant expression differences were selected for qRT-PCR validation, and qRT-PCR primers were designed using NCBI primer (Table 1). The relative expression of lncRNA was calculated using the 2^-ΔΔCt method with GAPDH as the internal reference gene in three independent biological replicates, and the results of the experiment were analyzed using one-way ANOVA.

Table 1

qRT-PCR Validation of the Top 15 lncRNA
lncRNA name	Transcripts name	Primer sequence (5’-3’)
Gm10076	ENST00000469019	F: TGTGTGCTGCCATCGGTAAT R: AAGGCGGTCATTTCTCCAGG
Gm40723	ENST00000427183	F: AGAACTGGCACGTACAGCAA R: ACCACTTGTGGACACAGGAC
AC169509.2	ENST00000586582	F: ACTGTATCTGGCAAAGCCCC R: GGCTCAGAGCAGGCTAGATG
Gm37452	ENST00000375651	F: GCAGGTAGCCTGTGTGCTTA R: ACAAGTGAAGGGACGGGAAC
Gm42783	ENST00000529920	F: CCCACGACTTGAAAGGAGGG R: CCCAGGGAAGCCTTACACTT
Gm44830	ENST00000454626	F: TGAGTGGCCTGCATACTTGA R: TCGGTGGCTAAAAGCACCAG
4930447F24Rik	ENST00000555043	F: GAGGCCCCAGCAGAATAGAC R: GGCATCCAGGGCTCTAAGAC
4933430A20Rik	ENST00000455791	F: CTGGCCCATCCTGATACCAC R: ACAAGGAAAACAGCCGGACA
Gm43628	ENST00000414393	F: CTGTCTTGACACCGTGGGTT R: ACCAGGCTCATACATGGTGC
B930036N10Rik	ENST00000439498	F: CCGCTAACCCAAGGTCCATT R: TCACAGCTGCCCGTTGTTAT
Gm44153	ENST00000554225	F: GGAGACCTTGTGCTCTGTCC R: GCTGCCCCCAAGTTACATCT
Gm38034	ENST00000523884	F: CTCGCAGCTGTCTACTGAGG R: GACTTTTGGGAGAGCAGCCA
Gm10138	ENST00000421483	F: AAGCGACAGTGTGATCGGAG R: ACCCTGGTGCTTTAGGCAAG
Gm12708	ENST00000431071	F: TTGGCAAGCAGCACTGAGTA R: TGTTGGACAAGGTCGCGTAA
AC163032.1	ENST00000426413	F: GCAGGACTCACTGGGAACAA R: TGCAACCGGATGAGCTTTCT

3.1 Prokaryotic expression and characterization of wbkC

A wbkC gene fragment was amplified from the B. melitensis M5-90 genome, and the size of 780 bp was as expected (Fig. 1A). The recombinant plasmid pET-28a-wbkC was constructed, and pET-28a-wbkC was digested using BamH Ⅰ and Hind Ⅲ restriction endonucleases, and the size of the digested product was about 5369bp and 780bp, which was consistent with the size of the pET-28a plasmid (5369bp) and the size of the wbkC gene fragment (780bp) (Fig. 1B). Optimizing the recombinant protein expression conditions, the highest wbkC protein expression of BL21-pET-28a-wbkC was observed at 37°C with an IPTG concentration of 1 mmoL/L for 4 h of induction (Fig. 1C and Fig. 1D). Western blot verified the presence of a specific band at a molecular weight size of approximately 29 kDa, which was consistent with the size of the wbkC protein, indicating successful expression of the recombinant fusion protein His-wbkC (Fig. 1E).

3.2 Preparation of polyclonal antibodies to wbkC protein

Recombinant fusion proteins were purified using affinity chromatography, and after purification, a single clear band appeared at a molecular weight size of about 29 kDa, which indicated a better purification effect, and the purity of the purified proteins was more than 80% (Fig. 2A). Figure 2 Alignment of gene distribution with reference genome. The purified proteins were used in animal immunization assays, and polyclonal antibody potencies to the wbkC protein ranged from 1:6400 to 1:12800 as determined by indirect ELISA (Table 2). Western blot verified the presence of a specific band at a molecular weight size of about 29 kDa, which was consistent with the size of the wbkC protein, indicating the successful preparation of a polyclonal antibody to the wbkC protein.

