Regulation of angiogenic genes and endothelial progenitor cells following resistance training in elderly men

doi:10.21203/rs.3.rs-4934103/v1

Download PDF

Research Article

Regulation of angiogenic genes and endothelial progenitor cells following resistance training in elderly men

https://doi.org/10.21203/rs.3.rs-4934103/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Purpose

Physical activity is recognized as an effective method for promoting angiogenesis and mitigating its age-related decline. Our study aims to investigate the acute and chronic effects of resistance training on endothelial progenitor cells (EPCs) and angiogenic gene expression in the elderly.

Methods

Twenty-four untrained elderly males (aged 65–75 years) volunteered to participate and were randomly assigned to either a resistance training (RT) group or a control group, with 12 participants in each. Before and after the training period, participants underwent physical tests to evaluate mobility, balance, ability to transfer from sitting to standing, walking stability, gait speed, and fall risk. Additionally, blood samples were collected before and after the first training session (i.e., initial pre-test and initial post-test) and before and after the final training session (i.e., final pre-test and final post-test) to assess CD34+, VEGFR2+, Hypoxia-inducible factor-1 (HIF-1), Vascular Endothelial Growth Factor (VEGF), stromal cell-derived factor-1 (SDF-1) and Vascular Endothelial Growth Inhibitor (VEGI).

Results

The angiogenic gene HIF-1 increased from the first pre-test to the second pre-test (p = 0.03) and from the second pre-test to the second post-test (p = 0.02). The VEGF gene increased from the first pre-test to the second pre-test (p < 0.01) and from the first pre-test to the second post-test (p = 0.04). The SDF-1 gene increased in the second post-test compared to the first pre-test in the RT group (p = 0.02), but it decreased from the first pre-test to the second pre-test (p = 0.04). For EPCs, CD34 + levels increased from the first pre-test to the first post-test (p < 0.01) and from the first pre-test to the second post-test (p < 0.01). VEGFR2 + levels significantly increased in the second pre-test compared to the first post-test (p = 0.04), first pre-test (p < 0.01), and the second post-test (p < 0.01).

Conclusion

Resistance training performed with adequate intensity and volume can enhance angiogenesis in the elderly.

Angiogenesis

Progenitor cell

resistance exercise

untrained old man

Angiogenesis is a physiological process characterized by the formation of new blood vessels, leading to an increase in capillary density [1, 2]. This process also regulates vascular permeability, which is crucial for better vascular homeostasis to promote function of circulatory system [3]. Optimal vascular homeostasis is generally maintained by modulating smooth-muscle tone, maintaining blood fluidity, producing pro-inflammatory molecules, and promoting neovascularization. These crucial roles of vascular homeostasis are primarily regulated by Vascular Endothelial Cell (EC), a cell monolayer that lines the blood vessels [4]. The regulatory role of ECs is mediated by Endothelial Progenitor Cells (EPCs) in response to changes in angiogenic factors such as Vascular Endothelial Growth Factor (VEGF), Hypoxia-inducible factor-1 (HIF-1), and stromal cell-derived factor-1 (SDF-1) which are key contributors to angiogenesis [5–9].

Scientific literature indicates that EPCs can differentiate into ECs and incorporate into new blood vessels formation [10]. EPCs are self-renewing hematopoietic progenitor cells involved in vascular homeostasis through endothelium regeneration and postnatal neo-vascularization when they move into peripheral blood [1, 11]. This process, known as the mobilization of EPCs from bone marrow to peripheral blood, is crucial for these functions [12]. These variabilities are comprehensively work with changes in EPCs markers. The most recognized markers of EPCs are CD34+, CD133 + and VEGF receptor (VEGFR)2+ [13].

Current studies suggest that hemodynamic changes in blood flow, such as hypoxia and shear stress, lead to molecular changes, including increased levels of growth factors, estrogen, and nitric oxide. These changes are proposed to stimulate the generation of EPCs by triggering the secretion of angiogenic factors such as VEGF, HIF-1, SDF-1, insulin-like growth factor-1 (IGF-1), bone morphogenetic protein-4 (BMP-4), cytokine-like protein 1 (CLP-1), and keratinocyte growth factor (CGF), thereby promoting angiogenesis [5, 7–9]. The crucial role of prominently expressed angiogenic factors in enhancing EPCs, which subsequently lead to the production of ECs, has remained a compelling area of investigation for medical scientists.

Several studies showed that Hypoxia-inducible factor-1 (HIF-1) evokes the enhancing of EPCs expression through activation of VEGF, erythropoietin, monocyte chemoattractant protein-1 (MCP-1), SDF-1, and potentially reducing vascular endothelial growth inhibitor (VEGI) and pre-activation peptide (PAP) during hypoxic conditions [14–17]. However, the full extent of these contributions to physiological and hemodynamic changes remains unclear.

Previous research has shown that physical exercise is an effective non-pharmacological method for improving cardiorespiratory fitness. It boosts hypoxia and generates significant shear stress, both crucial for mobilizing EPCs from the bone marrow. This process increases EPCs' circulation and stimulates key angiogenic factors [18, 19]. Scientific evidences indicate that different types and intensities of physical exercise result in various levels of hypoxia followed by HIF-1α secretion to become an important stimulus for expression of VEGF [5, 15, 20–23]. Scientific literature indicates that both aerobic and resistance exercise have beneficial effects on angiogenesis. Previous studies report that 30-minute aerobic training, in both high intensity (~ 82% VO2max) and moderate intensity (~ 68% VO2max), increases the numbers of CD34+/KDR + and CD34+/CD133 + cells, whereas 10-minute exercise with same intensities does not significantly affect these cell numbers [19]. Also, a significant CD34 + cell mobilization and CD34+/KDR + cell release occurred after 4-hour cycling at 70% of ventilatory threshold and 1-hour running on treadmill [24]. By contrast, CD34 + cells did not enhance throughout the high- and moderate-intensity physical exercise, but declined 40 to 60 minutes post-exercise [25, 26]. These results highlight how physical activity stimulates EPCs and regulates their production. However, the conflicting results underscore the importance of ongoing research into the effects of different types of physical activities on angiogenesis and its associated markers, such as EPCs and angiogenic factors. Continued investigation is essential to fully understand and harness the benefits of physical exercise in this context.

