Biotechnological properties of Bacillus amylolyquefaciens B65, strain isolated from an artisanal tannery

doi:10.21203/rs.3.rs-4934578/v1

Download PDF

Research Article

Biotechnological properties of Bacillus amylolyquefaciens B65, strain isolated from an artisanal tannery

https://doi.org/10.21203/rs.3.rs-4934578/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Leather industry is traditionally characterized by the use of large amounts of chemical agents, some of which are toxic for human health and the environment. However, during the last years, many efforts have been made with the aim of successfully implement enzymes as agents for different leather production stages. The lipopeptides produced by the Bacillus spp. genus have excellent surfactants and antibacterial properties and may collaborate in the soaking stage of leather processing as well as in the leather preservation. Moreover, Bacillus sp. proteases and lipopeptides can be co-produced in one culture medium, saving the production costs.

In the present work, a screening of enzymatic activities was performed to 11 strains of the Bacillus sp. genus that have been isolated from samples of an artisan tannery from Salta, Argentina. In particular, the ability of B. amyloliquefaciens B65 to degrade α-type (nails, hair, wool) and β-type (feathers) keratin was demonstrated by scanning electron microscopy (SEM). The co-production of proteases, keratinases, glycosidases and lipopeptides of this strain was conducted at 37°C in mineral media supplemented with chicken feathers. In these nutrient-poor media, the strain secreted amylases, pectinases, proteases, keratinases, and collagenases. A MALDI-TOF study also revealed that the strains secreted homologues of kurstakins, iturins, surfactins and fengycines lipopeptides families. Therefore, B. amyloliquefaciens B65 presents great industrial potential applications, not only for tanneries but also for other industries such as pharmaceuticals, food, textiles and detergents, among others.

Bacillus

enzymes

keratinases

lipopeptides

proteases

The great diversity of microorganisms that nature offers is our biggest source of biotechnological processes and products. In this sense, Bacillus spp. genus has advantageous properties such as quick growth in economical culture media, relatively easy scale up and genetic manipulation possibilities. Moreover, they are generally recognized as safe (GRAS), except for the B. anthracis and B. cereus species (Hong et al. 2008). It is well known that Bacillus spp. genus largely contribute to the provision of proteases, carbohydrases, lipases and keratinases for several industrial applications (Schallmey et al. 2004; Duza and Mastan 2013). Their enzymes are also attractive for bioremediation processes in slaughterhouses, poultry plants and tanneries, which generate large amounts of lipid-proteinaceous wastes. Particularly, for leather industry these enzymes have successfully collaborate in different stages of leather production such as soaking, dehairing, bating, degreasing and staining (Thanikaivelan et al. 2004; Schallmey et al. 2004, Hasan et al. 2022).

Bacillus sp. lipopeptides have excellent dispersant, detergent, surface-active, antimicrobial and emulsifying properties (Sabaté et al. 2009; Makkar et al. 2011; Sabaté and Audisio, 2013). Lipopeptides may have a potential application as surfactants in the soaking stage of leather production as they could favour the extraction of undesirable substances such as fats, blood and salts. Furthermore, the antibacterial properties of lipopeptides may contribute to skin preservation. They could also be applied in the degreasing stage to emulsify the released fats. Moreover, lipopeptides and proteases metabolic production pathways has been demonstrated to be closely related for Bacillus sp. strains (Lilge et al. 2021), therefore they can be co-produced in a unique culture medium, saving production costs (Ramnani et al. 2005) and the use of the whole bacterial cell or the cell free supernatant would be more profitable than the use of its purified metabolites.

Industrial wastes can be good sources for searching microorganisms which produced both enzymes and lipopeptides. So, we propose the isolation of Bacillus spp. strains from solid and liquid samples taken from different sectors of an artisanal tannery of Salta Province, Argentina. The different isolates where screened to profile enzymatic activities and all relevant bacteria were phylogenetically characterized. Bacillus spp. B65 was selected for further studies to determinate the co-production of proteases and lipopeptides in different culture medium.

Isolation of Bacillus spp. from local tannery

Bacillus spp. isolation was performed with the following culture media: MRS medium at pH 6.4 prepared according to manufacture; 2% (w/v) BHI pH 7; nutrient agar pH 7 (NA): 0.3% (w/v) bacteriologic trypticase and 0.5% (w/v) meat peptone. Basal mineral medium (BMM) [g/L]: 0.5 NaCl, 0.4 Na₂HPO₄, 0.3 NaH₂PO₄, pH 7 (Brandelli and Riffel 2005); BMM supplemented with 1% (w/v) feathers and, BMM with 1% (w/v) feathers and 0.2% (w/v) yeast extract. All media were supplemented with 1.5% (w/v) agar.

Sludge, soil and effluent samples were taken from several sectors of an artisanal tannery of Atocha, Salta, Argentina (Fig. 1). Homogeneous mother solutions from solid samples were prepared as follows: 1.0 g of sludge or soil was dissolved in 9 ml of sterile distillate water and then serial dilutions were made. Liquid effluent samples were directly serial diluted. To isolate Bacillus spp. genus colonies, 500 µl of each diluted sample were poured into Petri dishes and mix with molten tempered agar medium (10 ml). Plates were incubated at 37°C from 48 h to 72 h. Each Bacillus spp. like colony was activated by transferring it from the agar medium into 2% (w/v) BHI broth and incubated at 37°C for 24 h. Eleven strains having Bacillus spp. characteristics were preserved in 2% (w/v) BHI broth supplemented with 20% (v/v) glycerol at -20°C.

Qualitative screening of enzymatic activities

Amylase activity. The well agar plate diffusion method was performed using 10 ml of molten, temper agar starch medium (SA): 5 g L^-1 meat peptone, 3 g L^-1 bacteriological trypticase, 10 g L^-1 soluble starch and 15 g L^-1 Agar-Agar. Each well was filled with 15 µl of isolated Bacillus spp. strain grown in 2% (w/v) BHI broth at 37°C for 24 h. Petri dishes were incubated at 37°C for 14 d, growth was periodically verified and amylase activity was revealed with 1 ml of 96° ethanol after 14 d (Bergey´s 2009). The appearance of a clear zone around the colony, due to starch hydrolysis, indicated an amylase positive result.

Lipase activity. Nutrient salt agar (NSA) medium was used for lipase screening (g/L): 5 bacteriologic trypticase, 2.5 meat peptone, 4 NaCl and 10 Agar-Agar, pH 7. Olive oil and rhodamine B solution final concentrations in NSA medium were: 2% (v/v) and 0.0002% (v/v), respectively. This solution was vigorously mixed and poured into NSA medium (60°C), which was also mixed till emulsification and used as lipase agar medium (LA) (Kouker and Jaeger 1987; Hasan 2009). The well agar plate diffusion method was performed as described for amylase activity. Lipase activity was considered positive when pink colonies fluorescence orange upon UV irradiation using transilluminator Labnet International Inc. TM-26 model (USA) was observed. Staphylococcus aureus ATCC 29213 was used as positive control and Escherichia coli ATCC 25922 as negative one (Kouker and Jaeger 1987). Negative lipase strains also form pink colonies but they do not show UV orange fluorescence.

Protease activity. Milk agar medium (MA) was used for proteases screening and was prepared as described in Bergey´s Manual of Determinative Bacteriology (2009). The well agar plate diffusion method was performed as described above. Protease activity was considered positive when a clear zone around the bacterial colony, due to milk proteins hydrolysis, was developed.