Table 2

Determination of Polyclonal Antibody Titer of *wbkC*
Dilution multiple of Antibody	P/N
1∶800	11.47
1∶1600	10.47
1∶3200	5.51
1∶6400	3.50
1∶12800	2.07
1∶25600	1.83

3.3 Preparation of Ad_wbkC recombinant adenovirus

A wbkC gene fragment was amplified from the B. melitensis M5-90 genome, and the size of 780 bp was as expected (Fig. 3A). The shuttle plasmid ADV4-wbkC was constructed, and ADV4-wbkC was digested using EcoR Ⅰ with Hind Ⅲ restriction endonuclease, and the size of the digested product was about 7500bp and 780bp, which was consistent with the size of the ADV4 plasmid (7500bp) and the size of the wbkC gene fragment (780bp) (Fig. 3B). Recombinant adenoviruses were prepared and titers were determined using 293A cells, and cytopathic effect (CPE) was observed in samples at dilutions of 1×10 − 2, 1×10 − 3, and 1×10 − 4 72 h after transfection with recombinant adenoviruses Ad_wbkC and Ad_GFP. The titers of both recombinant adenovirus Ad_wbkC and control recombinant adenovirus Ad_GFP were 1×1010 PFU/mL (Fig. 3C and Fig. 3D).

3.4 Recombinant adenovirus Ad_wbkC mediates overexpression of wbkC in RAW264.7 cells

The multiplicity of infection (MOI) and transfection time were optimized, respectively, and when the MOI was 100 : 1 and the transfection time was 72 h, large green fluorescence was observed under the fluorescence microscope, which indicated a higher expression of the wbkC protein (Fig. 4A and Fig. 4B). Recombinant adenovirus Ad_wbkC with control recombinant adenovirus Ad_GFP was transfected into RAW264.7 cells under optimized conditions, and large green fluorescence was observed (Fig. 4C). The qRT-PCR verified that the wbkC gene expression in the Ad_wbkC test group was highly significantly higher than that in the Ad_GFP control group, with a fold difference of about 1510-fold (Fig. 4D). Western blot verified that the Ad_wbkC test group showed a specific band at a size of about 29 kDa, which was consistent with the size of the wbkC protein, and no specific band was found in the Ad_GFP control group (Fig. 4E). It indicated that Ad_wbkC successfully mediated the overexpression of wbkC in RAW264.7 cells.

3.5 Sequencing data preprocessing results

RNA concentration and purity were detected using a NanoDrop 2000 spectrophotometer, and RNA quality was examined using RNA electrophoresis.The RNA samples from the Ad_GFP control group and the Ad_wbkC test group all showed bands at the 28S, 18S and 5S positions, with no obvious spurious bands or dragging bands, indicating that the quality of the RNAs was high (Fig. 5). Preprocessing the sequencing data, the valid Reads of the Ad_GFP control group were 9,193,911,914, in which 97.81% of the bases with quality value ≥ 20 and 94.28% of the bases with quality value ≥ 30; and the valid Reads of the Ad_wbkC test group were 706,555,706, in which 97.57% of the bases with quality value ≥ 20 and 94.28% of the bases with quality value ≥ 30, meeting the requirements for the subsequent data analysis (Table 3). 93.78%, which meets the requirements for subsequent data analysis (Table 3).

Table 3

Statistics Before and After Quality Control
Sample name	Raw data	Valid data	Q20(%)	Q30(%)	GC(%)
Ad_GFP	93665522	91939914	97.81	94.28	48.55
Ad_ wbkC	72620224	70655706	97.57	93.78	49.25

3.6 Analysis of overall lncRNA expression levels

Based on the FPKM value of lncRNA, the distribution of lncRNA expression in the Ad_GFP control group and the Ad_wbkC test group was demonstrated by expression distribution plots and box plots. In the expression distribution plot, the horizontal coordinate indicated the lncRNA expression level, the vertical coordinate indicated the distribution density, and the curve distribution was basically consistent across samples (Fig. 6A). In the box plots, the horizontal coordinate indicates the sample source and the vertical coordinate indicates the lncRNA expression level. The box plots for each sample contained five statistics, from top to bottom: maximum, upper quartile, median, lower quartile & minimum, and the overall levels were generally consistent across samples (Fig. 6B). It showed that the lncRNA expression trend and expression level of Ad_GFP control group and Ad_wbkC test group were overall consistent and reproducible.

3.7 Visual analysis of differential lncRNAs

The differentially expressed lncRNAs were counted, and compared to the Ad_GFP control group, there were a total of 62 significantly differentially expressed lncRNAs in the Ad_wbkC test group, of which 32 were up-regulated and 30 were down-regulated in lncRNA expression. Based on the FPKM values of the lncRNAs of each sample, the differential expression of lncRNAs was visualized by MA plots and scatter plots. Each point represents a specific lncRNA, and in the MA plot, the horizontal coordinate A represents log2 (FPKMAd_GFP* FPKMAd_wbkC) and the vertical coordinate represents log2 (FPKMAd_GFP/ FPKMAd_wbkC). In the scatter plot, the horizontal coordinate represents log2 (FPKMAd_GFP + 1) and the vertical coordinate represents log2 (FPKMAd_wbkC + 1). Red dots represent the expression of up-regulated lncRNAs, blue dots represent the expression of down-regulated lncRNAs, and gray dots represent the expression of insignificant lncRNAs (Fig. 7A vs. Figure 7B).

3.8 Cluster analysis of differential lncRNAs

Cluster analysis was used to determine the expression patterns of different lncRNAs in each sample. lncRNAs with similar expression patterns may have similar biological functions or participate in the same cell signaling pathways. In the differential lncRNA clustering heatmap, each row represents a specific lncRNA and each column represents the sample source. Based on the FPKM values of the lncRNAs of each sample, the color from green to red indicates low to high expression; dark red indicates high expression of lncRNAs and dark green indicates low expression of lncRNAs (Fig. 8A). In the trend line plot of differential lncRNA expression patterns, the horizontal coordinate indicates the sample source and the vertical coordinate indicates the lncRNA expression level. Differential lncRNAs with the same expression pattern were grouped into a subset, with each gray line representing a specific lncRNA and the blue line representing the average expression level of the subset. Subset 1 included 31 differential lncRNAs, subset 2 included 27 differential lncRNAs, subset 3 included 3 differential lncRNAs, and subset 4 included 1 differential lncRNA (Fig. 8B).

3.9 Analysis of GO and KEGG functional enrichment of lncRNA target genes

GO and KEGG functional analysis was based on enrichment significance (P-value), enriching for target genes that may have the same function or participate in the same signaling pathway.

The TOP 10 GO functionally enriched target genes cis-regulated by significantly different lncRNAs are: positive regulation of cyclic nucleotide phosphodiesterase activity (GO:0051343), regulation of cytolysis in other organisms (GO:0051710), positive regulation of cytolysis in other organisms (GO:0051714), N-acetylmuralyl-L-alanine amidase activity ( GO:0008745), peptidoglycan receptor activity (GO:0016019), negative regulation of natural killer cell differentiation (GO:0032824), negative regulation of natural killer cell differentiation in the immune response (GO:0032827), growth in symbiotic interactions (GO:0044110), growth of symbionts in the host (GO:0044117), regulation of natural killer cell differentiation involved in the immune response (GO:0032826) (Fig. 9A).

The TOP 10 GO functionally enriched target genes with significant differences in lncRNA trans-regulation are DNA binding (GO:0003677), immune system process (GO:0002376), nucleobase-containing compound biosynthesis process (GO:0034654), RNA biosynthesis process (GO:0032774), macromolecule biosynthesis process (GO. 0009059), Heterocyclic biosynthesis process (GO:0018130), Aromatic compound biosynthesis process (GO:0019438), Cellular macromolecule biosynthesis process (GO:0034645), Organocyclic compound biosynthesis process (GO:1901362), Transcription, DNA template (GO:0006351) (Fig. 9B) .

The TOP 10 target gene KEGG signaling pathways enriched for cis-regulation of significantly different lncRNAs are MAPK signaling pathway-plant (ko04016), plant-pathogen interaction (ko04626), phototransduction-fly (ko04745), phototransduction (ko04744), olfactory transduction (ko04740), long duration enhancement ( ko04720), amphetamine addiction (ko05031), renin secretion (ko04924), glioma (ko05214), Fanconi anemia pathway (ko03460) (Fig. 9C).

The TOP 10 target genes enriched for KEGG signaling pathway regulated by significantly different lncRNAs in trans are: rheumatoid arthritis (ko05323), systemic lupus erythematosus (ko05322), tuberculosis (ko05152), NOD-like receptor signaling pathway (ko04621), phagolysosomes (ko04145) non-homologous end joining (ko03450), graft-versus-host disease (ko05332), alcoholism (ko05034) cytoplasmic DNA-sensing pathway (ko04623), allograft rejection (ko05330) (Fig. 9D).

3.10 Mining of lncRNAs associated with cellular autophagy signaling pathway

Based on the results of GO and KEGG enrichment analysis of differentially expressed lncRNA target genes, the cellular autophagy-associated lncRNAs with TOP 15 expression were screened for qRT-PCR validation, and the differences between lncRNA 4933430A20Rik (ENSMUSG00000110116) and lncRNA B930036N10Rik ( ENSMUSG00000091993) were consistent with the sequencing results, with approximately 1.5-fold and 2.5-fold differential expression folds, and highly significant differences between groups (Fig. 10A vs. Figure 10B).

Sequencing technology has developed rapidly in the past 20 years, and second-generation sequencing technology, represented by transcriptome sequencing technology, has begun to be used in a large number of basic applications, clinical applications and scientific research. Transcriptome sequencing technology directly sequences cDNA, which is not limited by whether the genomic data of a species is complete or not, and has the advantages of higher efficiency, lower cost, high sensitivity and reproducibility, and it is widely used in biological research [22].

The relationship between Brucella and autophagy and its intracellular survival mechanism is an important aspect of brucellosis research. It has been shown that through interactions with a variety of autophagy-related proteins, Brucella utilizes the cellular autophagy process to promote its own replication and infection [23]. Deletion of VirB, the B. melitensis T4SS promoter, results in reduced virulence and promotes autophagy [24]; the B. melitensis Per gene is involved in the biosynthesis of the LPS O-side chain, and infection of RAW264.7 cells with B. melitensis M5-90-Δper causes down-regulation of autophagy levels [25]. The role of wbkC, an important gene involved in LPS O-side chain biosynthesis, in the mechanism of Brucella-induced macrophage autophagy remains unclear.

lncRNAs are non-coding RNAs greater than 200 nucleotides in length, which are not only involved in transcriptional regulation in organisms, but also have important biological functions and significance in processes such as immune response and cellular autophagy [26]. Studies have shown that lncRNAs can interact with DNA, RNA, proteins, and signaling receptors and play a series of roles [27–29]. By exploring the changes in lncRNA expression and analyzing the lncRNA expression profile, it has certain reference value for the study of the mechanism of Brucella regulating cellular autophagy.

The aim of this study was to reveal the mechanism by which B. melitensis affects macrophage autophagy and intracellular survival. B. melitensis wbkC recombinant fusion proteins were obtained by prokaryotic expression and specific polyclonal antibodies were prepared. Adenovirus was utilized to mediate overexpression of the B. melitensis wbkC gene in RAW26437 cells. Transcriptome sequencing was utilized to construct differentially expressed lncRNA expression profiles and 62 significantly differentially expressed lncRNAs were identified. Analysis of the enrichment of the lncRNA target gene GO with KEGG showed that B. melitensis wbkC affects RAW264.7 phagolysosomes (ko04145), other autophagy (ko04136), negative regulation of cytostatic natural killer cell differentiation (GO:0032824), negative regulation of natural killer cell differentiation in the immune response (GO. 0032827), regulation of natural killer cell differentiation involved in immune response (GO:0032826), negative regulation of natural killer cell activation (GO:0032815), immune system processes (GO:0002376), immune response (GO:0006955) and other activities. In this study, we further used autophagy as an entry point to validate the differentially expressed lncRNAs related to the autophagy pathway using qRT-PCR, and initially mined and identified lncRNA 4933430A20Rik and lncRNA B930036N10Rik as the key endogenous B. melitensis wbkC proteins affecting autophagy in RAW264.7 cells lncRNA. The results of lncRNA target gene prediction showed that lncRNA4933430A20Rik and lncRNA B930036N10Rik may affect RAW264.7 cellular macroautophagy (GO:0016236) and mitochondrial via trans-regulation of the target gene Gabarapl 1 (ENSMUSG00000030161) autophagy (GO:0000422). This study provides ideas for further exploring the molecular mechanism of autophagy induced by B. melitensis wbkC protein in RAW264.7 cells, and contributes to the study of the mechanism of autophagy regulation in macrophages by Brucella melitensis.

Data availability:The raw data presented in this study can be found in online repositories. The name and accession number of the repository/repository can be found at: NCBI SRA; GSE147129.

Acknowledgements:Not applicable.