Contrary to upregulated angiogenesis processes mentioned above, some parameters affect this phenomenon. Contrary to up regulatory angiogenic processes mentioned above (e.g. physical activity), several intervening factors adversely influence this phenomenon. An increasing body of evidence indicates that aging is one of the most effective parameters in diminishing angiogenesis, subsequent reduction of angiogenic genes, and related progenitor cells [27, 28]. Multiple studies have demonstrated that aging leads to a decline in the levels of EPCs in peripheral circulation, resulting in significant reductions in their functions such as migration and proliferation. Additionally, aging impairs the ability of EPCs to repair and regenerate damaged blood vessels [6, 27–29]. Furthermore, reports indicate that VEGF and SDF-1α levels in aged tissues hinder the migration of EPCs into ischemic cells [30]. However, other studies have reported negligible effects of aging on VEGF [31].

Previous studies have demonstrated that NO production, endothelial repair, and angiogenic stimulation in the elderly are significantly enhanced following resistance exercise [15, 32, 33] or endurance exercise [31]. A systematic review has revealed significant variations in exercise duration (ranging from 2 to 24 weeks) and intensity (75%-85% of maximal heart rate or 60%-70% of peak/maximum oxygen consumption), leading to different effects on EPCs [34]. Furthermore, studies show that both endurance and interval training boost EPC expression [35]. However, the effects of well-structured resistance exercises on angiogenesis, and the underlying cellular and molecular mechanisms in older adults, remain contentious.

Although resistance training regimens are generally viewed as more manageable or tolerable for older adults due to their anaerobic nature [36, 37], the specific molecular responses to these exercises, which could potentially help reduce medical costs in the elderly, are not yet well understood. Therefore, this study aims to explore the molecular processes involved in angiogenic factors and progenitors, and to propose a time-to-intensity program designed to maximize benefits for older individuals.

Participants

Twenty-four untrained elderly male volunteers (aged 65–75 years) were randomly selected from a pool of 100 healthy elderly males residing at Kahrizak sanatorium, Karaj Branch, Iran. Prior to enrollment, participants underwent a medical screening to exclude any undisclosed complications, as well as visual, hearing, orthopedic, acute cardiovascular, or metabolic issues. All participants provided written informed consent and were randomly assigned to either a resistance training (RT) group or a control group, with 12 participants in each. The study protocol was approved by the ethical committee of the Sport Sciences Research Institute of Iran (No. IR.SSRI.REC.1397.219) and adhered to the ethical standards outlined in the Helsinki Declaration.

Study design

Figure 1 provides an overview of the experimental protocol. The study involved an 8-week resistance training program, which included a familiarization session, as well as the following assessments: 1st pre-test (pre-response-test), 1st post-test (post-response-test), 2nd pre-test (pre-adaptation-test), and 2nd post-test (post-adaptation-test). The assessments evaluated performance using the Timed Up & Go test (TUG) and Isometric hand grip test, angiogenic gene expression using Real-Time PCR, and angiogenic progenitor cell count using Flow Cytometry.

Performance Testing Procedures

The Timed Up and Go (TUG) test is commonly employed to evaluate mobility, balance, the ability to transfer from sitting to standing, walking stability, gait speed, and fall risk in older adults. Participants are instructed to rise from a chair, walk a specified distance, and return to sit back down. A shorter completion time indicates better functional performance [38]. The Isometric Hand Grip test assesses the isometric strength of the hands. Participants are asked to grasp the isometric handgrip dynamometer (YAGAMI TY-300i, Nagoya, Japan) with their dominant hand and squeeze it as forcefully as possible. Results are recorded in kilograms.

Figure 1 here

Blood sampling and training protocol

The selected participants took part in a familiarization session during which their one-repetition maximum (1RM) was assessed for six specific movements: chest press, cable pull-down, back squat, hamstring curl, calf raises, and leg extensions. The measurements were conducted using an incremental approach to determine the 1RM [39]. One week later, all participants were instructed to fast overnight and abstain from alcohol and strenuous physical activity for 24 hours before blood sampling. After a 12-hour overnight fast, the first 5 milliliters of blood (baseline pre-blood sampling) were drawn via venipuncture and collected in EDTA tubes [37]. Two hours after the first blood sampling, participants engaged in a resistance training session consisting of 3 sets of 10 repetitions at 70% of their one-repetition maximum (1RM). Immediately following this session, the second blood sampling (baseline post-blood sampling) was conducted. After 48 hours, an incremental resistance training program commenced. This program included selected movements performed for 4 sets of 10 repetitions at 45–50% of 1RM, three times per week, with a 60-second rest between sets for the first two weeks. The load was progressively increased by 5% every two weeks, following the same training protocol, until the completion of 8 weeks (reaching 60–65% of 1RM in the final two weeks). Each repetition of every movement adhered to a rhythm of 1 second for the concentric phase and 1 second for the eccentric phase, guided by a metronome to ensure consistency across all participants. The first post-training blood sampling was conducted 48 hours after the last training session for both the resistance training (RT) and control groups. Two hours later, a post-training performance test was administered, followed immediately by the second post-training blood sampling. All blood samples were analyzed at the Laboratory Research Center of Iran University of Medical Sciences in Tehran to assess gene expression levels of HIF-1, VEGF, SDF-1, and VEGI.

