Activation of glial cells induces proinflammatory properties in brain capillary endothelial cells

doi:10.21203/rs.3.rs-4947167/v1

Download PDF

Article

Activation of glial cells induces proinflammatory properties in brain capillary endothelial cells

https://doi.org/10.21203/rs.3.rs-4947167/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Purpose

The blood-brain barrier (BBB), formed by brain endothelial cells (BECs) ensures a stable microenvironment inside the brain by regulating transport of blood-borne molecules to the brain. However, neurodegenerative diseases are often accompanied by neuroinflammation and BBB impairment mediated by activated glial cells through their release of proinflammatory cytokines. To study the effects of glial cells with respect to BECs activation, we aimed to develop an in vitro BBB model with inflammation by preactivating glial cells and subsequently studying their impact on BECs.

Methods

Primary mixed glial cells (MGCs) mainly containing astrocytes and microglia were lipopolysaccharide (LPS)-stimulated, after which the LPS-containing medium was removed. The glial cells were then co-cultured with differentiated, unstimulated primary mouse BECs in transwells meaning that the BECs were under influence solely from cytokines and other pro-inflammatory molecules released from the activated glial cells. The cytokine expression by MGCs and secretion to the culture medium were quantitated after LPS stimulation using qPCR and Meso Scale analysis. The effects of the inflammatory stimuli from MGCs on the BECs were then measured through changes in BBB integrity, evaluated by trans-endothelial electrical resistance (TEER), passive permeability and tight junction proteins alterations, and possibly altered expression of adhesion molecules. The effects of the indirect stimulation of the MGCs on BECs was further compared to the effects on BECs directly stimulated with LPS.

Results

LPS stimulation of MGCs significantly upregulated mRNA expression of interleukin 6, interleukin 1β, and tumor necrosis factor α and significantly increased the secretion of several pro-inflammatory cytokines, e.g. IL-6, TNF-α, KC/ GRO (CXCL1) and IL-12p70. Proving that these cytokines influenced BECs, co-culturing BECs with pre-stimulated MGCs significantly affected the barrier integrity similar to direct stimulation with LPS of the BECs leading to lowering of TEER and increased permeability. Tight junction expression was unaltered, but with rearrangements of tight junction proteins. Expression of cell-adhesion molecules was significantly increased in BECs co-cultured with LPS-prestimulated MGCs when compared to that of directly stimulation with LPS.

Conclusion

Activating MGCs denotes a setting where glial cells influence and transform BECs into a proinflammatory phenotype .

Biological sciences/Neuroscience/Blood brain barrier

Biological sciences/Biological techniques

Biological sciences/Biological techniques/Biological models

Blood-brain barrier

Neuroinflammation

In-vitro BBB model

Glial cells

LPS

Neurodegenerative diseases are increasingly common in the rapidly aging population (Hou et al., 2019). They affect the central nervous system (CNS) by progressive cellular dysfunction and cell death in specific brain areas leading to diseases such as Alzheimer´s disease, Parkinson's disease, amyotrophic lateral sclerosis, and multiple sclerosis (MS) (Schain and Kreisl, 2017; Shigemoto-Mogami et al., 2018). Neurodegenerative diseases are often accompanied by neuroinflammation and blood-brain barrier (BBB) impairment mediated by activated glial cells (microglia and astrocytes), which trigger the release of proinflammatory cytokines (Brandl and Reindl, 2023; Takata et al., 2021; Wilson et al., 2023).

The BBB protects the brain from harmful substances circulating in the bloodstream by regulating the transport of molecules, cells, and ions from the blood to the brain. The BBB consists of a monolayer of specialized brain endothelial cells (BECs) supported and regulated by pericytes and astrocytes (Abbott et al., 2010, 2006; Cardoso et al., 2010; Daneman and Prat, 2015). The BECs are tightly interconnected by tight junctions, like claudin-5 (CLD5) and occludin (OCLN), which have intracellular domains that bind the cytoplasmic scaffold proteins zonula occludens (ZO1-3). Tight junctions are responsible for the integrity of the BBB by regulating paracellular diffusion, thereby ensuring low passive transport into the brain (Abbott et al., 2010, 2006; Cardoso et al., 2010; Daneman and Prat, 2015).

Activation of glial cells can affect the integrity of the BBB, but decreased integrity of the BBB can also activate glial cells, why it remains unclear whether BBB dysfunction is a cause or a result of neurodegeneration with neuroinflammation (Takata et al., 2021). Microglia cells are the brain's resident immune cells, and together with the astrocytes, these protect the CNS from insults, like infection, injury, and disease (Sofroniew, 2020; Takata et al., 2021). Through pattern recognition receptors, such as Toll-like receptors (TLRs), glial cells recognize pathogen-associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs) and become activated. When activated microglia and astrocytes can polarize into either a pro- (M1, A1) or anti-inflammatory phenotype (M2, A2) (Kwon and Koh, 2020; Skrzypczak-Wiercioch and Sałat, 2022; Takata et al., 2021; Zhao et al., 2022). M1 microglia secrete pro-inflammatory cytokines and chemokines like tumor necrosis factor α, (TNFα), interleukin 1β (IL-1β), and interleukin 6 (IL-6), which are known to decrease the BBB permeability and alter TJ protein expression (Almutairi et al., 2016; Brandl and Reindl, 2023; Rochfort et al., 2016, 2014; Wang et al., 2014; Zhao et al., 2022), but also recruit additional cells, e.g., leukocytes, from the circulation by upregulating the expression of cell adhesion molecules, like Intercellular Adhesion Molecule 1 (ICAM-1) and vascular cell adhesion protein 1 (VCAM-1) on BECs (Almutairi et al., 2016; Galea, 2021; Lécuyer et al., 2016). The microglia proinflammatory M1 phenotype can be activated via proinflammatory stimuli like interferon-γ (INFγ) and lipopolysaccharide (LPS), found in the outer wall of gram-negative bacteria (Brandl and Reindl, 2023; Kwon and Koh, 2020).

Transwell assays are popular for modeling the BBB in vitro and are widely used to study transport mechanisms and drug delivery strategies at the BBB (Hede et al., 2021; Helms et al., 2016; K.B. Johnsen et al., 2019; Thomsen et al., 2021, 2017). Among the basic characteristics, a valid in vitro model expresses low paracellular permeability, high expression of tight junction proteins, and several functional transporters, including efflux transporters (Brandl and Reindl, 2023; Cardoso et al., 2010; Helms et al., 2016; Reichel et al., 2003; Thomsen et al., 2021), however, these characteristics correlate to an intact BBB. In vitro BBB models for studying the mechanisms and the cell-cell interactions related to neuroinflammation and BBB impairment in neurodegenerative diseases, are also highly relevant.

A popular source for modeling inflammatory stimuli in vivo and in vitro is LPS, as this molecule is a potent PAMP that triggers a pronounced inflammatory cascade, resulting in the production of inflammatory mediators (Gaillard et al., 2003; Haileselassie et al., 2020; Poetsch et al., 2010; Skrzypczak-Wiercioch and Sałat, 2022; Vizuete et al., 2022; Zhen et al., 2018). In vivo, LPS triggers neuroinflammation both upon cerebral administration and by systemic inflammation when administered peripherally (Galea, 2021; Skrzypczak-Wiercioch and Sałat, 2022). In vitro, LPS can stimulate glial cells to secrete proinflammatory cytokines (Shigemoto-Mogami et al., 2018; Zhen et al., 2018) but has also been used to stimulate BECs directly leading to changed BBB permeability (De Vries et al., 1996a; Gaillard et al., 2003; Poetsch et al., 2010). This does not resemble the effect on the BECs from proinflammatory cytokines secreted by activated glial, but rather the direct effect of LPS on the barrier integrity.

The present study, therefore, attempted to develop an alternative in vitro BBB model with inflammation where murine mBECs (mBECs) are co-cultured with mixed glial cells (MGCs) pre-stimulated with LPS, to investigate the response of mBECs cultivated with activated MGCs and thereby the effect of the secretion of pro-inflammatory cytokines from MGCs on the BECs phenotype. The model was compared to mBECs stimulated directly with LPS. We hypothesized that preactivation of MGCs would cause an inflammatory state of the BECs mimicking neuroinflammation to a greater extent than direct LPS stimulation. Our observations suggest that pre-stimulating glial cells before co-culturing with BECs results in high secretion of pro-inflammatory cytokines, which subsequently alters the integrity of BECs, reorganizes their tight junction expression, and increases their expression of adhesion molecules, thereby transforming BECs to exhibit a neuroinflammatory phenotype.

Isolation of mixed glia cells (MGCs)

Primary mouse MGCs were isolated from one to two-day-old C57BL/6 mice as previously described (Thomsen et al., 2021, 2017). The study has been conducted accordance with the relevant guidelines. The methods concerning handling of the mice were performed in accordance with the ARRIVE statement guidelines. The Danish Experimental Animal Inspectorate under the Ministry of Food and Agriculture approved all handling of the mice (permission no.: 2016-15-0201-00979). In short, the mice brains were suspended in Dulbecco's modified Eagle medium (DMEM) (Cat. no. 31966, Thermo Scientific) and filtered through a 40 µm nylon strainer. Flasks precoated with poly-L-lysine (Cat. no. P6282, Sigma/Millicell Merck KGaA) were used to culture the MGCs. MGC medium consisting of DMEM mixed with 10% fetal calf serum (FCS) (Cat. no. 10270, Thermo Scientific) and 10 µg/mL gentamicin sulfate (Cat. no. 17-518Z, Lonza Copenhagen) was added to the flasks and subsequently placed in a CO₂ incubator with 5% CO₂ and 95% O₂ at 37°C, with a change of medium twice a week. After three weeks, the MGCs were either frozen in DMEM supplemented with 30% FCS and 7.5% dimethyl sulfoxide (Cat. no. D2650, Sigma/Millicell Merck KGaA) for later use, or transferred to 12-well plates precoated with poly-L-lysine. MGCs were additionally cultivated for two weeks before being stimulated with LPS or co-cultured with mouse BECs (mBECs).

LPS stimulation of MGCs

To investigate the response of the MGCs to LPS, cultures of MGCs were stimulated with 100 ng/mL LPS for three or 48 hours. After three hours of incubation with LPS, the medium was replaced with MGC medium, and cells and medium were subsequently harvested after three, six, 24, and 48 hours (Fig. 1A). Non-LPS-stimulated MGCs served as a control. The cells were lysed for gene expression analysis and the medium was analyzed with mesoscale multiplex analysis for cytokine profiling.

To analyze the morphological changes of the MGCs and expression of the toll-like receptor 4 (TLR4) after LPS stimulation, the MGCs were seeded on poly-L-lysine coated coverslips and stimulated for three hours with LPS before the medium was replaced with MGC-medium without LPS. The MGCs were cultured for an additional six hours before being fixated with either paraformaldehyde or ice-cold − 20°C 99.9% methanol for immunocytochemistry.

Mesoscale Multiplex Analysis

The cytokine levels in the media from LPS-stimulated MGCs and non-stimulated MGCs were measured using MesoScale electrochemiluminescence with the V-PLEX mouse Proinflammatory Panel 1 (IFNγ, IL-1β, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12p70, Keratinocyte chemoattractant/human growth-regulated oncogene (KC/GRO) (also known as CXCL1) and TNF-α (Cat. no K15012). Media from three control and three LPS-stimulated MGC cultures from each time point (three, six, and 24 hours), were pooled and run in duplicates. To determine the protein concentration of each cytokine, a SECTOR Imager 6000 (MSD Mesoscale Discovery, USA) plate reader was applied. Samples were analyzed in duplicates and 25 µl was loaded in each well. Data analysis was carried out using MSD Discovery Workbench software.

Isolation of mouse brain capillary endothelial cells (mBECs)

Primary cultures of mBECs were isolated from the brains of eight-week-old C57BL/6 female mice as described previously (Thomsen et al., 2021, 2017). All procedures and handling of mice were approved by the Danish National Council for Animal Welfare (Permit number: 2016-15-0201-00979). Mice used in the experiment were purchased from Javier Labs. All animals had unrestricted access to food and water and were housed under stable temperature conditions between 20–22°C, humidity 40–60%, and a light-dark cycle of 12 hours. The mice were deeply anesthetized using isoflurane and a total number of 90 mice were used for these experiments equal to six isolations of primary mBECs. The brains were isolated, and the meninges and visible white matter were removed. The gray matter was cut into small pieces in ice-cold DMEM-F12 (Cat. no. 31331, Thermo Scientific). The tissue was digested in a suspension of DMEM-F12, containing collagenase type II (1 mg/ml) (Cat. No. C6885, Sigma/Millicell Merck) and DNase I (20 µg/mL) (Cat. No. D4513, Sigma/Millicell Merck) and placed on an incubating mini shaker at 37°C for 75 min. The homogenate was mixed and centrifuged in 20% bovine serum albumin (Cat. No. EQBAH62, Europa Bioproducts) in DMEM-F12 to separate the cells. The microvessels present in the cell pellet were further treated with DMEM-F12 supplemented with collagenase/dispase (1 mg/ml) and DNase I (7.5 mg/µl) in a mini shaker (200 rpm) at 37°C for 50 min. A 33% Percoll gradient (Cat. No. P1644, Sigma/Millicell Merck) was used to separate and isolate the microvessels. The isolated microvessels were cultured in mBEC medium consisting of DMEM-F12 supplemented with 10% plasma-derived bovine serum (Cat. No. 60-00-810, First Link), 0.1 mg/mL Insulin-Transferrin-Sodium Selenite Supplement (Cat. No.11074547001, Sigma/Millicell Merck), 10 µg/mL gentamicin sulfate, and freshly added 1 ng/mL basic fibroblast growth factor (Cat. No. 100-18B, PeproTech Nordic), in flasks precoated with collagen IV (Cat. no. C5533, Sigma/Millicell Merck) and fibronectin (Cat. no. F1141, Sigma/Millicell Merck). For the first four days of culturing, the medium was supplemented with 4 µg/ml Puromycin, to minimize pericyte contamination (Calabria et al., 2006; Perrière et al., 2005). The cells were cultured in a CO₂ incubator with 5% CO₂ and 95% O₂ at 37°C. Four days after isolation of mBECs, they were either frozen in endothelial media, supplemented with 20% FSC (a total concentration of 30%) and 7.5% dimethyl sulfoxide, or directly passaged on to 12 well-hanging culture inserts for the establishment of a co-culture BBB models with MGCs.

Establishment of BBB in vitro models

mBECs were seeded in hanging culture inserts pre-coated twice with 1 mg/mL collagen IV and 1 mg/mL fibronectin diluted in Milli-Q water at a density of approximately 100,000 cells/cm². To obtain a confluent monolayer, the mBECs s were placed in a CO₂ incubator with 5% CO₂ and 95% O₂ at 37°C for approximately 24–48 hours to obtain confluent monolayers, before co-culturing with MGCs. To further induce tight junction formation the mBEC, medium in the luminal chamber was supplemented with 550 nM hydrocortisone (Cat. no. H4001, Sigma/Millicell Merck), 250 mM CTP-cAMP (Cat. no. C3912, Sigma/Millicell Merck), and 17,5 mM RO 20-1724 (Cat. no. B8279, Sigma/Millicell Merck), and the medium in the abluminal chamber contained 1:1 mixture of mBECs medium and MGCs medium, supplemented with 550 nM hydrocortisone.

Establishment of inflammatory in vitro BBB models

We created three different scenarios of LPS stimulation to create in vitro BBB models with inflammation (Fig. 2). Two models were designed to investigate the direct effect of LPS on the seeded mBEC monolayer, while the third model was designed to investigate the indirect effect of LPS on the mBECs, by pre-stimulating MGCs with LPS, thereby activating these to increase their production of pro-inflammatory cytokines. The third model therefore investigates the effect of a range of cytokines secreted by MGCs on the mBECs. The models are referred to as luminal LPS, abluminal LPS, and activated MGCs (aMGCs), respectively. On day one, the mBECs in all three models were co-cultured with non-stimulated MGCs and tight junction induced. The next day (day two), the three models were created by using 100 ng/mL LPS (serotype 055:B5, Cat. No L2880, Sigma/Millicell Merck).

The luminal LPS model was established by adding LPS to the luminal chamber for three hours before the medium was replaced with mBECs medium without LPS. The mBECs were incubated for an additional six hours before the transendothelial electrical resistance (TEER) was measured and the mBECs lysed for gene expression analysis.

The abluminal LPS model was established by adding LPS to the abluminal chamber for three hours before the medium was replaced with mBECs medium without LPS and the mBECs were incubated for an additional 6 hours before TEER was measured and the mBECs lysed for gene expression analysis.

The aMGC model was established by stimulating a culture of MGCs with LPS for three hours before the medium was replaced and the aMGCs were co-cultured with induced mBECs cultured on hanging culture inserts. The mBECs were co-cultured with the aMGCs for either six hours before TEER was measured and the mBECs lysed for gene expression analysis or for 24 hours before TEER was measured and the mBECs were fixated for immunocytochemistry.

Non-stimulated mBECs co-cultured with MGCs with a change of the luminal medium served as the control for the luminal LPS model, (luminal control), and non-stimulated mBECs co-cultured with MGCs with a change of the abluminal medium served as the control for the abluminal LPS and aMGC models (abluminal control) (Fig. 3).

TEER measurements

The integrity of mBECs was assessed by TEER measurements using a Millicell ERS-2 epithelial volt-ohm Meter and STX01 Chopstick Electrodes (Merck Millipore, Hellerup, Denmark, DK). The measured TEER of the mBECs was subtracted from the value of an empty collagen IV/fibronectin-coated hanging culture insert containing only medium. The differences between TEER measured in the co-culture and the TEER of an empty hanging insert were multiplied by the area of the culture inserts. TEER was measured daily and before and after experiments. The calculated TEER values are presented as mean Ω × cm² ± Standard Deviation (SD).

Apparent permeability of 3H-D-Mannitol

The apparent permeability of 3H-D-Mannitol was investigated in the aMGC model after 24 hours to further investigate the influence of the aMGCs on the mBECs barrier integrity. The passive permeability across the mBEC monolayer was measured by adding 1 µCi/ml 3H-D-Mannitol (Specific activity 15.9 Ci/mol) to the luminal chamber of the filter insert (Thomsen et al., 2021). mBECs cultured with non-stimulated MGCs served as control. TEER was measured before the addition of 3H-D-Mannitol, and the cells were incubated for two hours at 37 ºC under mild agitation. During the incubation period, 100 µl samples were taken from the luminal chamber at 0 hours and 100 µl samples were taken from the abluminal chamber at 0, 15, 30, 60, 90, and 120 min and replaced with the same volume of fresh media. Samples were mixed with Ultima Gold™ liquid scintillation cocktail and counted in a Hidex 300SL liquid scintillation counter (Kem-En-Rec Nordic, Taastrup, Denmark). The total amount of millimoles transported in each well was plotted against time and the flux at steady state was calculated as the slope of the straight line divided by the area of the filter insert. The apparent permeability (Papp) was then calculated by dividing the flux at a steady state with the initial concentration in the upper compartment. The calculated Papp data were plotted against the TEER value for each filter insert or collectively plotted regardless of TEER.

Immunocytochemistry

Immunocytochemistry was performed on mBECs from the aMGC model and non-stimulated mBEC controls, LPS-stimulated MGCs, and non-stimulated MGCs. The cells were washed twice in 0.1M PBS, fixed for 10 minutes in 4% paraformaldehyde at room temperature, and subsequently washed twice in 0.1M PBS. Non-specific binding sites were inhibited by adding a blocking buffer containing 3% BSA, and 0.3% Triton-X-100 diluted in 0.1M PBS for 30 min to avoid unspecific binding of antibodies. All incubations were performed at room temperature under mild agitation. mBECs were incubated with the following primary antibodies: rabbit anti-CLD5 (cat. no SAB4502981, Sigma/Millicell Merck), rabbit anti-OCLN (cat. no. ABT 146, Sigma/Millicell Merck), and rabbit anti-ZO-1 (ZO-1; cat. no. 61-7300, Zymed_Lab/Invitrogen), rat anti-VCAM (cat. no. AB19569, Abcam), and hamster anti-ICAM-1 (cat. no. MA5405, ThermoScientific Life Technology) all diluted 1:200 in incubation buffer. MGCs were incubated with the following primary antibodies: rabbit anti-glial fibrillary acidic protein (GFAP; cat. no. Z0334, Dako) and rat anti-cluster of differentiation molecule 11B (CD11B; cat. no. MCA74, Serotec), and mouse anti-TLR4 (Cat.no. sc-293072, Santa Cruz) all diluted 1:250 in incubation buffer. For immunolabelling of TLR4, the MGCs were fixed with ice-cold − 20°C 99.9% methanol for 10 minutes instead of with paraformaldehyde. After one hour of incubation with the primary antibodies, the cells were washed twice in washing buffer (blocking buffer diluted 1:50 in PBS) to remove unbound primary antibodies.

Secondary donkey anti-rabbit Alexa Flour 594 (cat. no. A21207, Invitrogen), goat anti-mouse Alexa Flour 594 (cat. no. 1037286, Invitrogen), donkey anti-mouse Alexa Flour 488 (cat. no. 41225A, Invitrogen), goat anti-rabbit Alexa Flour 488 (cat. no. A11034, Invitrogen), goat anti-rat Alexa Flour 594 (cat. no. A11007, Invitrogen), and goat-anti-hamster Alexa Flour 488 (cat. no. A21110, Invitrogen) antibodies were diluted 1:200 in incubation buffer and incubated with the cells for one hour at room temperature. The secondary antibodies were removed, and cells were subsequently washed twice in PBS. For staining of the nuclei, the cells were incubated for 5 min with 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) (1 mg/ml; cat. no. D9542) diluted 1:500 in PBS. Afterward, cells were mounted on object slides using fluorescent mounting media (cat. no. S3023, DAKO). For examination of the cells, an AxioObserver Z1 fluorescence microscope equipped with an Apotome and Axiocam MR camera or a LSM900 confocal microscope (Zeiss) was used. Using ImageJ software, the included immunocytochemistry images were adjusted for brightness and contrast.

Reverse transcriptase quantitative polymerase chain reaction (RT-qPCR)

RNA isolation

RNA was isolated from mBECs (one sample corresponded to 3 hanging culture inserts) from the three inflammatory in vitro models together with their respective controls. RNA was additionally isolated from the LPS-stimulated MGCs and non-stimulated MGCs (one sample corresponds to two wells in a 12-well plate) at various time points. The Purification of RNA was conducted using the Thermo Scientific GeneJET purification kit (cat. no. K0731, Thermo Scientific) following the manufacturer's protocol. In brief, the cells were lysed with lysis buffer supplemented with 14.3 M beta-mercaptoethanol, and 96% ethanol was added to the lysed samples. Subsequently, the cell lysate was added to the purification columns followed by multiple washing steps using the two washing buffers included in the kit, before eluting the RNA with nuclease-free water. To determine the concentration and purity of the RNA samples, a DS-11 FX Spectrophotometer (DeNovix, USA) was utilized.

cDNA synthesis

Before synthesizing complementary DNA (cDNA), genomic DNA was removed from the purified RNA samples. In RNase-free tubes, DEPC-treated water, 10X reaction buffer with MgCl₂, and DNase I enzyme (cat. no. K0731, Thermo Scientific) were mixed with 300 ng RNA from each sample. The samples were incubated in a T100TM thermal cycler (Bio-Rad) for 30 minutes at 37°C. After incubation, ethylenediaminetetraacetic acid (EDTA) (cat. no. K0731, Thermo Scientific) was added to each sample before another incubation step for 10 minutes at 65°C. For synthesizing cDNA from the DNase-treated RNA samples, Maxima H Minus First Strand cDNA Synthesis Kit (Cat. no. K1651, Thermo Scientific) was used. In RNase-free tubes, 250 ng RNA (MGCs) or 60–150 ng (mBECs) DNase-treated RNA from each sample was mixed with oligo (dT)18 primers, random hexamer primers, 10 mM dNTP mix, 5X RT buffer, and Maxima H Minus Enzyme Mix, and nuclease-free water to reach a final volume of 20 µl. The samples were then incubated for 10 minutes at 25°C, 15 minutes at 50°C, and 5 minutes at 85°C, in the thermal cycler.

qPCR

The synthesized cDNA samples from MGCs were analyzed by qPCR to measure the relative gene expression of Il6, Il-1β, Tnfα, while cDNA samples from mBECs were analyzed for relative gene expression of Cldn5, Ocln, and Tjp1. Actin beta (Actb) and hypoxanthine phosphoribosyltransferase 1 (Hprt1) were used as reference genes (Table 1). Before the qPCR analysis, the DNase-treated samples were tested for DNA contamination, by analyzing them as reverse transcriptase minus (RT-) negative controls, and standard curves with 10 x serial dilutions were made to validate primers. Primer efficiencies of 92–108% were accepted and set to 100%. Samples were analyzed in triplicates, with a final volume of 10 µl consisting of 2 ng cDNA mixed with a master mix containing Maxima™ SYBR Green and forward- and reverse primer. The samples were analyzed using the QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific) with a thermal profile: 95°C for 10 min, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 min, and a melt curve cycle of 95°C for 15 seconds, 60°C for 1 min, and 95°C for 15 seconds.

For mBECs relative gene expression of glucose transporter 1 (Glut1), Transferrin receptor (Tfr), Solute carrier family 3 member 2 (Slc3a2, also known as cluster of differentiation 98 heavy chain (CD98hc)), Icam1, and Vcam1 and the reference gene Hprt1, probe-based qPCR was utilized. In short, 2 ng cDNA was mixed with a master mix containing TaqMan Multiplex MasterMix (cat. no. 4484262) and 1 µl of Taqman Probes for Hprt1 (cat. no. 4448490) in combination with 1 µl of either, Glut1 (cat. no. 4331182), Tfr (cat. no. 4351370), Slc3a2 (cat. no. 4331182), Icam1 (cat. no. 4331182), or Vcam1 (cat. no. 4331182) reaching a final volume of 20 µl. Samples were analyzed in the QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific), with a thermal profile: 95°C for 20 sec, followed by 40 cycles of 95°C for 1 second and 60°C for 20 seconds.

The relative gene expression ratio of Il6, Il-1β, Tnfα, Cldn5, Ocln, and Tjp1 were calculated according to the method described by Pfaffl (Pfaffl, 2001) normalizing the data to the geometric mean of the expression of the two reference genes Actb and Hprt1 and using the non-LPS-stimulated cells as the reference sample. The relative gene expression ratio of Glut1, Tfr, Slc3a2, Icam1, and Vcam1 was calculated using the delta-delta CT method using the non-LPS-stimulated cells as the reference sample.

Table 1

Primer sequences used in RT-qPCR reactions
Gene	Forward primer	Reverse primer
Actb	CTGTCGAGTCGCGTCCACC	TCGTCATCCATGGCGAACTGG
Hprt1	GTTGGATACAGGCCAGACTTTGTTG	GATTCAACTTGCGCTCATCTTAGGC
Il6	ACAGAAGGAGTGGCTAAGGACCA	TCTGACCACAGTGAGGAATGTCCA
IL-1β	TGCCACCTTTTGACAGTGATGAGAA	TGTTGATGTGCTGCTGCGAGA
TNF-α	CTGGCCAACGGCATGGATCT	AGCAAATCGGCTGACGGTGT
Cldn5	AGGATGGGTGGGCTTGATCCT	GTACTCTGCACCACGCACGA
Ocln	GATTCCGGCCGCCAAGGTT	TGCCCAGGATAGCGCTGACT
Tjp1	GAGACGCCCGAGGGTGTAGG	TGGGACAAAAGTCCGGGAAGC

Statistical analysis

All data are shown as mean ± Standard deviation (SD), and all statistical tests were performed using GraphPad Prism (version 10.2.3). All experiments were repeated several times, using cells from different isolations, and each n-value refers to each experiment unless otherwise stated in the figure legend. No statistical tests were performed to determine sample size. All statistical analyses were two-sided, and a p-value of ≤ 0.05 was considered statistically significant. All data sets were analyzed for outliers using the ROUT test and for equal variances using either an F-test (two groups) or a Brown-Forsynthe test (three groups). When equal variances were met, datasets were analyzed using an unpaired T-test (two groups) or an ordinary One-way ANOVA with Tukey’s post hoc analysis. When equal variances were not met, which was only the case for a few data sets containing two groups, these were analyzed using the non-parametric Mann-Whitney t-test. Data sets containing more than two variables were analyzed using a Two-way ANOVA with Tukey's multiple comparisons test or an Uncorrected Fisher's LSD. The details of the specific statistical analysis used are reported in figure legends.

Stimulating MGSs with LPS for only three hours is sufficient for MGC activation

To investigate the effect of LPS on MGCs, these were stimulated with 100 ng/µl LPS for three hours before the medium was changed to remove LPS. Medium and MGCs were subsequently sampled three, six, 24, and 48 hours later (Fig. 1A), to measure the levels of inflammatory cytokines. Three hours after removing LPS, the mRNA expression of Il-6, Il-1β, and Tnfα significantly increased in stimulated MGCs compared to non-stimulated MGCs (Fig. 1B). The gene expression levels of all three cytokines remained significantly elevated for 24 hours but decreased to levels close to baseline after 48 hours. The highest expression of the cytokines was found after three hours and steadily declined hereafter, except for Il-1β, which remained at high levels for 24 hours. When stimulating the MGCs with LPS continuously for 48 hours, the gene expression of the cytokines increased, however only Tnfα was found to be significantly higher than the non-stimulated MGCs (Fig. 1B). To investigate the cytokine profile secreted by the LPS-stimulated MGCs, a Meso Scale Discovery electrochemiluminescent assay was carried out using the medium collected three, six, and 24 hours after LPS removal (Fig. 1C). IL-6 was secreted in the highest concentration, peaking 24 hours after LPS removal, followed by TNF-α and KC/ GRO and IL-12p70, which all peaked after six hours. The LPS-stimulated MGCs also secreted IFNγ, IL-2, IL-5, IL-10, and IL-1β though at low levels, and no detectable secretion of IL-4 was observed (Fig. 1C). Together these data reveal that three hours of LPS stimulation is sufficient to activate MGCs and increase their expression and secretion of multiple cytokines for at least 24 hours.

Next, the composition of the MGC culture and expression of the TLR4 was investigated (Fig. 1D-E). The cultures were stained for the astrocytic marker, GFAP, and the microglia marker, CD11b. The MGCs were found to be a mixture of GFAP-expressing astrocytes, and CD11b-expressing microglia cells. No major difference in morphology or distribution of the two cell types was found in response to LPS stimulation. LPS exerts its effect through the stimulation of the TLR4 receptor (Kielian, 2006) and independent of LPS stimulation, TLR4 colocalized with the microglia marker CD11b (Fig. 1E), thus showing the microglial cells in the MGC cultures expressed TLR4, which complies with several studies (Olson and Miller, 2004; Papageorgiou et al., 2016). No specific TLR4 expression was found in the astrocytes, why the effect of LPS is believed to be mainly through the initial activation of microglial cells and subsequent activation of astrocytes by microglia secreted cytokines (Fig. 1E). The expression of TLR4 was also confirmed in mBECs on both a gene and protein level and was likewise not found to be influenced by LPS stimulation (data not shown).

Co-culturing pre-LPS stimulated MGCs with mBEC affects barrier integrity similarly to direct LPS stimulation of the mBECs

Next to investigate the effect of the cytokine response, created by pre-stimulating MGCs with LPS, on the integrity of mBECs, an in vitro BBB model with inflammation was established (referred to as aMGCs) (Fig. 2). This model was compared to mBECs directly influenced by three hours of LPS stimulation in either the abluminal or luminal chamber (referred to as abluminal LPS and luminal LPS, respectively), followed by a medium change to remove LPS. All three cultures were compared to non-stimulated MGCs, following the same procedures of medium change (Fig. 2). Firstly, the effect of activated MGCs and direct LPS on the mBECs integrity was analyzed by the measure of TEER. Mean TEER values of 131.9 ± 52.7 W*cm² (luminal control), 144.4 ± 49.9 W*cm² (luminal LPS), 146.1 ± 33.5 W*cm² (abluminal control), 147.1 ± 47.7 W*cm² (abluminal LPS) and 154.9 ± 49.5 W*cm² (aMGCs) were measured before LPS stimulation. Nine hours after LPS stimulation (6 hours after LPS removal) the relative TEER reduction was calculated (Fig. 3A). Luminal LPS stimulation significantly reduced the barrier integrity of the mBECs by 25.6 ± 17.5% compared to luminal control, where only a 6.3 ± 13.5% reduction was observed (P = 0.0395) (Fig. 3A). Likewise a significant reduction, was seen when mBECs were stimulated abluminal with LPS (24.4 ± 19.5%, P = 0.002) or co-cultured with pre-stimulated aMGCs (21.9 ± 13.7%, P = 0.0036) compared to abluminal control, which increased by 12 ± 13.3%. Inflammation has been associated with BBB impairment, which can involve the downregulation or degradation of tight junction proteins (Alkabie et al., 2016; Haileselassie et al., 2020; Park et al., 2023). Therefore, the mBECs were investigated for potential changes in the gene expression pattern of three highly expressed tight junction proteins six hours after LPS removal. No significant changes were observed in the gene expression levels of Cldn5, Ocln, or Tjp1 when comparing luminal LPS to the luminal control and when comparing abluminal LPS and aMGC-stimulated mBECs with the abluminal control (Fig. 3B), suggesting that the decreased TEER was not accompanied by changed tight junction gene expression levels. However, a tendency towards a lower transcriptional expression of Cldn5 was seen in all LPS-stimulated models compared to controls, a tendency not observed for Ocln, or Tjp1 (Fig. 3B).

To further evaluate the barrier integrity of the aMGCs model, TEER and the paracellular permeability (Papp) to 3H-D-Mannitol, a small molecule normally not able to cross the BBB, were investigated 24 hours after co-culturing with the LPS-stimulated MGCs (Fig. 3C-D). Furthermore, changes in the composition of tight junction proteins were likewise evaluated using immunocytochemical staining. Before co-culturing mBECs with aMGCs or non-stimulated MGCs (control) both cultures displayed TEER values above 130 Ω*cm² (Gaillard and de Boer, 2000; Thomsen et al., 2021, 2017) (Control: 158.4 ± 15.6 Ω*cm², aMGCs: 156.5 ± 11.6 Ω*cm²). However, 24 hours later mBECs of the aMGCs model had significantly lower TEER values (Fig. 3C), with an average of 115.3 ± 10 Ω*cm², whereas the control mBECs increased in TEER to 185.2 ± 18.3 Ω*cm² (P < 0.0001) (Fig. 4A). The percentage relative decrease in TEER for each culture insert, therefore showed a 5.5 ± 4.9% increase in TEER for control mBECs, while mBECs of the aMGC model showed a significant decrease in integrity, corresponding to 26.25 ± 6.9% (P < 0.0001) (Fig. 3C). When assessing the paracellular permeability of 3H-D-Mannitol, a significantly higher Papp to 3H-D-Mannitol was observed in mBECs co-cultured with aMGCs compared to control mBECs (1.1x10^− 5±1.6x10-6 s/cm, 9.2x10^− 6±6.3x10^− 7 s/cm respectively) (P = 0.0045) corresponding well with the lower TEER values observed in these cells (Fig. 3D).

The tight junction composition and localization of the essential tight junction proteins OCLN, CLD5, or ZO1 in the mBECs of the aMGC model (Fig. 3E) were evaluated using immunocytochemistry. The expression of the tight junction proteins was highly, evenly, and robustly expressed at the cell-cell borders of the mBEC cultured with non-stimulated MGCs (abluminal control), however, mBECs from the aMGC model showed some tendency to a more uneven and not coherently expressed protein expression, revealing small gaps between adjacent cells. However, a complete breakdown of the barrier integrity was not observed, due to TEER values staying above 110 Ω*cm² and never dropping below levels measured in non-induced mBECs (30–50 Ω*cm²) and the Papp remaining in the low range for mBECs isolated from mice (Gaillard and de Boer, 2000; Thomsen et al., 2021, 2017) (Fig. 3E).

mBECs of the aMGCs model have increased expression of cell-adhesion molecules

Neuroinflammation in vivo is accompanied by increased expression of cell adhesion molecules for the recruitment of leukocyte migration across the BBB (Abadier et al., 2015; Lopes Pinheiro et al., 2016; Varatharaj and Galea, 2017). To further evaluate the inflammatory response in the mBECs, the relative gene expression of the two cell-adhesion molecules Icam1 and Vcam1 were investigated (Fig. 4A, B). mRNA expression of Vcam1 was significantly increased in mBECs stimulated with LPS in the luminal (P = 0.004) and abluminal chamber (P = 0.0026), but to an even higher degree when mBECs were co-cultured with LPS pre-stimulated MGCs (P = 0.0001) (Fig. 4A). Icam1 expression increased when LPS was added in the abluminal chamber, but only significantly when mBECs were co-cultured with pre-stimulated aMGCs compared to control mBECs (P = 0.0177) (Fig. 4A). The changes observed at the gene expression levels of the adhesion molecules were further investigated in mBECs of the aMGCs model using immunocytochemistry (Fig. 4B). ICAM-1 and VCAM-1 expression was almost non-detectable in the control mBECs but increased drastically in mBECs of the aMGCs model after 24 hours (Fig. 4B). This upregulation of ICAM-1 and VCAM-1 indicates that the aMGCs model can mimic the upregulation of adhesion molecules observed in brain endothelial in vivo in diseases like MS (Bö et al., 1996).

Finally, the changes in the gene expression levels of several potential drug delivery targets were investigated in all three models and compared to their respective controls. The mRNA expression levels of Tfr, one of the most studied drug delivery targets at the BBB (Johnsen et al., 2017; Kasper Bendix Johnsen et al., 2019), normally involved in the transport of iron into the brain were not influenced by the inflammatory response created by either direct or indirect LPS stimulation (Fig. 4C). The solute carrier, Glut1, responsible for glucose transport into the brain, almost significantly decreased when mBECs were directly luminal-LPS stimulated compared to control mBECs (P = 0.0503). The addition of LPS in the abluminal chamber or co-culturing mBECs with pre-stimulated aMGCs did not influence Glut1 mRNA expression. On the other hand, gene expression levels of Scl3a2, also known as the BBB target CD98hc (Chew et al., 2023), significantly increased when mBECs were co-cultured with pre-stimulated aMGCs compared to the abluminal control (P = 0.0369) (Fig. 4C). Together these data show that mBECs respond to the inflammatory reaction created by LPS, by upregulating both adhesion molecules but also changing the expression of some BBB targets used for drug delivery purposes. The highest effect of LPS was however, observed in mBECs of the aMGC model that were co-cultured with MGCs pre-stimulated with LPS, suggesting this method of mimicking the effect of neuroinflammation on the BBB might be superior to the direct effect of LPS.

This study reports on an in vitro BBB model with inflammation for studying the effects of proinflammatory mediators secreted by MGCs on the BEC's integrity and phenotypic expression of cell adhesion molecules and transporter proteins. We developed a model, where MGCs are pre-stimulated with LPS for only three hours, which was sufficient to activate aMGCs before these were co-cultured with BECs. Pre-activated MGCs increased their expression and secreted a variety of both pro- and inflammatory cytokines up to 24 hours after removal of LPS. The effect of LPS is believed to be initiated through TLR4 (Olson and Miller, 2004; Papageorgiou et al., 2016), which is primarily expressed by microglial cells. The inflammatory reaction created by pre-stimulating the MGCs with LPS significantly affected the BBB integrity and increased the expression of adhesion molecules, suggesting that this model is valid for further studies on the neuroinflammatory phenotype of BECs when influenced by proinflammatory mediators secreted by activated MGCs.

Pre-stimulating MGCs with LPS is sufficient to exert a strong inflammatory effect for up to 24 hours.

Stimulating MGCs with LPS for only three hours resulted in a strongly increased gene expression of Il-1β, Il-6, and Tnf-α, which remained elevated for min 24 hours. Both Il-6 and Tnf-α were expressed in the highest amounts three hours after removal of LPS stimuli, followed by a steadily declined expression, returning to normal after 48 hours. The half-life of Tnf-α mRNA from mice astrocytes has been measured to be 0.3 hours, whereas it increases to 0.9 following LPS stimulation (Li et al., 2012). The short half-life of Tnf-α mRNA means that the MGCs continue to produce mRNA long after removing the LPS stimuli. Increased gene expression levels of Il-6, Il-1β and TNFα upon 100ng/ml LPS stimulation of primary microglial cells were reported previously but also confirmed on a protein level (He et al., 2021).

We further analyzed the secretion of a panel of cytokines up to 24 hours after LPS removal and found a robust secretion of IL-6 and TNFα with peak secretion six hours after LPS was removed, with concentrations above 20 ng/mL and 4.7 ng/mL respectively. This is in line with a previous study demonstrating increased IL-6 and TNFα secretion in brain homogenates after sepsis and in pure cultures of primary mouse astrocytes following stimulation with 100 ng/mL LPS (Beurel and Jope, 2009).

Normally, low levels of IL-6 are present in the brain, but during neuropathological changes as seen in MS, Parkinson, and Alzheimer´s disease higher brain expression of IL-6 is observed (Rothaug et al., 2016). IL-6 is furthermore essential for the symptom development associated with MS, as IL-6-deficient mice are resistant to the detrimental effects of the experimental autoimmune encephalomyelitis model of MS (Okuda et al., 1998; Samoilova et al., 1998). IL-6 can stimulate a response through either canonical or trans-signalling. The IL-6 receptor α (IL-6R) is required for canonical signaling, and within the CNS, this receptor is only expressed by microglia, while cells like astrocytes, neurons, and endothelial cells, lack IL-6R but can respond to IL-6 through trans-signaling via soluble IL-6R residing in the cytoplasm. Hence, IL-6 can activate two distinct pathways, the classic anti-inflammatory pathway through the IL-6 receptor as well as the pro-inflammatory pathway through trans-signaling that mediates neurodegeneration (Rothaug et al., 2016; West et al., 2019). Thus, IL-6 seems to have both beneficial and harmful effects (Gruol and Nelson, 1997; West et al., 2019). IL-6 secreted by microglia can therefore via pro-inflammatory trans-signaling activate astrocytes to increase their expression and secretion of IL-6, especially in the presence of other pro-inflammatory cytokines (Van Wagoner et al., 1999), but also disrupt the barrier integrity of BECs via IL-6 mediated upregulation of VCAM-1 and ICAM-1 (Eugster et al., 1998; Rothaug et al., 2016), corresponding well to the observation reported in the present study.

TNF-α is a pro-inflammatory cytokine primarily secreted by microglia following activation and can induce the activation of adjacent resting microglia or astrocytes, thereby resulting in an unregulated inflammatory CNS response (A. Frankola et al., 2011). TNF-α has therefore also been shown to play a vital role in neurodegeneration, as anti-TNFα approaches can alleviate CNS disease symptoms (A. Frankola et al., 2011; Chang et al., 2017). Here we demonstrate that only three hours of LPS stimulation of MGCs induced a potent TNF-α secretion peaking six hours after LPS removal reaching a concentration of 4.7 ng/mL, which is comparable to the 3 ng/mL previously reported by Kong et al., after stimulating MGCs with 100 ng/mL LPS for six hours (Kong et al., 1997). Interestingly, despite these MGCs being stimulated with the same concentration of LPS, the length of stimuli does not seem to increase the TNF-α secretion significantly. Likewise, Welser-Alves et al. have investigated the secretion of TNF-α from 1 µg/mL LPS-stimulated mouse MGCs, which is a ten times higher concentration of LPS than used in the present study. They exposed the cells for 48 hours and measured the TNF-α concentration to be around 1.9 ng/mL (Welser-Alves and Milner, 2013), which is somewhat lower than our concentration of 2.9 ng/mL after 24 hours. Combined these data suggest that increasing the concentration and incubation time of LPS do not increase the inflammatory response exerted by the MGCs.

KC/GRO also known as CXCL1 is a chemokine that plays a role in BBB disruption during neuroinflammation and previous studies have identified the main source of KC/GRO secretion to be from astrocytes (Shigemoto-Mogami et al., 2018), suggesting that the initial effect of LPS on microglia, secondarily also activates the astrocytes. It has furthermore been reported that CXCL1 affects leukocyte recruitment to brain vessels during LPS-induced inflammation (Wu et al., 2015), which corresponds well with an increased expression of ICAM-1 and VCAM-1 in mBECs co-cultured together with pre-stimulated MGCs in the aMGCs model, as a consequence of their increased secretion of KC/GRO. The secretion of KC/GRO peaked 6 hours after the change of media, reaching a concentration of 5 ng/mL. Liu et al. have reported similar results after stimulating primary rat astrocytes with 1 µg/mL, where the concentration of CXCL1 peaks after three hours of stimulation with a concentration of around 6.5 ng/mL (Liu et al., 2018).

Microglia are activated in response to LPS both in vitro and in vivo, initiating the immune response by secreting proinflammatory cytokines, which further induces astrogliosis (He et al., 2021; Liddelow et al., 2017). Our immunolabeling confirms that only microglia of the MGC culture express TLR4, why only microglia cells can respond to LPS stimulation, corresponding well to previous observations that pure cultures of rat astrocytes do not respond to LPS, as these lack TLR4 receptor and downstream signaling components required for LPS activation (Liddelow et al., 2017). Reactive microglia can also via eg. TNF-α secretion induces the reactive A1 phenotype of astrocytes (Liddelow et al., 2017). Other studies do however report on cytokine secretion after LPS stimulation of astrocytic cultures (Beurel and Jope, 2009; Li et al., 2012; Liu et al., 2018), which could suggest that these astrocytic cultures have been contaminated with microglial cells that subsequently activate astrocytes to increase the secretion of various cytokines, as the same isolation procedure can be used to isolate both astrocytes and microglial cells (Thomsen et al., 2021).

mBECs in the aMGC model exhibit a neuroinflammatory phenotype

A majority of neurodegenerative diseases are accompanied by neuroinflammation, thus understanding the detrimental effect of neuroinflammation on the BBB is imperative. Despite LPS being an endotoxin found in the outer wall of gram-negative bacteria, it has been used for many years to induce both systemic- and neuroinflammation, as it promotes the release of various cytokines and chemokines through microglia activation (Cunningham, 2013; Kwon and Koh, 2020). The neuroinflammatory effect can also be mimicked by stimulating BECs with particular cytokines e.g. IL-1β, IL-6, and TNF-α (De Vries et al., 1996b; Poetsch et al., 2010), however, this might be a simplification of the complicated nature of neuroinflammation. In vitro BBB models are useful tools for studying various properties of the BBB (Thomsen et al., 2021), however existing models often study the direct effect of LPS on the BECs (Alkabie et al., 2016; Banks et al., 2015; Haileselassie et al., 2020; Hultman et al., 2010; Poetsch et al., 2010; Veszelka et al., 2007), which can lead to apoptosis (Cardoso et al., 2012). Co-culturing mBECs with pre-activated MGCs is, therefore, an alternative method for mimicking the effect of glial-mediated inflammation on BBB properties, without LPS having any direct effect on mBECs. Instead, BECs are affected by the cytokines secreted by pre-stimulated MGCs, corresponding well with the neuroinflammatory state in vivo.

A somewhat similar approach of activating MGCs before co-culturing with mBECs has been described previously (Park et al., 2023; Shigemoto-Mogami et al., 2018). Shigemoto et al activated microglial cells for one hour with 1µg/mL LPS before transferring them to astrocytic culture in the abluminal compartment of an in vitro triple co-culture model, resulting in decreased TEER values, higher permeability, and lower protein levels of ZO1, OCLN, and CLD5 (Park et al., 2023; Shigemoto-Mogami et al., 2018). Park et al took a slightly different approach by using immortalized cells to establish a contact co-culture BBB model with endothelial cells and astrocytes and established a proinflammatory response by exposing the model to activated microglial conditioned media obtained from an LPS (50ng/mL) stimulated microglial cell line. Again a decreased BBB integrity was demonstrated through decreased TEER values and lower protein expression of ZO1, OCLN, and CLD5 (Park et al., 2023). Prestimulating MGCs instead of only microglial cells might mimic the signaling between microglia and astrocytes, as activated microglia are responsible for the further induction of astrogliosis (He et al., 2021; Liddelow et al., 2017).

Studies point towards decreased BBB integrity during inflammation (Banks et al., 2015; Cardoso et al., 2012; Haileselassie et al., 2020; Kwon and Koh, 2020; Poetsch et al., 2010; Veszelka et al., 2007; Zhao et al., 2022), underlining the effect of pro-inflammatory cytokines released from activated MGCs on the BECs phenotype. The present study compared the effect of cytokine secretion from activated MGCs on the mBECs in the aMGCs model to the direct effect of LPS on mBECs via either luminal or abluminal stimulation. We found decreased integrity determined by TEER measurements, but no significant changes in the gene expression levels of the tight junction proteins zo1, ocln, and cld5. Compared to control mBECs, mBECs of the aMGC, luminal LPS, and abluminal LPS models, all showed similar decreases in TEER around 20–25%. mBECs of the aMGC model therefore show a similar effect on BBB permeabilty as directly stimulating the mBECs with LPS. This suggests that the secretion of cytokines from the pre-activated MGCs and TLR4 activation via direct LPS stimulation of the mBECs decreases the BBB permeability through different pathways. