Study area and sample collection
Twenty-two herds in Mazandaran and Golestan provinces located on the southern coasts of the Caspian Sea, northern Iran, in the summer of 2013 were selected for this study. Ten animals with pale or hyperthermic mucous membranes were randomly selected from each herd and peripheral blood smears were prepared from their ears. Finally, 220 thin and thick blood smears were collected from 220 sheep suspected of theileriosis (100 from Mazandaran province and 120 from Golestan province) and transferred to the parasitology laboratory of Mazandaran University of Medical Sciences.
Peripheral blood smear
The Giemsa staining method was used for microscopic examination of peripheral blood smears for the presence of Theileria. Morphological parameters of the parasite such as the shape and location of each infected red blood cell are considered for accurate differentiation(Noaman 2014).
DNA extraction
To extract DNA from peripheral blood on the slide, initially, blood smears fixed were shaved with a scalpel and transferred to encoded micro tubes. DNA extraction was performed by the phenol chloroform isoamyl alcohol method. Blood samples were dissolved in lysis buffer and then 20 µl protainase k (10 mg/ml) was additional. After that to digest the proteins, the samples were incubated at 56º for 2 hours. The mixture was then mixed with phenol chloroform and centrifuged at 13400 rpm for 15 minutes. Supernatant was transferred to a new micro tube and 2.5 times the sample volume was added to that 96% ethanol. Then the samples were placed at-20 ° C for 45 minutes and then centrifuged at 13,400 rpm for 15 minutes. Washing was performed with 70 ° ethanol and finally extracted DNA air-dried, liquefied in Tris-EDTA (TE) buffer at 55º C, and finally kept at -20 degrees until use.
PCR assay
The two genera Babesia and Theileria were differentiated by PCR and using specific primers derived from hyper variable region of 18srRNA with a piece length of 420-430 bp listed in Table 1.
On the other hand, there is a difference of approximately 30 bp during PCR products of these two parasites, which can be easily detected by 1.5% agarose gel (ShayanHooshmand et al. 2008).
The PCR reaction with a final volume of 25 microliters, including 12.5 μl master mix, 0.5 μl of each primer, 5μl of DNA template and 6.5 μl deionized water was performed by the Thermo cycler (Bio-Rad).Also the temperature program used for the PCR reaction: 5 min at 95°C, 38 cycles of 94°C for 45s, 56° for 45s, 72°C for 45s and a final extension step for 10 min. For visual detection by ultraviolet transillumination, we used 1.5% agarose gel electrophoresis with Syber green stain.
Table1. The sequences of specific primers(Shayan et al. 2008)
|
PCR product (bp) Nucleotide sequences No
|
|
426-430 (Theileria) 5 CACAGGGAGGTAGTGACAAG 3 P1
389-402 (Babesia) 5 AAGAATTTCACCTATGACAG 3 P2
|
Detection of Theileria lestoquardi
For PCR detection of T. lestoquardi, the final volume of the reaction was 25 microliters considering 100 to 400 ng of DNA. The primer sequence used is given in Table 2. Also, the temperature program used to perform the PCR reaction was: 95 ° C for 5 minutes to denature DNA, 35 - 38 cycles of 45 seconds at 54 - 58°C, 45 seconds at 72°C and 45 seconds at 94°C. Finally, PCR was accomplished with the additional extention phase for 10 minutes (Shayan and Rahbari 2007). Finally, 1.5% agarose gel and electrophoresis were used to confirm the amplification
Table2. The sequences specific primers of T. lestoquardi (Shayan and Rahbari 2007)
|
Name
|
Gene
|
Nucleotide sequences
|
PCR product
|
|
Theileria Le-sense
|
T. lestoquardi ms1-2 gene AJ006448 NCBI
|
5·GTTACTCTCACTTCATGTGAG 3·
|
669 bp
|
|
Theileria Le-antisense
|
5·GGAGAACTTGTCGACAGCTGG 3·
|