Gene expression with Real Time- PCR

Blood samples (5 mL) were collected via venipuncture into EDTA tubes specifically designed to be RNAase-free. These samples were utilized to measure hematologic parameters. Total RNA was extracted from the blood using the AccuZol^™ kit following the manufacturer's instructions (BIONEER), and then dissolved in 50 µL of RNase-free water. The quality of RNA samples was assessed using the 260/280 nm absorbance ratio measured on a NanoDrop 2000c® Spectrophotometer (Thermo Scientific, Wilmington, DE, USA). Samples with ratios below 1.7 were excluded from further analysis. Subsequently, cDNA for target genes HIF-1, VEGF, SDF-1, and VEGI, along with the reference gene β-actin, was synthesized using the 2X RT-PCR Pre-Mix (Taq, Biofact) protocol. Next, 1 µg of synthesized cDNA was used in a SYBR Green-based RT-PCR assay following a two-step procedure with the 2X Real-Time PCR Master Mix (Biofact) protocol. For each reaction, 5.00 µL of Master Mix, 3.5 µL of DEPC-treated water, 0.5 µL of primers for the selected genes (0.25 µL forward and 0.25 µL reverse), and 1.00 µL of template cDNA were combined. The thermocycling conditions were as follows: initial denaturation at 95°C for 10 min, followed by one cycle at 95°C for 20 s and 58°C for 45 s, and then 40 amplification cycles at 95°C for 30 s. β-actin values were used for sample normalization as the housekeeping gene. Relative fold changes were determined using the ΔΔCt^-2 method, with gene expression values relative to the control (β-actin). Primer pairs (forward and reverse) for all genes are detailed in Table 1. Gel electrophoresis analysis of gene expression was conducted following the protocol described in Larkin et al. [9].

Table 1

Sequencing of the primers used in RT-PCR
Primer pairs used for RT-PCR
Primer Name	Oligo sequences 5'→3'	Length	OOD
Primer Name	Sequence 5'→ 3' (10–50 bp)	Length	OOD
HIF-1α-F	CTAGCCGAGGAAGAACTATGAAC	23	2–4
HIF-1α-R	CACTGAGGTTGGTTACTGTTGG	22	2–4
SDF-1α-F	TCACAATCATCATCATTCTCATTCTC	26	2–4
SDF-1α-R	GTTAAGCCACCACCTGACTG	20	2–4
VEGF – α-F	AAGGGGCAAAAACGAAAGCG	20	2–4
VEGF – α-R	GGAGGCTCCAGGGCATTAGA	20	2–4
VEGI-F	TTAGAGCAGACGGAGATAAGCC	22	2–4
VEGI-R	TTGGTATAGTTCATTCGGTTCTTGG	25	2–4
b-actin-F	CATGTACGTTGCTATCCAGGC	22	2–4
b-actin-R	CTCCTTAATGTCACGCACGAT	21	2–4

Table 1 here

Flow cytometry

EPCs in peripheral blood were quantified using flow cytometry to assess their migration from the bone marrow to the peripheral blood. Approximately 3 mL of blood samples were collected into EDTA-containing tubes and immediately centrifuged at 3000 rpm for 15 minutes. The buffy coats, which contain total mononuclear cells, were then isolated using density gradient centrifugation from heparinized blood. After isolation, the cells were incubated with fetal calf serum for 30 minutes before staining with specific monoclonal antibodies. Subsequently, the samples were washed with a buffer containing phosphate-buffered saline and 1% bovine albumin. The cells were stained using monoclonal antibodies, including phycoerythrin (PE)-conjugated CD34 + antibody (ebioscience, USA) and phycoerythrin (PE)-conjugated VEGFR2 + receptor antibody (ebioscience, USA). PE-conjugated antibodies with the same isotype as the aforementioned antibodies served as negative controls. Following staining, the cells were washed. Initial separation was based on the forward and side scatter properties of the cells. After isolating the lymphocyte particles, the number of CD34+/VEGFR2 + cells were quantified to determine the count of endothelial progenitor cells. Flow cytometry analysis was conducted using a FACSCalibur flow cytometer and BD Cell Quest software, with results reported as counts per microliter (n/µL). Data were visualized as a histogram in the flow cytometry analysis, where the relative fluorescence intensity of light scattering was represented on the X-axis and the cell count on the Y-axis.

Statistical analysis

The results are presented as Mean ± SD. Normality and homogeneity of distribution were assessed using the Kolmogorov–Smirnov and Levin's tests, respectively. To determine the significance of differences between groups, repeated measures analysis of variance (ANOVA) was employed. Mauchly's sphericity test was used to assess the assumption of sphericity for repeated measures. A significance level of P ≤ 0.05 was considered, and all data were analyzed using SPSS version 16.

Anthropometric variables

Changes in anthropometric variables at the 1st pre-test are presented in Table 2. Data analysis indicated no significant differences between the two groups for any of the anthropometric variables during the pre-test (P ≤ 0.05).

Table 2

Anthropometrics variables of Resistance Training and Control group in 1st pre-test phase (Mean ± SD).
Group	Age (Year)	Height (cm)	Weight (kg)	Body Mass Index (kg/cm²)	Body Fat %	Lean Body Mass (kg)
Resistance Training	66.42 ± 3.7	166.11 ± 6.3	66.07 ± 2.4	24.01 ± 4.4	20.23 ± 8.3	52.04 ± 3.7
Control	69.83 ± 2.4	169.05 ± 4.7	67.71 ± 3.8	23.75 ± 7.2	19.11 ± 5.3	51.34 ± 6.2

Practical Performance

As presented in Table 3, within-group results demonstrate a significant increase in hand grip strength (p = 0.02) and a significant decrease in TUG (p = 0.01) after 8 weeks of training in the RT group, whereas these factors did not change significantly in the control group. Additionally, between-group results reveal a significant increase in hand grip strength (p = 0.01) and a significant decrease in TUG (p = 0.03) after 8 weeks of training in the RT group compared to the control group.

Table 2 here

Molecular responses of angiogenic factors

The molecular responses of angiogenic factors to resistance training in different pre-post times were examined as part of the response and adaptation process following training in old men. RT-PCR analysis revealed that HIF-1 expression significantly increased from the 1st pre-test to the 2nd pre-test (p = 0.03). Additionally, HIF-1 expression showed a significant increase from the 2nd pre-test to the 2nd post-test (p = 0.02). Comparing between-group results, HIF-1 expression was significantly lower in the RT group compared to the Control group in the 2nd post-test (p = 0.00). Within the RT group, the fold change in HIF-1 expression was significantly higher in the 1st post-test (fold change = 1.89, p = 0.00), 2nd pre-test (fold change = 2.66, p = 0.00), and 2nd post-test (fold change = 2.38, p = 0.00) compared to the 1st pre-test (Fig. 3).

Figure 2 here

In the RT group, VEGF gene expression significantly increased from the 1st pre-test to the 2nd pre-test (p = 0.00). Furthermore, VEGF expression showed a significant increase in the RT group from the 1st pre-test to the 2nd post-test (p = 0.04). Additionally, VEGF levels were significantly higher in the RT group compared to the Control group in the 2nd post-test (p = 0.03). Interestingly, there was a significant difference between the 2nd pre-test and 2nd post-test in the RT group (p = 0.00), as well as between the 2nd post-test of the RT group and the 2nd post-test of the Control group (p = 0.03). Within the RT group, the fold change in VEGF expression from the 1st pre-test was significant in the 1st post-test (fold change = 1.59, p = 0.01), 2nd pre-test (fold change = 1.91, p = 0.00), and 2nd post-test (fold change = 1.77, p = 0.01) (Fig. 3).

In the analysis of SDF-1 gene expression differences (Fig. 3), the results indicated a significant increase in the 2nd post-test compared to the 1st pre-test in the RT group (p = 0.02), whereas it decreased in the 2nd pre-test compared to the 1st pre-test (p = 0.04). Within the RT group, SDF-1 significantly increased in the 2nd post-test compared to the 2nd pre-test (p = 0.00). In the between-group analysis, SDF-1 levels were lower in the RT group's second pre-test than in the Control group's second pre-test (p = 0.02). Additionally, SDF-1 was significantly higher in the RT group than in the Control group in the second post-test (p = 0.02). Within the RT group, the fold change in SDF-1 expression from the 1st pre-test was significant in the 1st post-test (fold change = 1.97, p = 0.00), 2nd pre-test (fold change = 2.71, p = 0.00), and 2nd post-test (fold change = 2.52, p = 0.00). VEGI was consistently expressed throughout all stages of the study based on RT-PCR analysis, but the fold changes did not show significant differences in both within-group and between-group analyses. Analysis of VEGI data revealed no significant changes between the groups. Moreover, the changes observed within both the RT and Control groups in the within-group assessment of VEGI were insignificant.

Figure 3 here

Regarding EPCs (Figs. 4 and 5), the CD34 + cell numbers per microliter (cells/µL) did not show significant changes across all phases in the control group. However, there were significant increases observed in the post-training phases in RT group. Specifically, the differences were statistically significant between the 1st post-test and the 1st pre-test (p = 0.00), and between the 2nd post-test and the 1st pre-test (p = 0.00). Additionally, there was a significant difference of p = 0.01 between the 1st post-test and the 2nd pre-test, and p = 0.02 between the 2nd post-test and the 2nd pre-test.

Figure 4 here

As depicted in Fig. 5, VEGFR2 + did not exhibit significant changes across all phases in the control group, whereas significant changes were observed in different phases of the RT group. Increases in VEGFR2 + were significant between the 1st pre-test and the 1st post-test (p = 0.04), the 2nd pre-test (p = 0.00), and the 2nd post-test (p = 0.00). Additionally, the increases in VEGFR2 + between the 1st post-test and the 2nd pre-test (p = 0.00), and between the 1st post-test and the 2nd post-test (p = 0.00) were significant. Moreover, the number of VEGFR2 + in the 2nd pre-test was significantly higher than its number in the 2nd post-test (p = 0.00).

Figure 5 here

The present study aimed to assess both the immediate and long-term effects of resistance training on angiogenic factors and functional performance in elderly men, and to compare these outcomes with those of sedentary peers of the same age. The main findings of this study were that 8 weeks of resistance training positively altered endothelial progenitors (CD34 + and VEGFR2+), angiogenesis-related genes (HIF-1α, VEGF, and SDF-1), and functional parameters (Timed Up & Go and Hand Grip) among trained elderly individuals. Also, our findings indicated that resistance training decreases VEGI in elders. In summary, Resistance Training stimulated adaptive mechanisms that promote angiogenesis.