Author Contributions:

Hanwei Jiao, Cailiang Fan, Jixiang Li, Liting Cao, Zuoyong Zhou and Yuefeng Chu contributed to the conception and design of the study. Hanwei Jiao, Wenjie Li, Fengyuan Jiao and Gengxu Zhou contributed to data acquisition and data analysis. Chi Meng, Lingjie Wang and Shengping Wu contributed to the interpretation of the data. Hanwei Jiao, Wenjie Li, and Fengyuan Jiao drafted the manuscript. The manuscript was revised by Hanwei Jiao. The final version of the manuscript has been read and approved by all authors.

Conflict of Interest:The authors declare no competing interests.

Funding:This study was financially supported by the State Key Laboratory for Animal Disease Control and Prevention (SKLVEB-KFKT-09), the Fundamental Research Funds for the Central Universities (SWU-KT22013), the Science and Technology Major Project of Gansu Province (22ZD6NA001), and the Innovation Program of Chinese Academy of Agricultural Sciences (CAAS-CSAB-202403),

Kurmanov B, Zincke D, Su W, Hadfield TL, Aikimbayev A, Karibayev T, et al. Assays for Identification and Differentiation of Brucella Species: A Review. Microorganisms. 2022;10:1584.
Khurana SK, Sehrawat A, Tiwari R, Prasad M, Gulati B, Shabbir MZ, et al. Bovine brucellosis - a comprehensive review. Vet Q. 2021;41:61–88.
Liu Z, Gao L, Wang M, Yuan M, Li Z. Long ignored but making a comeback: a worldwide epidemiological evolution of human brucellosis. Emerg Microbes Infections. 2024;13:2290839.
Erkyihun GA, Gari FR, Kassa GM. Bovine Brucellosis and Its Public Health Significance in Ethiopia. Zoonoses. 2022;2.
Shi B, Li X, Li B, Zheng N, Li M, Liu Y et al. Construction and Evaluation of the Brucella Double Gene Knock-out Vaccine Strain MB6 ∆bp26∆wboA (RM6). Zoonoses. 2022;2.
Aragón-Aranda B, de Miguel MJ, Martínez-Gómez E, Zúñiga-Ripa A, Salvador-Bescós M, Moriyón I, et al. Rev1 wbdR tagged vaccines against Brucella ovis. Vet Res. 2019;50:95.
Occhialini A, Hofreuter D, Ufermann C-M, Al Dahouk S, Köhler S. The Retrospective on Atypical Brucella Species Leads to Novel Definitions. Microorganisms. 2022;10:813.
Rossetti CA, Maurizio E, Rossi UA. Comparative Review of Brucellosis in Small Domestic Ruminants. Front Vet Sci. 2022;9:887671.
Anbazhagan S, Himani KM, Karthikeyan R, Prakasan L, Dinesh M, Nair SS, et al. Comparative genomics of Brucella abortus and Brucella melitensis unravels the gene sharing, virulence factors and SNP diversity among the standard, vaccine and field strains. Int Microbiol. 2024;27:101–11.
Corbel MJ. Brucellosis: an overview. Emerg Infect Dis. 1997;3:213–21.
Jiménez de Bagüés MP, Terraza A, Gross A, Dornand J. Different responses of macrophages to smooth and rough Brucella spp.: relationship to virulence. Infect Immun. 2004;72:2429–33.
Billard E, Dornand J, Gross A. Interaction of Brucella suis and Brucella abortus rough strains with human dendritic cells. Infect Immun. 2007;75:5916–23.
Martínez-Gómez E, Ståhle J, Gil-Ramírez Y, Zúñiga-Ripa A, Zaccheus M, Moriyón I, et al. Genomic Insertion of a Heterologous Acetyltransferase Generates a New Lipopolysaccharide Antigenic Structure in Brucella abortus and Brucella melitensis. Front Microbiol. 2018;9:1092.
Riegert AS, Chantigian DP, Thoden JB, Tipton PA, Holden HM. Biochemical Characterization of WbkC, an N-Formyltransferase from Brucella melitensis. Biochemistry. 2017;56:3657–68.
Godfroid F, Cloeckaert A, Taminiau B, Danese I, Tibor A, de Bolle X, et al. Genetic organisation of the lipopolysaccharide O-antigen biosynthesis region of brucella melitensis 16M (wbk). Res Microbiol. 2000;151:655–68.
Cloeckaert A, Grayon M, Verger JM, Letesson JJ, Godfroid F. Conservation of seven genes involved in the biosynthesis of the lipopolysaccharide O-side chain in Brucella spp. Res Microbiol. 2000;151:209–16.
Lacerda TLS, Cardoso PG, Augusto de Almeida L, Camargo ILB da, Afonso C, Trant DAF et al. CC,. Inactivation of formyltransferase (wbkC) gene generates a Brucella abortus rough strain that is attenuated in macrophages and in mice. Vaccine. 2010;28:5627–34.
Brazão TF, Johnson JS, Müller J, Heger A, Ponting CP, Tybulewicz VLJ. Long noncoding RNAs in B-cell development and activation. Blood. 2016;128:e10–19.
Kitagawa M, Kitagawa K, Kotake Y, Niida H, Ohhata T. Cell cycle regulation by long non-coding RNAs. Cell Mol Life Sci. 2013;70:4785–94.
Sun X, Wong D. Long non-coding RNA-mediated regulation of glucose homeostasis and diabetes. Am J Cardiovasc Dis. 2016;6:17–25.
Zhang L, Yu S, Ning X, Fang H, Li J, Zhi F, et al. A LysR Transcriptional Regulator Manipulates Macrophage Autophagy Flux During Brucella Infection. Front Cell Infect Microbiol. 2022;12:858173.
Lander ES, Linton LM, Birren B, Nusbaum C, Zody MC, Baldwin J, et al. Initial sequencing and analysis of the human genome. Nature. 2001;409:860–921.
Starr T, Child R, Wehrly TD, Hansen B, Hwang S, López-Otin C, et al. Selective subversion of autophagy complexes facilitates completion of the Brucella intracellular cycle. Cell Host Microbe. 2012;11:33–45.
Deng X, He J, Wang Y, Yang Q, Yi J, Zhang H, et al. Deletion of the type IV secretion system promoter VirB in Brucella abortus A19 strain attenuated the virulence of the bacteria and promotes autophagy. Can J Microbiol. 2022;68:165–76.
Hanwei J, Nie X, Zhu H, Li B, Pang F, Yang X, et al. miR-146b-5p Plays a Critical Role in the Regulation of Autophagy in ∆per Brucella melitensis-Infected RAW264.7 Cells. Biomed Res Int. 2020;2020:1953242.
Xue Z, Zhang Z, Liu H, Li W, Guo X, Zhang Z, et al. lincRNA-Cox2 regulates NLRP3 inflammasome and autophagy mediated neuroinflammation. Cell Death Differ. 2019;26:130–45.
Postepska-Igielska A, Giwojna A, Gasri-Plotnitsky L, Schmitt N, Dold A, Ginsberg D, et al. LncRNA Khps1 Regulates Expression of the Proto-oncogene SPHK1 via Triplex-Mediated Changes in Chromatin Structure. Mol Cell. 2015;60:626–36.
Kleaveland B, Shi CY, Stefano J, Bartel DP. A Network of Noncoding Regulatory RNAs Acts in the Mammalian Brain. Cell. 2018;174:350–e36217.
Yamazaki T, Souquere S, Chujo T, Kobelke S, Chong YS, Fox AH, et al. Functional Domains of NEAT1 Architectural lncRNA Induce Paraspeckle Assembly through Phase Separation. Mol Cell. 2018;70:1038–e10537.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Analysis of Brucella melitensis wbkC protein affecting the lncRNA expression profiles of RAW264.7 cells and mining of autophagy pathway lncRNAs

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

1. Introduction

2. Materials and Methods

2.1 cell culture

2.2 Prokaryotic expression and characterization of wbkC

2.3 Preparation of polyclonal antibodies to wbkC protein

2.4 Preparation of Ad_wbkC recombinant adenovirus

2.5 Ad_wbkC target cell infection and validation

2.6 RNA library construction and transcriptomics sequencing

2.7 Differential lncRNA expression analysis

2.8 Analysis of GO and KEGG functional enrichment of differential lncRNA target genes

2.9 Mining of lncRNAs associated with cellular autophagy signaling pathway

3. Results

3.1 Prokaryotic expression and characterization of wbkC

3.2 Preparation of polyclonal antibodies to wbkC protein

3.3 Preparation of Ad_wbkC recombinant adenovirus

3.4 Recombinant adenovirus Ad_wbkC mediates overexpression of wbkC in RAW264.7 cells

3.5 Sequencing data preprocessing results

3.6 Analysis of overall lncRNA expression levels

3.7 Visual analysis of differential lncRNAs

3.8 Cluster analysis of differential lncRNAs

3.9 Analysis of GO and KEGG functional enrichment of lncRNA target genes

3.10 Mining of lncRNAs associated with cellular autophagy signaling pathway

4. Discussion

Declarations

References

Additional Declarations

Status:

Version 1