Caseinase activity. The well agar plate diffusion method using casein agar medium (CA) described by Nilegaonkar et al. (2007) was performed as described above. Caseinase activity was considered positive for strains showing a white or opaque zone around the bacterial colony, due to casein hydrolysis.

Collagenase activity. Collagenase activity was carried out with the same CA medium, but 1% w/v casein was replaced by 1% w/v calf hide powder as collagen substrate (CollA). The well agar plate diffusion method was performed as described above. Collagenase activity was revealed by transilluminator UV irradiation and it was considered positive when a clear zone appeared around the colony.

All media were sterilized by autoclaving at 121.1°C, 1.2 atm for 20 min. Experiments were carried out by triplicate.

Keratinase activity. Basal mineral medium (BMM) and minimal growth medium (MGM, g/L): 0.5 NaCl, 0.7 KH₂PO₄; 1.4 K₂HPO₄ and 0.1 MgSO₄.7H₂O, pH 7 (Wang and Shih 1999) were supplemented with chicken melanized feathers as the only source of carbon and nitrogen. Keratin substrates were thoroughly washed with tap water and rinsed with distilled water, to finally let them dry in an oven at 60°C for 48 h. Media and chicken feathers were sterilized separately. 5 ml of each sterile media were dispensed into screw cap tubes containing ca. 0.06 g sterile chicken melanized feathers under sterile conditions. Strains inocula were grown in 2% (w/v) BHI at 37°C for 24 h and were used at 2% (v/v). Keratinase activity was considered positive when the vane structure of feathers was broken in small pieces or the rachis was bared. Sterility controls of feathers were considered showing structurally intact feathers. Experiments were carried out by triplicate.

Phylogenetic characterization

From the 48 Bacillus spp. isolated strains 11 were selected for phylogenetic characterization at species and sub-species level by amplification of the internal transcribe spacer (ITS) of 16S rRNA and of gyrA gen fragment. Taq polymerase (Invitrogen, Brazil); 10× STR buffer (Promega, USA); agarose (Invitrogen, USA); SYBER® SAFE (Invitrogen, USA) were used as reagents. Modified boiling method was used to extract total genomic DNA according to Bell et al. (1998). Active cultures of Bacillus spp. were incubated at 37°C in 5 ml of 2% (w/v) BHI broth. 1 ml of these cultures were centrifuged (10 min /10°C/10 000 rpm) and pellet were re-suspended in 500 µl of MiliQ water. These suspensions were heated for 10 min at 100°C and centrifuged at the conditions already mentioned. Control reaction mixtures without template DNA were included in each experiment. PCR products were separated on 0.8% agarose gel (85V for 50 min) in 1× TAE buffer. Gels were stained with 0.01% (v/v) SYBER® SAFE and gel amplification patterns were verify in a transilluminator (section LIPASE) Labnet International Inc. TM-26 model (USA). Sequencing service of both strands was provided by Macrogen Inc. (Seoul, Korea), these sequences were then compared with those deposited in GenBank using BLAST program (http://www.ncbi.nlm.nih.gov) and uploaded at the data base using SEQUIN Application Version 13.70.

Specie level characterization by 16S subunit of rRNA gen

The universal primers for specie level characterization were: f-S-D-BACT 008 (AGAGTTGATCCTGGCTCAG) and r-S-D-BACT-1495 (CTACGGCTACCTTGTTGTTACGA), Invitrogen [De Silva 1998, Sacchi 2002]. The extracted genomic DNA was amplified in a 50 µl reaction mixture containing: 34.2 µl PCR water, 5 µl 10× STR buffer, 0.2 µl of each primer (100 µM), 0.4 µl Taq polymerase (500 Units − 5U µl^-1) and 10 µl of sample DNA. The ITS-16S rRNA amplification was performed as follows: initial denaturation step at 94°C for 5 min, followed by 30 cycles, each one at 94°C for 1 min, 50°C for 2 min and 72°C for 2 min and a final extension at 72°C for 7 min (Sabaté 2009).

Specie confirmation and sub-specie identification by gyrA gen

Sub-specie level characterization was carried out by partial amplification of gyrA gen using the following primers: gyrA-f (CAGTCAGGAAATGCGTACGTCCTT) and gyrA-r (CAAGGTAATGCTCCAGGCATTGCT), Invitrogen [Roberts 1994, Chun & Bae 2000]. The reaction mixture for DNA amplification was the same used for 16S rRNA. PCR conditions consist of an initial denaturation at 94°C for 2 min, followed by 40 cycles of 94°C for 30 s, 51°C for 45 s, 68°C for 90 s each one, and a final extension at 72°C for 7 min (Sabaté and Audisio 2013).

SEM observation of keratin substrates degradation by B. amyloliquefaciens B65

Hydrolysis of keratin substrates by B. amyloliquefaciens B65 were analysed by Scanning Electron Microscopy (SEM: Joel JSM 6480 LV, Metalizer: Denton Vacuum IV. Apparatus Drying: Denton Vacuum DCP-1 Critical Point). For this purpose, 6 mg of each keratin substrate (chicken feather: CF; llama wool, LW; sheep wool, SW; human hair, HH and human nail, HN) were incubated at 37°C for 6 d in 10 mL of MGM with a 4% (v/v) inoculum grown on 2% (w/v) of BHI broth at 37°C for 24 h. Bacterial viability was determined by plate counting. The keratin substrates were wash with distilled sterile water after an intense agitation on vortex (Vicking, Argentina), centrifuged for 10 min/10 000 rpm (Presvac DCS-16-RV, Buenos Aires, Argentina) and let dry with 96° ethanol.

Enzymes and lipopeptide production by B. amyloliquefaciens B65

These co-productions were performed in two different media, the mineral medium (MM) described by Brandelli and Riffel (2005) and the minimal growth medium (MGM) proposed by Wang and Shih (1999). Both media were supplemented with 0.5% (w/v) white or black chicken feathers. Inoculum was added at 1.0% (v/v) after growing in BHI 2% (w/v) medium for 18 h at 37 ºC. Incubation conditions were 37°C/200 rpm and the cell free supernatant´s (CFS) were recovered by centrifugation (15 min/10 ºC/10 000 rpm) and filtration on cellulose acetate membrane filter (0.2 µm, Sartorius, Göttingen, Germany) every 24 h. The CFS´s were stored at -20°C and were used for the enzymes and lipopeptides determinations over time. pH was monitored with color fixed indicator strips (Macherey-Nagel, Düren, Germany). Viable cells and spores were monitored by plate counting in BHI 2% (w/v) medium.

Protease quantitative activity determinations. It was measured by Kunitz (1947) modified method as describe below. Enzyme substrate consist of 1% (w/v) bovine casein Hammarsten grade homogeneous solution prepared in 0,05 M TRIS-HCl buffer (pH 8.5) and heated at 100°C/15 min until complete dilution. Reaction mixtures were a 1:1 relation of CFS (suitably diluted) and casein solution at a final volume of 1.0 ml. The reactions were incubated for 1 h at 37 ºC and 250 rpm. To stop the reaction 1.5 ml of pre-cooled 10% (w/v) trichloroacetic acid (TCA) were added to the reaction mixture. Absorbance at 280 nm was measured in a Cintra 101 double beam UV-Visible spectrophotometer before centrifugation (15 min/6 ºC /10 000 rpm). Total blank consist of heat inactivated CFS properly diluted and substrate solution. Standard curve was generated by using 0 to 1.2 mM solutions of L(-)-tyrosine. One unit of protease activity was defined as the amount of enzyme required to hydrolyse 1 µmol min^− 1 of tyrosine per millilitre under the specified experimental conditions.