Previous studies have demonstrated that resistance training enhances the musculoskeletal system's capacity to improve its functional capabilities [5, 6, 38]. Consistent with this evidence, elderly participants in the current study showed reduced timed Up & Go test times and increased hand grip strength after 8 weeks of resistance training. These findings suggest that resistance training enhances overall mobility, balance, sitting-to-standing transitions, walking stability, and reduces fall risk in older adults [38, 39].

Considering the significant increases in angiogenic issues, numerous studies indicate that exercise training can mitigate these conditions [5, 40]. In our experiment, we hypothesized that resistance training could have beneficial effects on angiogenesis, both in the acute response phase following exercise and over the chronic adaptation phase of 8 weeks.

When assessing the acute effects of resistance training during both pre-test (1st pre-test compared to 1st post-test) and post-test (2nd pre-test compared to 2nd post-test) phases, known as the response phase, significant changes in angiogenic progenitors and genes can be observed as angiogenic responses. Previous studies have shown two to eightfold increases in angiogenic factors during the response phase (2–4 hours after a training session), highlighting considerable variability in individual responses to different forms of RT [9, 18, 23, 31, 41]. Shear stress and hypoxia are known to potentially stimulate and facilitate the movement of CD34 + and SDF-1. These factors are reported to plausibly increase angiogenic factors such as VEGF, VEGFR2+, HIF-1α, and nitric oxide synthetase (NOS) by enhancing muscle hemoglobin concentrations [9, 30, 31, 34]. The positive increases in angiogenic factors observed in the present study following a moderate-intensity resistance training program align with findings reported by Karami et al. (2020), Farzanegi et al. (2021) and Yang et al. (2013), who documented significant increases in EPCs and VEGF [40, 42, 43]. However, these results contrast with the findings of Larkin et al. (2012), who observed no significant changes and even reported a slight decrease in angiogenic gene expression following low-intensity resistance training. They attributed this to instability in muscle oxygenation as a probable cause [9]. Furthermore, Rakobowchuk et al. (2012) reported no changes in CD34 + following 6 weeks of both high and moderate-intensity interval training, which contrasts with the findings of the present study [26]. The age of the subjects in the present study may explain this discrepancy. Resistance training at 45–65% of one-repetition maximum (1RM) likely imposes greater stress on the musculoskeletal and physiological systems of elderly individuals compared to RT at 40% of 1RM in younger subjects as studied by Larkin and colleagues [9]. Regarding endothelial progenitor cells (EPCs), a well-designed study by Niemiro and colleagues (2017) reported a decrease in CD34 + cells following a bout of continuous physical exercise [25]. One potential mechanism speculated to reduce EPCs and angiogenic gene expression is the age-related decline in nitric oxide levels [44]. It is well-documented that aging contributes to a reduced capacity of the vasculature to release nitric oxide [33].

While the results of study by Niemiro at al. (2017) contradicts the results of the present study, which observed an increase in CD34 + following resistance training [25], another study demonstrated that acute exercise increases the peripheral circulating levels of EPCs in middle-aged and elderly men [27], aligning with the findings of our experiment. Following physical exercise, EPCs migrate into the bloodstream and secrete substances like VEGF, SDF-1, and matrix proteins in potentially injured endothelial regions of the circulatory system in older individuals, which may enhance the accumulation of EPCs in these damaged areas [45]. Other studies have demonstrated that EPCs contribute to vascular repair by secreting vasoactive substances such as matrix proteins, growth factors, and chemokines, which promote angiogenesis and help maintain vascular homeostasis [7, 8]. Accordingly, the observed response to resistance training in this study likely involves stimulation of EPCs and angiogenic genes during the acute response phase.

To evaluate the adaptive effects of resistance training on angiogenic factors, the comparison between results from the 2nd pre-test and 1st post-test revealed significant increases in VEGF, HIF-1, SDF-1, and EPCs following resistance training. These findings align with previous studies demonstrating that regular endurance, high-intensity interval, and resistance training consistently stimulate angiogenic factor [43, 46]. In this regard, recent research indicated an increase in EPCs following interval training [35]. Moreover, scientific evidence has demonstrated that regular resistance training increases the circulating levels of EPCs [43, 46]. Other studies have reported that exercise training lasting 4 to 8 weeks enhances EPCs in both elderly individuals and children [47].

As mentioned earlier, aging contributes to decreased nitric oxide levels, which subsequently increases endothelial cell apoptosis and contributes to cardiovascular disease [44]. It appears that the increase in EPCs following resistance training in older men may be due to improvements in the nitric oxide mechanism or a reduction in endothelial cell apoptosis. Nitric oxide operates through the HIF regulatory pathway, which in turn stimulates the expression of VEGF as a key angiogenic gene [29]. This aligns with a study conducted by Kim et al. (2023), which reported significant increases in VEGF levels and vascular function following a 16-week resistance training program of moderate intensity (training with RPE 12–13) in elderly women [48]. Additionally, Shimizu and colleagues (2016) and Mehri Alvar and colleagues (2016) reported significant increases in VEGF levels following 4 weeks and 5 weeks of resistance training in healthy adults and elderly men, respectively [32, 49]. These improved angiogenic factors (CD34+, VEGFR2+, VEGF, SDF-1, and HIF1) are likely linked to the relationship between resistance training (45–70% incremental 1RM) and enhanced angiogenic capacity in older individuals. This enhancement potentially counters various cardiovascular disorders such as arterial stiffness, atherosclerosis, hypertension, stroke, and coronary artery disease [1, 19, 20, 50].

In this study, we hypothesized that an eight-week resistance training intervention in elderly individuals would promote angiogenesis. Our results demonstrated significant enhancements in the expression of both angiogenesis-promoting cytokines, particularly HIF-1α, SDF-1α, VEGF, and no significant change in inhibitory cytokine VEGI, along with favorable changes in endothelial progenitor cells (EPCs). Thus, it can be concluded that resistance training, when performed with adequate intensity and volume, can enhance angiogenic health in the elderly. Future research should investigate the dose-response relationship of various resistance training protocols on angiogenic factors (EPCs, genes, and protein production) in older adults and compare these findings across different age groups.

Authors’ contribution All authors contributed equally to the step-by-step parts of the study.

Funding There was no external financial support for this study.

Conflict of interest The authors declare that they have no conflict of interest.

Availability of data and materials Original source data is available under reasonable request

Compliance with ethical standards

Competing interest The authors declare that they have no conflict of interest.

Ethics approval The study protocol was approved by the ethical committee of the Sport Sciences Research Institute of Iran (No. IR.SSRI.REC.1397.219) and adhered to the ethical standards outlined in the Helsinki Declaration.

Jia G, Aroor AR, DeMarco VG, Martinez-Lemus LA, Meininger GA, Sowers JR (2015) Vascular stiffness in insulin resistance and obesity. Front Physiol 6:231. https://doi.org/10.3389/fphys.2015.00231
Hoier B, Hellsten Y (2014) Exercise-induced capillary growth in human skeletal muscle and the dynamics of VEGF. Microcirculation (New York, N.Y.: 1994) 21(4):301–314. https://doi.org/10.1111/micc.12117
Ferrara N, Gerber HP, LeCouter J (2003) The biology of VEGF and its receptors. Nat Med 9(6):669-676.
Bkaily G, Jacques D (2023) Morphological and Functional Remodeling of Vascular Endothelium in Cardiovascular Diseases. Int J Mol Sci 24(3):1998. https://doi.org/10.3390/ijms24031998
Gharaat MA, Mehri Alvar Y (2023) Effect of resistance training modalities on angiogenic indices in sedentary male students. Tehran U Med Sci J 81(6):441-9.
Karami S, Shahidi F, Rajabi H, Golab F (2019) Effect of 8-week resistance training on HIF-1α gene expression and Endothelial Progenitor Cells recall of blood after one session of resistance activity in elderly men. Sci J Iran Blood Transfus Organ 16(2): 124-132.
Schneller D, Hofer-Warbinek R, Sturtzel C, Lipnik K, Gencelli B, Seltenhammer M, Wen M, Testori J, Bilban M, Borowski A, Windwarder M, Kapel SS, Besemfelder E, Cejka P, Habertheuer A, Schlechta B, Majdic O, Altmann F, Kocher A, Augustin HG, Hofer E (2019) Cytokine-Like 1 Is a Novel Proangiogenic Factor Secreted by and Mediating Functions of Endothelial Progenitor Cells. Circ Res 124(2):243–255. https://doi.org/10.1161/CIRCRESAHA.118.313645
Tamari T, Kawar-Jaraisy R, Doppelt O, Giladi B, Sabbah N, Zigdon-Giladi H (2020) The paracrine role of endothelial cells in bone formation via CXCR4/SDF-1 pathway. Cells 9(6):1325. 10.3390/cells9061325
Larkin KA, Macneil RG, Dirain M, Sandesara B, Manini TM, Buford TW (2012) Blood flow restriction enhances post-resistance exercise angiogenic gene expression. Med sci sports exerc 44(11):2077–2083. https://doi.org/10.1249/MSS.0b013e3182625928
Sabbah N, Tamari T, Elimelech R, Doppelt O, Rudich U, Zigdon-Giladi H (2019) Predicting Angiogenesis by Endothelial Progenitor Cells Relying on In-Vitro Function Assays and VEGFR-2 Expression Levels. Biomolecules 9(11):717. https://doi.org/10.3390/biom9110717
Medina RJ, Barber CL, Sabatier F, Dignat-George F, Melero-Martin JM, Khosrotehrani K, Ohneda O, Randi AM, Chan JKY, Yamaguchi T, Van Hinsbergh VWM, Yoder MC, Stitt AW (2017) Endothelial progenitors: a consensus statement on nomenclature. Stem Cells Transl Med 6 (5):1316–1320.
Cavalcante SL, Lopes S, Bohn L, Cavero-Redondo I, Alvarez-Bueno C, Viamonte S, Ribeiro F (2019) Effects of exercise on endothelial progenitor cells in patients with cardiovascular disease: A systematic review and meta-analysis of randomized controlled trials. Rev Port Cardiol 38:817–827.
Goligorsky MS (2014) Endothelial progenitor cells: from senescence to rejuvenation. Semin Nephrol 34(4):365–373.
Carneiro D, Sielski MS, Vieira CP, Costa FTM, Werneck C, Vicente CP (2019) Administration of endothelial progenitor cells accelerates the resolution of arterial thrombus in mice. Cytotherapy 21(4):444-459.
Lundby C, Calbet JA, Robach P (2009) The response of human skeletal muscle tissue to hypoxia. Cell Mol Life Sci 66(22):3615–23.
Rehman J, Li J, Orschell CM, March KL (2003) Peripheral blood endothelial progenitor cells are derived from monocyte/macrophages and secrete angiogenic growth factors. Circulation 107(8):1164–1169.
Dachs G, Tozer G (2000) Hypoxia modulated gene expression: angiogenesis, metastasis and therapeutic exploitation. Eur J Cancer 36(13):1649-1660.
Lansford KA, Shill DD, Dicks AB, Marshburn MP, Southern WM, Jenkins NT (2016) Effect of acute exercise on circulating angiogenic cell and microparticle populations. Exp Physiol 101(1):155–167. https://doi.org/10.1113/EP085505
Laufs U, Urhausen A, Werner N, Scharhag J, Heitz A, Kissner G, et al (2005) Running exercise of different duration and intensity: effect on endothelial progenitor cells in healthy subjects. Eur J Cardiovasc Prev Rehabil 12(4):407-14.
Gharaat MA, Choobdari HR, Sheykhlouvand M (2024) Cardioprotective effects of aerobic training in diabetic rats: Reducing cardiac apoptotic indices and oxidative stress for a healthier heart. ARYA Atheroscler 20(2):50-60. DOI: http://dx.doi.org/10.22122/arya.**
Sheykhlouvand M, Gharaat MA (2024) Optimal homeostatic stress to maximize the homogeneity of adaptations to interval interventions in soccer players. Front Physiol 15:1377552. doi: 10.3389/fphys.2024.1377552.
Samadi M, Nazem F, Gharaat MA (2014) Designing the simulation training of taekwondo competition according to heart rate, blood lactate and rating of perceived exertion. Med Dello Sport 67(4):581-592.
Prior BM, Lloyd PG, Yang HT, Terjung RL (2003) Exercise-Induced Vascular Remodeling. Exerc Sport Sci Rev 31(1):26-33.
Mobius-Winkler S, Hilberg T, Menzel K, Golla E, Burman A, Schuler G, Adams V (2009) Time dependent mobilization of circulating progenitor cells during strenuous exercise in healthy individuals. J Appl Physiol 107(6):1943–1950
Niemiro GM, Parel J, Beals J, van Vliet S, Paluska SA, Moore DR, Burd NA, DeLisio M (2017) Kinetics of circulating progenitor cell mobilization during submaximal exercise. J Appl Physiol 122(3):675–682.
Rakobowchuk M, Harris E, Taylor A, Baliga V, Cubbon RM, Rossiter HB, Birch KM (2012) Heavy and moderate interval exercise training alters low-flow-mediated constriction but does not increase circulating progenitor cells in healthy humans. Exp physiol 97(3):375–385. https://doi.org/10.1113/expphysiol.2011.062836
Ambrose C (2015) Muscle weakness during aging: a deficiency state involving declining angiogenesis. Ageing Res Rev 23:139–53. doi: 10.1016/j.arr.2015.03.005.
Hoetzer GL, Van Guilder GP, Irmiger HM, Keith RS, Stauffer BL, DeSouza CA (2007) Aging, exercise, and endothelial progenitor cell clonogenic and migratory capacity in men. J Appl Physiol 102(3):847–852.
Karami S, Rajabi H (2024) The Effect of Resistance Training on Selected Hemodynamic and Functional Factors of the Older Adults Residents of a Nursing Home in Kahrizak. Salmand: Iranian J Ageing 19(3):
URL: http://salmandj.uswr.ac.ir/article-1-2727-fa.html
Hayakawa J, Migita M, Ueda T, Fukazawa R, Adachi K, Ooue Y, et al (2009) Dextran sulfate and stromal cell derived factor-1 promote cxcr4 expression and improve bone marrow homing efficiency of infused hematopoietic stem cells. J Nippon Med Sch 76(4):198–208.
Uryga AK, Bennett MR (2016) Ageing induced vascular smooth muscle cell senescence in atherosclerosis. The J physiol 594(8):2115–2124. https://doi.org/10.1113/JP270923
Shimizu R, Hotta K, Yamamoto S, Matsumoto T, Kamiya K, Kato M, Hamazaki N, Kamekawa D, Akiyama A, Kamada Y, Tanaka S, Masuda T (2016) Low-intensity resistance training with blood flow restriction improves vascular endothelial function and peripheral blood circulation in healthy elderly people. Eur J App Physiol 116(4):749–757. https://doi.org/10.1007/s00421-016-3328-8
Lauer T, Heiss C, Balzer J, Kehmeier E, Mangold S, Leyendecker T, Rottler J, Meyer C, Merx MW, Kelm M, Rassaf T (2008) Age-dependent endothelial dysfunction is associated with failure to increase plasma nitrite in response to exercise. Basic Res Cardiol 103(3):291–297. https://doi.org/10.1007/s00395-008-0714-3
Ribeiro F, Ribeiro IP, Goncalves AC, Alves AJ, Melo E, Fernandes R, Costa R, SarmentoRibeiro AB, Duarte JA, Carreira IM, Witkowski S, Oliveira J (2017) Effects of resistance exercise on endothelial progenitor cell mobilization in women. Sci Rep 7:17880. https://doi.org/10.1038/s41598-017-18156-6
Rezaei S, Matinhomaee H, Azarbayjani MA, Farzanegi P (2018) Effect of Interval Training Intensity on Gene Expression of Endothelial Progenitor Cells and Cardiac Stem Cells in Aged Rats. J Ilam Uni Med Sci 26(3):27-37.
URL: http://sjimu.medilam.ac.ir/article-1-3767-en.html
Gharaat MA, Kashef M, Jameie B, Rajabi H (2017) Effect of endurance and high intensity interval swimming training on cardiac structure and Hand2 expression of rats. J Shahid Sadoughi Uni Med Sci 25(9):748-58.
Fereshtian S, Sheykhlouvand M, Forbes S, Gharaat M (2017) Physiological and performance responses to high-intensity interval training in female inline speed skaters. Apunts. Medicina de l'Esport 52(196):131-138.
Bohannon RW (2006) Reference values for the timed up and go test: a descriptive meta-analysis. J Geriatr Phys Ther 29(2):64-68. doi:10.1519/00139143-200608000-00004
Shaw CE, McCully KK, Posner JD (1995) Injuries during the one repetition maximum assessment in the elderly. J Cardiopulm Rehabil 15(4):283-287. doi:10.1097/00008483-199507000-00005
Karami S, Shahidi F, Rajabi H, Golab F (2020) Response of Endothelial Progenitor Cells and Expression of Angiogenic Cytokine Genes in Preconditioning with Resistance Training in Elderly Men. Iranian J Endocrinol and Metab 22(4):337-348. URL: http://ijem.sbmu.ac.ir/article-1-2796-en.html
Gustafsson T, Kraus WE (2001) Exercise-induced angiogenesis-related growth and transcription factors in skeletal muscle, and their modification in muscle pathology. Frontiers in bioscience: a journal and virtual library 6:D75–D89. https://doi.org/10.2741/gustafss
Farzanegi P, Zamani M, Khalili A, Dehghani H, Fotohi R, Ghanbarpour MR (2021) Effects of upper- and lower-extremity resistance training on serum vascular endothelial growth factor, myostatin, endostatin and follistatin levels in sedentary male students. Sci & Sports 36(2):139.e1-139.e6. https://doi.org/10.1016/j.scispo.2020.02.013).
Yang Z, Xia WH, Su C, Wu F, Zhang YY, Xu SY, Liu X, Zhang XY, Ou ZJ, Lai GH, Liao XX, Jin YF, Tao J (2013) Regular exercise-induced increased number and activity of circulating endothelial progenitor cells attenuates age-related decline in arterial elasticity in healthy men. Int J Cardiol 165(2):247–254. https://doi.org/10.1016/j.ijcard.2011.08.055
Papapetropoulos A, Garcia-Cardena G, Madri JA, Sessa WC (1997) Nitric oxide production contributes to the angiogenic properties of vascular endothelial growth factor in human endothelial cells. J Clin Invest 100(12):3131–3139.
Zhang X, Huang Z, Xie Y, Chen X, Zhang J, Qiu Z, Ma N, Xu G, Liu X (2016) Lower levels of plasma adiponectin and endothelial progenitor cells are associated with large artery atherosclerotic stroke. Int J Neurosci 126(2):121–126. https://doi.org/10.3109/00207454.2014.994624
Thorell D, Borjesson M, Larsson P, Ulfhammer E, Karlsson L, DuttaRoy S (2009) Strenuous exercise increases late outgrowth endothelial cells in healthy subjects. Eur J App Physiol 107(4):481–488. https://doi.org/10.1007/s00421-009-1144-0
Sabayan B, Westendorp RG, Grond JV, Stott DJ, Sattar N, van Osch MJ, van Buchem MA, de Craen AJ (2014) Markers of endothelial dysfunction and cerebral blood flow in older adults. Neurobiol aging 35(2):373–377. https://doi.org/10.1016/j.neurobiolaging.2013.08.020
Kim HB, Seo MW, Jung HC (2023) Effects of Aerobic vs. Resistance Exercise on Vascular Function and Vascular Endothelial Growth Factor in Older Women. Healthcare (Basel, Switzerland) 11(18):2479. https://doi.org/10.3390/healthcare11182479
Mehri Alvar Y, Sayeevand Z, Erfani Adab F, Heidari Moghadam R, Samavat Sharif MA, Karami S (2016) The effects of five weeks resistance training on some vascular growth factors in sedentary men. Sport Physiol 8(29):15-30. doi: 10.22089/spj.2016.645
Gharaat MA, Kashef M, Jameie B, Rajabi H (2018) Effect of endurance and high intensity interval swimming training on cardiac hypertrophy of male rats. J Shahid Sadoughi Uni Med Sci, 26(4): 306-318.

No competing interests reported.

Download PDF

Editorial decision: Revision requested
11 Nov, 2024
Reviews received at journal
11 Nov, 2024
Reviewers agreed at journal
05 Nov, 2024
Reviewers invited by journal
17 Oct, 2024
Editor assigned by journal
19 Aug, 2024
Submission checks completed at journal
19 Aug, 2024
First submitted to journal
18 Aug, 2024

You are reading this latest preprint version

Regulation of angiogenic genes and endothelial progenitor cells following resistance training in elderly men

Status:

Version 1

Abstract

Purpose

Methods

Results

Conclusion

Figures

Introduction

Materials and Methods

Participants

Study design

Performance Testing Procedures

Figure 1 here

Blood sampling and training protocol

Gene expression with Real Time- PCR

Table 1 here

Flow cytometry

Statistical analysis

Results

Anthropometric variables

Practical Performance

Table 2 here

Molecular responses of angiogenic factors

Figure 2 here

Figure 3 here

Figure 4 here

Figure 5 here

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1

Regulation of angiogenic genes and endothelial progenitor cells following resistance training in elderly men

Status:

Version 1

Abstract

Purpose

Methods

Results

Conclusion

Figures

Introduction

Materials and Methods

Participants

Study design

Performance Testing Procedures

*Figure 1 here*

Blood sampling and training protocol

Gene expression with Real Time- PCR

*Table 1 here*

Flow cytometry

Statistical analysis

Results

Anthropometric variables

Practical Performance

*Table 2 here*

Molecular responses of angiogenic factors

*Figure 2 here*

*Figure 3 here*

*Figure 4 here*

*Figure 5 here*

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1

Figure 1 here

Table 1 here

Table 2 here

Figure 2 here

Figure 3 here

Figure 4 here

Figure 5 here