Keratinase quantitative activity determinations. Keratin azure was used as substrate and Sigma (Wainwrigth, 1982) protocol was followed with one modification, reagents were used in half of the quantities. Reaction mixture was incubated for 4 h at 37°C and 250 rpm in a TRIS-HCl pH 8.5 buffer. Total reaction blank was considered for all CFS concentrations. The reaction mixtures were cooled and supernatants were collected by centrifugation (10 min/6 ºC /10 000 rpm). Absorbance was measured at 595 nm. One unit of keratinase activity was defined as the amount of enzyme required to increase the corrected A_{595 nm} in 0.01 per hour, under the specified reaction conditions. The corrected A_{595 nm} was the difference between the sample absorbance and its respective total blank.

Amylase quantitative determinations. The total reduced sugars were determined by the 3,5-dinitrosalicilic acid method (Miller, 1959). Homogeneous solutions of 1.0% soluble starch (Mallincrodt, St. Louis, USA) was prepared in sodium phosphate buffer 50 mM (pH 7.5). Reaction mixture consist of 0.1 mL of a 1:2 dilution of CFS: phosphate buffer and 0.4 mL of 1.0% substrate solution. Enzyme incubation conditions were 37°C/ 30 min/ 200 rpm. Standard glucose curve was done with anhydrous glucose (Cicarelli, Santa Fe, Argentina). Enzyme, substrate and reaction blanks were done. One unit of glycosidase activity (IU/ml) was defined as the amount of enzyme or CFS necessary to release 1 µmol min^− 1 of reduced sugars under the specified reaction conditions.

Total protein determination. CFS total protein content was determinated by Lowry et al. (1951) method. Bovine albumin was used to construct the standard curve.

Lipopeptides UV-MALDI-MS determinations

Matrix-assisted ultraviolet laser desorption-ionization mass spectrometry (UV–MALDI MS) analysis was conducted to determinate the presence of lipopeptides in the CFSs. Ultraflex II Bruker Daltonics Time-of-Flight/Time-of-Flight (TOF/TOF) (Bremen, Germany) spectrometer was used. The mass spectra were obtained in positive lineal ionic mode. External mass calibration was performed using β-cyclodextrin (molecular weight ([MW] 1134.36) with 9H-pyrido [3,4b]-indole (norharmane, nHo) as a matrix. The sample solutions were placed on a polished steel target plate MTP 384 of Bruker Daltonics (Bremen, Germany). The matrix solution was prepared by dissolving nHo in an acetonitrile/water (1:1, v/v). For the UV-MALDI MS experiments, samples were placed using the sandwich method described by Nonami et al. (1997), successively loading 0.5 µL of the matrix solution, analite and matrix solutions, allowing each layer to dry at room temperature and atmospheric pressure. The matrix-analite ratio/proportion was 3:1 (v/v) and the loading sequence of the matrix and analite solutions was: i) matrix, ii) analite, iii) matrix, iv) matrix. The desorption-ionization was conducted by a triple Nd: YAG laser (355 nm) frequency. At first, the experiments were performed by adjusting the firing position of the laser over the full range in order to select the optimum position of the data collection. Then, the laser shot was fixed at key points of the sample. Finally, the laser power was adjusted to obtain higher signals than the noise (S/N) ensuring minimum fragmentation of the paired ions. Each mass spectrum was generated by an average of 100 laser pulses per point. The obtained spectra were analysed by FlexControl and FlexAnalysis software’s.

Isolation and phylogenetic characterization

Samples to isolate Bacillus spp. strains were taken from different sectors of an artisanal tannery of Atocha, Salta, Argentina. 48 Bacillus spp. strains were conserved for screening studies. From these extracted mixture, 11 strains were selected for phylogenetic characterization based on enzymatic profile (Table 2). The sequence analyses of isolated strains showed 97.0 to 100.0% identity for ITS-16S rRNA gene and 98.0 to 100.0% for gyrA DNA fragments, when compared to Bacillus spp. genus sequences stored in GenBank/BLAST nucleotide database NCBI. This data was deposited in GenBank database and the accession numbers are listed in Fig. 1. The evolutionary distances of the strains in the phylogenetic trees demonstrated that the 11 isolated strains are members of the Bacillus spp. genus. Based on the evolutionary distances the phylogenetic tree constructed with the 16S rRNA sequences (data not shown) revealed two groups, the GRAS related Bacillus sp. strains such as B. amyloliquefaciens, B. licheniformis and B. subtilis which includes the isolated strains; and the group of human pathogen Bacillus sp. strains such as B. anthracis, B. cereus and B. mycoides.

Table 1

Enzymatic activities screening of the *Bacillus* sp. strains isolated from artisanal tannery of Salta, Argentina. (BMM) basal mineral medium; (MGM): minimal growth medium.
Strain		Amilase	Lipase	Protease	Caseinase	Collagenase	Keratinase (BMM)	Keratinase (MGM)
B. licheniformis	B6	+++	+	+	+	++	-	+
	B17	++	+	+	+	+	+	+
	B44	+	++	+++	+++	++	-	+
	B63	+	++	+++	+++	+++	-	-
B. amyloliquefaciens	B31	++	++	++	+++	++	-	+
	B37	+++	++	++	++	++	-	-
	B50	+	+++	+	++	+	-	-
	B54	++	+	+	+	+	-	-
	B65	+	+++	+++	+++	+++	+	+
B. subtilis subsp. subtilis	B27	+++	+	+	+	+	-	-
B. subtilis subsp. subtilis	B67	++	+	+++	+++	++	-	-

Table 2

Main peaks detected by UV-MALDI TOF mass spectrometry analysis of the lipopeptides in cell-free supernatant produced by *B. amyloliquefaciens* B65 in different media at 37°C; Matrix: norharmane. Positive ion mode. Fengycin A and B differ in the amino acid in position 6 (Ala or Val, respectively). (+) the lipopeptide homologue was detected at least in one time of the growth curve.
Calculated m/z	Family	Assigment	Molecular formula	BMM WF	BMM BF	MGM WF	MGM BF
943.51	Kurstakins	C14[M + Na]⁺	C₄₂H₇₀N₁₁O₁₂Na	+	+	-	+
959.58	Kurstakins	C14[M + K]⁺	C₄₂H₇₀N₁₁O₁₂K	+	+	-	-
1016.62	Surfactin	C12 [M + Na]⁺	C₅₀H₈₇N₇O₁₃Na	-	+	+	-
1030.63	Surfactin	C13 [M + Na]⁺	C₅₁H₈₉N₇O₁₃Na	+	+	+	+
1044.65	Surfactin	C14 [M + Na]⁺	C₅₂H₉₁N₇O₁₃Na	+	+	+	+
1053.52	Bacillomycin D	C14 [M + Na]⁺	C₄₈H₇₄N₁₀O₁₅Na	+	+	-	-
1058.66	Surfactin	C15[M + Na]⁺	C₅₃H₉₃N₇O₁₃Na	+	+	+	+
1067.64/ 1066.52	Bacillomycin D/iturin C	C15[M + Na]⁺/C14[M + Na]⁺	C₄₉H₇₆N₁₀O₁₅Na/ C₄₈H₇₃N₁₁O₁₅Na	+	+	+	+
1074.64	Surfactin	C15 [M + K]⁺	C₅₃H₉₃N₇O₁₃K	+	+	+	+
1081.55/ 1080.53	Bacillomycin D/iturin C	C16[M + Na]⁺ /C15[M + Na]⁺	C₅₀H₇₈N₁₀O₁₅Na/ C₄₉H₇₅N₁₁O₁₅Na	+	+	+	+
1088.65	Surfactin	C16 [M + K]⁺	C₅₄H₉₅N₇O₁₃K	+	+	+	+
1097.52/ 1096.51	Bacillomycin D/iturin C	C16[M + K]⁺ / C15[M + K]⁺	C₅₀H₇₈N₁₀O₁₅K/ C₄₉H₇₅N₁₁O₁₅K	+	+	+	+
1102.67	Surfactin	C17 [M + K]⁺	C₅₅H₉₇N₇O₁₃K	+	+	+	+
1116.69	Surfactin	C18 [M + K]⁺	C₅₆H₉₉N₇O₁₃K	+	+	+	+
1121.59	Iturin A	C18[M + Na]⁺	C₅₂H₈₂N₁₂O₁₄Na	-	-	-	+
1135.61	Iturin A	C19[M + Na]⁺	C₅₃H₈₄N₁₂O₁₄Na	-	-	+	+
1449.79	Fengycin A	C15[M + H]⁺	C₇₁H₁₀₈N₁₂O₂₀H	-	-	+	-
1463.80	Fengycin A	C16[M + H]⁺	C₇₂H₁₁₀N₁₂O₂₀H	-	-	+	-
1477.82	Fengycin A	C17[M + H]⁺	C₇₃H₁₁₂N₁₂O₂₀H	+	-	+	-
1485.78	Fengycin A	C16[M + Na]⁺	C₇₂H₁₁₀N₁₂O₂₀Na	-	-	+	-
1491.83	Fengycin B	C16[M + H]⁺	C₇₄H₁₁₄N₁₂O₂₀H	+	+	+	+
1501.76	Fengycin A	C16[M + K]⁺	C₇₂H₁₁₀N₁₂O₂₀K	-	-	+	-
1513.82	Fengycin B	C16[M + Na]⁺	C₇₄H₁₁₄N₁₂O₂₀Na	+	+	+	+
1515.77	Fengycin A	C17[M + K]⁺	C₇₃H₁₁₂N₁₂O₂₀K	-	-	+	-
1529.79	Fengycin B	C16[M + K]⁺	C₇₄H₁₁₄N₁₂O₂₀K	-	-	+	+
1533.88	Fengycin B	C19[M + H]⁺	C₇₇H₁₂₀N₁₂O₂₀H	+	+	+	-
1543.81	Fengycin B	C17[M + K]⁺	C₇₅H₁₁₆N₁₂O₂₀K	-	-	+	-

A phylogenetic tree with the gyrA gene sequences was also built to confirm the specie and sub-species level (Fig. 1). Because of their evolutionary distances, Bacillus sp. isolated strains B27 and B67 are grouped with B. subtilis subsp. subtilis C4, Mori2 and VCRCB471 strains, rather than with B. subtilis subsp. spizizenii and B. subtilis subsp. inaquosorum. Bacillus sp. B65, B37, B50, B31 and B54 strains presented 100% distance similarities with B. amyloliquefaciens ATCC15841, CMB01, CBMDLO3f strains. Whereas Bacillus sp. B44, B17 and B63 had 100% distance similarities with B. licheniformis AS08E and CICC10338 strains.

Enzymatic profile of the 11 Bacillus sp. isolated strains

Qualitative enzymatic characterization of Bacillus sp. strains isolated from local tannery revealed that despite the differences at specie level, amylase, lipase, protease, caseinase and collagenase activities were common for the 11 isolated strains (Table 2). On the contrary, keratinase activity was not as common as the other protease activities and only 5 strains were able to used feathers as their unique nutrient source. This activity was evaluated in two different salt culture media (BMM and MGM) where only B. licheniformis B17 and B. amyloliquefaciens B65 strains were able to degrade keratins from chicken feathers at 37°C, in both media. The results in Table 1 showed that keratinase activity was common for the B. licheniformis specie (B6, B17 and B44) and was also present in two of the five B. amyloliquefaciens isolated strains (B31 and B65), but B. subtilis subsp. subtilis isolated strains did not elicit such activity. Finally, B. amyloliquefaciens B65 was selected for further studies and proposed as a potential protease and keratinase producer, due to the plate agar diffusion assay using skim milk, casein and collagen as substrates and the test of degradation in minimum medium supplemented with chicken feathers.

B. amyloliquefaciens B65 keratinolitic substrates degradation studied by SEM

SEM observations confirmed that B. amyloliquefaciens B65 has the ability to degrade hard β-keratins of chicken feathers (Fig. 2A and B) leaving the rachis with a significant lower barbs density compared with control feathers. Moreover, the enzymatic machinery of this strain is suitable for the hydrolysis of soft α-keratins such as human hair and nails, sheep and llama wool. The degradation of human nail was observed as dark and punctual holes on the surface, which were not observed in the control (Fig. 2C and D). The sheep wool fibres presented a repeated and homogeneous scale pattern in all observed control sample, whereas fibres incubated for 6 d with B. amyloliquefaciens B65 were poorly defined (Fig. 2E and F). Human hair and llama wool showed the same degradation pattern, although it was not that remarkable. The plate count revealed a two orders of magnitude increase on viable cells from time 0 h (2,8×10⁵ CFU/ml) to 6 d incubation (2,45×10⁷ CFU/ml average count for all keratin substrates, since they were similar). Proper maintenance of viable and highly activated cells was observed in mineral medium supplemented with keratin as sole carbon and nitrogen source after 6 d incubation with a high inoculum.

Enzymatic potential and lipopeptides determination of B. amyloliquefaciens B65 strain

B. amyloliquefaciens B65 stationary phase was achieved after 24 h of agitated incubation conditions at 37°C in saline culture media supplemented with chicken feathers (Fig. 3). pH changes in media were observed at 48 h incubation time, going from pH 7 to 8 for white feathers and reaching up to pH 9 after 72 h of culture. The presence of black feathers did not change pH until 72 h of incubation in which a pH of 8 was reached.

B. amyloliquefaciens B65 proteolytic activity started at 24 h of incubation at 37°C in saline media and reached maximum production after 72 h in all cases (Fig. 3). The highest proteolytic activity obtain was 0,234 ± 0,001 UI ml^-1 in MGM supplemented with white (WF), but also with black chicken feathers (BF). The BMM production showed the same behaviour, although proteolytic activity was lower (0,197 ± 0,000 UI ml^-1).

Keratinolytic activity also presented the maximum production at 72 h of incubation in all studied media, except in MGM-WF, which after 48 h showed maximum keratinase production equal to 3,89 ± 0,70 UA ml^-1. The synthesis of both, proteolytic and keratinolytic enzymes on MGM media overcame the production obtained with BMM.

The presence of WF or non melanised feathers favoured the production of amylolytic enzymes. The maximum production of these glycolytic enzymes was 0,0721 ± 0,0002 UI ml^-1 at 72 h incubation in MGM-WF media.

The production of enzymes also allowed the studies of lipopeptides production of B. amyloliquefaciens B65 in saline media supplemented with β-keratins at 37°C and agitated incubation conditions. The UV-MALDI-TOF spectrometer determination in CFS´s from B. amyloliquefaciens B65 productions demonstrated the ability of this strain to secreted kurstakins, iturins, surfactins and fengycines lipopeptides families (Table 2). The presence of homologues of kurstakins family was observed at 72 h of culture in BMM and MGM media. Iturin and surfactin homologues secretion accompanied the bacterial growth and were continued to be synthesized during stationary phase. From these results it can be concluded that B. amyloliquefaciens B65 strain was able of secreting lipopeptides belonging to iturin, surfactin and fengycin families in saline media (BMM and MGM) supplemented with white or black chicken feathers at 37°C under agitation culture conditions. Some homologues of kurstakin and iturin A families were produced under specific saline and culture conditions. Agitation and default nutrient conditions did not affect the lipopeptides secretion.

It is worth mention that several fengycin homologues were detected in MGM media supplemented with white feathers (Table 2). Homologues of fengycin A were detected at m/z 1450.7 (C15 [M + H]⁺), m/z 1463.7 (C16 [M + H]⁺), m/z 1477.8 (C17 [M + H]⁺), m/z 1485.8 (C16 [M + Na]⁺), m/z 1501.8 (C16 [M + K]⁺), and m/z 1515.7 (C17 [M + K]⁺). In addition, protonated adducts of fengycin B were observed at m/z 1491.8 and 1533.9 (C16 and C19, respectively) and potassiated adducts were observed at m/z 1529.9 and m/z 1543.7 (C16 and C17, respectively)

In the present work, members of the Bacillus spp. genus are known to be ubiquitous and were recovered from all the liquid and solid samples collected at the artisanal tannery. Literature on Bacillus sp. isolated from tannery wastes are generally focused on their heavy metals bioremediation applications (Bachate 2013; Singh and Malaviya 2015; Abbas 2015; Kumari 2016). Thus, few works can be mention to compare our results. For example, B. subtilis K2 and S14, isolated from tannery wastes, produced an alkaline protease and a subtilisin-like keratinase, respectively, and were proposed as bating and dehairing assisting enzymes for leather industries (Hameed 1996; Macedo 2008). B. licheniformis VSG1 was studied for lipase and protease co-production (Sangeetha 2010), B. firmus TAP5 produced alkaline proteases (Joshi 2010) and Bacillus alkalitelluris TWI3 which secreted a thermostable metallo-protease (Anandharaj et al. 2016) were isolated from tannery wastes and were also proposed for tannery industry uses. Moreover, these studies are generally focused on one or two enzymes, our screening studies revealed the high potential of the Bacillus sp. strains and opened a spectrum of industrial possibilities. Recent review from Hasan et al. (2022) confirms this observation.

Phylogenetic characterization of the isolated Bacillus sp. strains using 16S rRNA and gyrA gene sequences revealed a great evolutionary distance with human pathogenic strains such as B. anthracis, B. cereus and B. mycoides. It is important to highlight these results because no matter the application (food, pharmaceutical, detergents, bioremediation, leather, textile industries, etc) the use of a GRAS strains avoids the increase of pathogenic microbial load in the environment. In these sense, there are some keratinases from B. cereus strains reported as biological agents in chicken feathers wastes management (Kim 2001; Lateef 2010; Lo 2012), leather processing (Nilegaonkar 2007) and wool treatment or detergent formulations (Sousa 2007). Therefore, the tannery isolated strains presented in this work are safer options for industrial enzymes production.

The qualitative screening of enzymatic activities revealed that all the Bacillus sp. isolated strains were able to degrade starch, olive oil, globular and fibrous proteins. In this screening, high lipase activity could be correlated with high protease activity. Sangeetha et al. (2010) and Parrado et al. (2014), carried out a co-production of lipases and proteases with B. licheniformis VSG1 and B. licheniformis ATCC 21415, respectively. The high percentage of protease and lipase producers is consistent with the chemical composition of the tannery samples, which had a great content of protein matter discarded during the leather production. According to Gradisar et al. (2005), protease activity using casein as substrate can be used as a parameter for determining a potential keratinase activity. Nonetheless, caseinase activity from the 11 isolated Bacillus sp. did not always corresponded with a keratinase activity, except for B. licheniformis B17, B6 and B44, and B. amyloliquefaciens B31 and B65 strains. B. licheniformis (except B63) and B. amyloliquefaciens B31 and B65 strains are true extracellular enzymes factories and are promising bacteria for several industrial and bioremediation processes. The results of keratinase screening with two different basal salt media and chicken feathers, lead to the conclusion that strains depend strongly on the salt composition to reveal a positive keratinase result. Long-Xian et al. (2010) discussed that media salt composition used for keratinase screening affects the production and secretion of these type of enzymes. These authors demonstrated that metal ions play a very important role on microbial metabolism and that strains are strongly dependent on them. These observations may explain the differences in keratinase activity in BMM and MGM. B. amyloliquefaciens B65 showed full degradation of chicken feathers (except rachis) in both media, it also revealed a remarkable protease activity in skim-milk, casein and collagen agar plates and was selected for SEM keratin degradation studies. The SEM studies revealed that B. amyloliquefaciens B65 was able to growth on minimal media and used both α-soft and β-hard keratins. Protease activity is usually secreted in response to a lack of nutrient (Parrado et al. 2011), experimental observation showed that this activity was widely distributed among the isolated strains, but keratinase activity was not that common. For example, B. subtilis subsp. subtilis B27 and B67 were not able to degrade chicken feathers under the incubation conditions tested in this work. Nonetheless, current literature reports several B. subtilis strains with noble keratinase activity on feathers (Suh and Lee 2001; Giongo 2007; Cai 2008; Macedo 2008; Pillai and Archana 2008; Brandelli 2010; Mazotto 2010; Kumar 2010; Almahasheer et al. 2022].

From the leather industry point of view collagenase activity tends to generate some rejection among the tanners, because in the end, leather is the result of fixing the dermis collagen composition. However, lime sulfide manages to open and soften the collagen fibers in such a way that the tanning agents can fully penetrate the hides giving high quality leathers. The disadvantage of this technology is the contamination of large amounts of water and the possibility of sulfuric acid generation during this tannery stage. Therefore, controlled or low collagenase activity, may be an eco-friendly tool that in combination with keratinase and globular protease (which degrades blood proteins) may achieve those high quality standards. Nowadays, world interest is focused on new GRAS sources of collagen producers against the actual collagenolytic pathogen ones: Clostridium histolyticum, Vibrio alginolyticus and Porphyromonas gingivalis (Petrova 2006; Lima 2015). The isolated strains from artisanal tannery may represent new possibilities for collagen degrading studies and may contribute in the leather production.

Cultivating B. amyloliquefaciens B65 in mineral media lead to the observation that hydrolytic enzymes secretion and pH values varies when it is cultivated with white or black chicken feathers. The chemical composition and the concentration of chicken feathers were demonstrated to have influenced the secretion profile of hydrolytic enzymes and the time of which the secretion occurred, according to Parrado et al. (2014). The presence of melanin of the black feathers could influence the production of hydrolytic enzymes, the secretion times and the differences that were observed in the pH values registered (Goldstein et al. 2004; Gunderson et al. 2008). Interestingly, the cellular growth of B. amyloliquefaciens B65 was accompanied by a pH increase, behaviour that was also observed by Daroit et al. (2009) with Bacillus sp. P45 strain. According to Riffel and Brandelli (2006) this is a widely spread characteristic among keratinolytic microorganisms and it is considered an indicator of the hydrolysis capability of a keratinolytic strain. The increase of pH in the culture medium is due to the ammonium liberation thought peptide deamination of the keratins (Kumar et al. 2008).

Proteolytic enzymes determinations of B. amyloliquefaciens B65 showed that there was more than one type of protease activity secreted in to the culture media: proteolytic, keratinolytic and colagenolytic. Daroit et al. (2009) also found more than one protease variety reinforcing the hypothesis that each protease activity contributes in some point the keratin substrates degradation. A possible degradation mechanism could involve in a first instance the attack of proteases and disulfide-reductases. These latter reduce the disulphide bonds decreasing the keratin fibers stability (sulphitolysis) leaving protein substrates suitable for less specific proteases and generating a more extended keratinolysis (Sangali and Brandelli 2000; Gupta and Ramnani 2006; Kumar et al. 2008; Pillai and Archana 2008; Brandelli 2008 and Daroit et al. 2009).

Bacillus genus α-amilases production usually accompanies the cellular growth and are secreted during exponential phase or during the early stationary phase (de Oliveira Santos and Leal Martins 2003; Ahmed and Hanan 2011). This fact was observed during B. subtilis (Bajpai and Sharma 1989), B. licheniformis TCRDC-B13 (Stephenson et al. 1998)d amyloliquefaciens B65 strains cultures. In accordance with that, the amylolytic enzymes produced and secreted by B. amyoliquefaciens B65 occurred during the first 24 h of culture.

Lipopeptides production studies with B. amyloliquefaciens B65 cultures allowed to know the capacity of the strain to co-produce surfactins, iturins and fengycins. These three families of lipopeptides were present in the 4 culture media studied and are the families of lipopetides with the greatest variety of homologues. The production of lipopeptides strongly depends on the conditions and nutrients used for their production (Mulligan 2005; Shaligram and Singhal 2010), in these sense, it was possible to identify kurstakins in some of the B. amyloliquefaciens B65 culture media.

Mass spectra analysis carried out by Price et al. (2007) established 3 main regions of m/z ranges. The first one was at 850–950 m/z and included kurstakins, the second one was from 100–1100 m/z which included surfactins and iturins and the third one from 1450–1550 m/z which grouped fengicins, polimixins and bacitracins. This classification made it possible to relate certain peaks in the mass spectra of the crude extracts of B. amyloliquefaciens B65 with the aforementioned lipopeptides.

Kurstakins were identify as a new class of low molecular weight lipopeptides (~ 900 Da) by Hathout et al. (2000) from a B. thuringiensis subsp. kurstaki HD-1 strain. Signals of kurstakins determined by Price et al. (2007) were 889, 905, 917 y 933 m/z. Most recently, El Arbi et al. (2016) identify kurstakins at 900.7, 914.7; 916.7; 928.7; 930.7; 942.7 y 944.7 m/z. The B. amyloliquefaciens B65 crude extracts analysed by UV-MALDI showed signals at m/z 943 and 959 (Table 2) indicating possible kurstakins secretion. Moreover, Price et al. (2007) studies proposed that the kurstakins remain retained by the bacterial cells instead of being secrete into the culture medium. However, they mention two of the 20 strains as exceptions to this rule. Therefore, the kurstakins of B. amyloliquefaciens B65 which were determined from the crude extracts after 48 to 72 h of culture, coincided with the exceptions mentioned by Price et al. (2007).

The co-production of biosurfactants and hydrolytic enzymes in the same culture medium is highly attractive for the detergent production sectors (Makkar et al. 2011) and would undoubtedly bring great advantages to the different stages of leather production (Taylor et al. 1987; Thanikaivelan et al. 2004). The use of lipopeptides in the leather industry is a proposal that arose during this work and no application studies of this type have been found in the literature to date. This opens up a promising line of research that takes advantage of hydrolytic enzymes and lipopeptides secreted from the same bacterial culture using the B. amyloliquefaciens B65 strain isolated from an artisanal tannery.

By means of isolation and screening strategies, we have found noble sources of Bacillus sp. strains that produce amylase, lipase, protease, collagenase and keratinase. Eleven native Bacillus strains were conserved and identified as B. licheniformis B6, B17, B44 and B63, B. amyloliquefaciens B31, B31, B37, B50, B54 and B65, and B. subtilis subsp. subtilis B27 and B67 strains. Potential applications for these newly isolated strains are promising and worth to continue studying. The present work intention was to isolate Bacillus bacteria from tannery wastes and select a good protease and keratinase producer so it can be used as a biologic agent for leather processing. Therefore, B. amyloliquefaciens B65 was tested against α-soft and β-hard keratins proving to degraded both of them. Keratinase and protease maximum production were achieved at 72 h of incubation in mineral media supplemented with chicken feathers at 37 ºC in agitated conditions. In these culture conditions the strain has demonstrated that proteolytic enzymes can be co-produced with lipopeptides from kurstakins, iturins, surfactins and fengycines families. Therefore B. amyloliquefaciens B65 strain has a productive potential of great interest for various industries (leather, detergent, antibacterial metabolites producer, etc.) and further studies on production and optimization are required depending on the target industry of interest to be applied.

Acknowledgments

The authors would like to thank Universidad Nacional de Salta (UNSa), Consejo Nacional de Investigaciones Cientíﬁcas y Técnicas (CONICET), Agencia Nacional de Promoción Cientíﬁca y Tecnológica (ANPCyT) of Argentina for the ﬁnancial support that made this work possible. Lic. I.M. Virgili Alemán thanks CONICET for her fellowship. To JAMO CUEROS S.A., the artisanal tannery for allowing us to take the samples for the bacterial isolation and to the Waters and Soil Laboratory of UNSa-CONICET for allowing us the use of the thermal cycler and Dr. M.J. Torres for the support during phylogenetic characterization.

No Conflict of interest

Author Contributions

Drs. M. Daz and M. C. Audisio contributed to the study conception and direction. The first draft of the manuscript was written by I. M Virgili Alemán, who also carried out all the experimental design, material preparation, data collection and analysis. G. Petroselli and R. Erra Balsells contributed with the lipopeptides UV-MALDI-MS determinations and data analysis. All authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Data Availability

The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.

Abbas S, Ahmed I, Kudo T, Iqbal M, Lee YJ, Fujiwara T, Ohkuma M (2015) A heavy metal tolerant novel bacterium, Bacillus malikii sp. nov., isolated from tannery effluent wastewater. Antonie Van Leeuwenhoek 108:1319–1330. https://doi.org/10.1007/s10482-015-0584-2
Ahmed AA, Hanan MI (2011) A potential new isolate for the production of a thermostable extracellular α- amylase. J Bacteriol Res 3:129–137
Almahasheer AA, Mahmoud A, El-Komy H, Alqosaibi AI, Aktar S, AbdulAzeez S, Borgio JF (2022) Novel feather degrading keratinases from Bacillus cereus group: biochemical, genetic and bioinformatics analysis. Microorganisms 10:93
Anandharaj M, Sivasankari B, Siddharthan N, Parveen Rani R, Sivakumar S (2016) Production, purification, and biochemical characterization of thermostable metallo-protease from novel Bacillus alkalitelluris TWI3 isolated from tannery waste. Appl Biochem Biotechnol. https://doi.org/10.1007/s12010-015-1974-7
Bachate SP, Nandre VS, Ghatpande NS, Kodam KM (2013) Simultaneous reduction of Cr(VI) and oxidation of As(III) by Bacillus firmus TE7 isolated from tannery effluent. Chemosphere 90:2273–2278. https://doi.org/10.1016/j.chemosphere.2012.10.081
Bajpai P, Sharma U (1989) Production of α-amylase in a low cost medium by Bacillus licheniformis TCRDC-B13. J Ferment Bioeng 67:422–423
Bell JM, Paton JC, Turnidge J (1998) Emergence of vancomycin-resistant Enterococci in Australia: phenotypic and genotypic characteristics of isolates. J Clin Microbiol 36:2187–2190
Ben Ayeda H, Hmideta N, Béchet M, Chollet M, Chataigné G, Leclère V, Jacques P, Nasri M (2014) Identification and biochemical characteristics of lipopeptides from Bacillus mojavensis A21. Process Biochem 49:1699–1707
Bergey´s Manual of systematic Bacteriology (2009) The Firmicutes. Springer-, New York
Brandelli A, Daroit DJ, Riffel A (2010) Biochemical features of microbial keratinases and their production and applications. Appl Microbiol Biotechnol 85:1735–1750. https://doi.org/10.1007/s00253-009-2398-5
Brandelli A, Riffel A (2005) Production of an extracellular keratinase from Chryseobacterium sp. growing on raw feathers. Electron J Biotechnol 8:35–42
Brandelli A (2008) Bacterial keratinases: useful enzymes for bioprocessing agroindustrial wastes and beyond. Food Bioprocess Tech 1:105–116
Cai C, Chen J, Qi J, Yin Y, Zheng X (2008) Purification and characterization of keratinase from a new Bacillus subtilis strain. J Zhejiang Univ Sci 9:713–720
Chun J, Bae KS (2000) Phylogenetic analysis of Bacillus subtilis and related taxa based on partial gyrA gene sequences. Antonie Van Leeuwenhoek 78:123–127
Daroit JD, Corrêa APF, Brandelli A (2009) Keratinolytic potential of a novel Bacillus sp. P45 isolated from the Amazon basin fish Piaractus mesopotamicus. Int Biodeter Biodegr 63:358–363
De Oliveira Santos E, Leal Martins ML (2003) Effect of the medium composition on formation of amylase by Bacillus sp. Braz Arch Biol Technol 46:129–134
De Silva S, Petterson B, Aquino de Muro M, Priest FG (1998) A DNA probe for the detection and identification of Bacillus sporothermodurans using the 16S-23S rDNA spacer region and phylogenetic analysis of some field isolates of Bacillus which form highly heat resistant spores. Syst Appl Microbiol 21:398–407
Duza MB, Mastan SA (2013) Microbial enzymes and their applications – a review. IAJPS 3:9357–9368
Giongo JL, LucasFS, Casarin F, Hebb P, Brandelli A (2007) Keratinolytic proteases of Bacillus species isolated from the Amazon basin showing remarkable de-hairing activity. World J Microbiol Biotechnol 23:375–382
Goldstein G, Flory KR, Browne BA, Majid S, Ichida JM, Burtt EH (2004) Bacterial degradation of black and withe feathers. Auk 3:656–659
Gunderson AR, Frame AM, Swaddle JP, Forsyth MH (2008) Resistance of melanized feathers to bacterial degradation: is it really so black and white? J Avian Biol 39:539–545
Gupta R, Ramnani P (2006) Microbial keratinases and their prospective applications: an overview. Appl Microbiol Biotechnol 70:21–33
Hameed A, Keshavarz T, Evans CS (1999) Effect of dissolved oxygen tension and pH on the production of extracellular protease from a new isolate of Bacillus subtilis K2, for use in leather processing. J Chem Technol Biotechnol 74:5–8
Hasan F, Shah AA, Hameed A (2009) Methods for detection and characterization of lipases: A comprehensive review. Biotechnol Adv 27:782–798
Hasan MJ, Haque P, Rahman MM (2022) Protease enzyme based cleaner leather processing: A review. J Clean Prod 365:132826. https://doi.org/10.1016/j.jclepro.2022.132826
Hathout Y, Ho YP, Ryzhov V, Demirev P, Fenselau C (2000) Kurstakins: a new class of lipopeptides isolated from Bacillus thuringiensis. J Nat Prod 63:1492–1496
Hong HA, Huang JM, Khaneja R, Hiep LV et al (2008) The safety of Bacillus subtilis and Bacillus indicus as food probiotics. J App Microbiol 105:510–520. https://doi.org/10.1111/j.1365-2672.2008.03773.x
Jemil N, Manresa A, Rabanal F, Ben Ayed H, Hmidet N, Nasri M (2017) Structural characterization and identification of cyclic lipopeptides produced by Bacillus methylotrophicus DCS1 strain. J Chromatogr B Biomed Appl. http://dx.doi.org/10.1016/j.jchromb.2017.06.013
Joshi BH (2010) Purification and characterization of a novel protease from Bacillus firmus Tap5 isolated from tannery waste. TJASR 6:1068–1076
Kim JM, Lim WJ, Suh HJ (2001) Feather-degrading Bacillus species from poultry waste. Process Biochem 37:287–291
Kouker G, Jaeger KE (1987) Specific and sensitive plate assay for bacterial lipases. Appl Environ Microbiol 53:211–213
Kumar AG, Swarnalatha S, Gayathri S, Nagesh N, Sekaran G (2008) Characterization of an alkaline active-thiol forming extracellular serine keratinase by the newly isolated Bacillus pumilus. J Appl Microbiol 104:411–419
Kumar R, Balaji, Uma TS, Mandal AB, Sehgal PK (2010) Optimization of influential parameters for extracelular keratinase production by Bacillus subtilis (MTCC9102) in solid state fermentation using horn meal - A biowaste management. Appl Biochem Biotechnol 160:30–39
Kumari V, Yadav A, Haq I, Kumar S, Bharagava RN, Singh SK, Raj A (2016) Genotoxicity evaluation of tannery effluent treated with newly isolated hexavalent chromium reducing Bacillus cereus. J Environ Manage 183:204–211. http://dx.doi.org/10.1016/j.jenvman.08.017
Kunitz M (1947) Crystalline soybean trypsin inhibitor. II. General properties. JGP 30:291–310
Lateef A, Oloke JK, Gueguim Kana EB, Sobowale BO, Ajao SO, Bello BY (2010) Keratinolytic activities of a new feather-degrading isolate of Bacillus cereus LAU 08 isolated from Nigerian soil. Int Biodeter Biodegr 64:162–165
Lilge L, Vahidinasab M, Adiek I, Becker P, Kuppusamy Nesamani C, Treinen C, Hoffmann M, Morabbi Heravi K, Henkel M, Hausmann R (2021) Expression of degQ gene and its effect on lipopeptide production as well as formation of secretory proteases in Bacillus subtilis strains. MicrobiologyOpen 10, e1241. https://doi.org/10.1002/mbo3.1241
Lima LA, Cruz Filho RF, dos Santos JG, Silva WC (2015) Protease with collagenolytic activity produced by Bacillus sp. DPUA 1728 from Amazonian soil. Braz J Microbiol. https://doi.org/10.1590/S1517-838246420130656
Long-Xian L, Sim MH, Li YD, Min J, Feng WH, Guan WJ, Li YQ (2010) Production, characterization and application of a keratinase from Chryseobacterium L99 sp. nov. Process Biochem 45:1236–1244
Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951) Protein measurement with the Folin phenol reagent. JBC 193:265–275
Macedo AJ, Beys da Silva WO, Gava R et al (2005) Novel keratinase from Bacillus subtilis S14 exhibiting remarkable dehairing capabilities. Appl Environ Microbiol 71:594–596
Macedo A, Beys-da-Silva W, Termignoni C (2008) Properties of a non collagen-degrading Bacillus subtilis keratinase. Can J Microbiol 54:180–188. https://doi.org/10.1139/w07-124
Makkar RS, Cameotra SS, Banat IM (2011) Advances in utilization of renewable substrates for biosurfactant production. AMB Express 1:1–5
Mazotto AM, Cedrola SM, Lins U, Rosado AS, Silva KT, Chaves JQ, Rabinovitch L, Zingali RB, Vermelho AB (2010) Keratinolytic activity of Bacillus subtilis AMR using human hair. LAM 50:89–96
Miller GL (1959) Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal Chem 31:426–428
Mulligan CN (2005) Environmental applications for biosurfactantes. Environ Pollut 133:183–198
Navarro AR (2005) Micronian Biotechonoly 1, Microbian Biotechnol Inst of the National University of Tucumán, San Miguel de Tucumán, Argentina. ISBN 987-05-0352-7, 1: 11–20
Nitschkea M, Costa SGVAO (2007) Biosurfactants in food industry. Trends Food Sci Technol 18:252–259
Nonami H, Fukui S, Erra-Balsells R (1997) β‐Carboline alkaloids as matrices for matrix‐assisted ultraviolet laser desorption time‐of‐flight mass spectrometry of proteins and sulfated oligosaccharides: a comparative study using phenylcarbonyl compounds, carbazoles and classical matrices. J Mass Spectrom 32:287–296
Parrado J, Rodriguez-Morgado B, Tejada M, Hernandez T, Garcia C (2011) Proteomic analysis of enzyme production by Bacillus licheniformisusing different feather wastes as the sole fermentation media. Enzyme Microb Technol 57:1–7
Parrado J, Rodriguez-Morgado B, Tejada M, Hernandez T, Garcia C (2014) Proteomic analysis of enzyme production by Bacillus licheniformis using different feather wastes as the sole fermentation media. Enzyme Microb Technol 57:1–7
Petrova DH, Shishkov SA, Vlahov SS (2006) Novel thermostable serine collagenase from Thermoactinomyces sp. 21E: Purification and some properties. J Basic Microbiol 46:275–285
Pillai P, Archana G (2008) Hide depilation and feather disintegration studies with keratinolytic serine protease from a novel Bacillus subtilis isolate. Appl Microbiol Biotechnol 78:643–650
Price NPJ, Rooney AP, Swezey JL, Perry E, Cohan FM (2007) Mass spectrometric analysis of lipopeptides from Bacillus strains isolated fromdiverse geographical locations. FEMS Microbiol Lett 271:83–89
Ramnani P, Suresh Kumar S, Gupta R (2005) Concomitant production and downstream processing of alkaline protease and biosurfactant from Bacillus licheniformis RG1: Bioformulation as detergent additive. Process Biochem 40:3352–3359
Riffel A, Brandelli A (2006) Keratinolytic bacteria isolated from feather waste. Braz J Microbiol 37:395–399
Roberts MS, Nakamura LK, Cow FM (1994) Bacillus mojavensis sp. nov., distinguishable from Bacillus subtilis by sexual isolation, divergence in DNA sequence and differences in fatty acid composition. Int J Syst Bacteriol 44:256–264
Sabaté DC, Audisio MC (2013) Inhibitory activity of surfactin, produced by different Bacillus subtilis subsp. subtilis strains, against Listeria monocytogenes sensitive and bacteriocin-resistant strains. Microbiol Res 168:125–129
Sabaté DC, Carrillo L, Audisio MC (2009) Inhibition of Paenibacillus larvae and Ascosphaera apis by Bacillus subtilis isolated from honeybee gut and honey samples. Res Microbiol 160:193–199
Sacchi CT, Whitney AM, Mayer LW, Morey R, Steigerwalt A, Boras A, Weyant RS, Popovic T (2002) Sequencing of 16S rRNA Gene: a rapid tool for identification of Bacillus anthracis. Emerg Infect Dis 8:1117–1123
Sangali S, Brandelli A (2000) Isolation and characterization of a novel feather-degrading bacterial strain. Appl Biochem Biotechnol 87:17–24
Sangeetha R, Geetha A, Arulpandi I (2010) Concomitant production of protease and lipase by Bacillus licheniformis VSG1 production, purification and characterization. Braz J Microbiol 41:179–185. https://doi.org/10.1590/S1517-838220100001000026
Schallmey M, Singh A, Ward OP (2004) Developments in the use of Bacillus species for industrial production. Can J Microbiol 50:1–17
Shaligram NS, Singhal RS (2010) Surfactin - A review on biosynthesis, fermentation, purification and applications. Food Technol Biotechnol 48:119–134
Singh A, Malaviya P (2015) Optimization of culture parameters for tannery effluent bioremediation by Bacillus galactosidilyticus APBS5-3. J Environ Biol 36:1149–1152
Souza F, Jus S, Erbel A, Kokol V, Cavaco-Paulo A, Gubitz GM (2007) A novel metalloprotease from Bacillus cereus for protein fibre processing. Enzyme Microb Technol 40:1772–1781
Stephenson K, Carter NM, Harwood CR, Petit-Glatron MF, Chambert R (1998) The influence of protein folding on late stages of the secretion of α-amylase from Bacillus subtilis. FEBS Lett 430:385–389
Suh HJ, Lee HK (2001) Characterization of a keratinolytic serine protease from Bacillus subtilis KS-1. J Protein Chem 20:165–169
Taylor MM, Bailey DG, Feairheller SH (1987) A review of the uses of enzymes in the tannery. J Am Leather Chem Assoc 82:153–164
Thanikaivelan P, Rao JR, Nair BU, Ramasami T (2004) Progress and recent trends in biotechnological methods for leather processing. Trends Biotechnol 22:181–188
Wainwrigth M (1982) A new method for determining the microbial degradation of keratin in soils. Experientia 38:243–244
Wang JJ, Shih JCH (1999) Fermentation production of keratinase from Bacillus licheniformis PWD-1 and a recombinant Bacillus subtilis FDB-29. J Ind Microbiol Biotechnol 22:608–616

No competing interests reported.

Download PDF

Editorial decision: Revision requested
04 Oct, 2024
Reviews received at journal
21 Sep, 2024
Reviews received at journal
21 Sep, 2024
Reviewers agreed at journal
05 Sep, 2024
Reviewers agreed at journal
02 Sep, 2024
Reviewers agreed at journal
02 Sep, 2024
Reviewers invited by journal
31 Aug, 2024
Editor assigned by journal
28 Aug, 2024
Submission checks completed at journal
27 Aug, 2024
First submitted to journal
18 Aug, 2024

You are reading this latest preprint version

Biotechnological properties of Bacillus amylolyquefaciens B65, strain isolated from an artisanal tannery

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Qualitative screening of enzymatic activities

Phylogenetic characterization

Specie level characterization by 16S subunit of rRNA gen

Lipopeptides UV-MALDI-MS determinations

Results

Isolation and phylogenetic characterization

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1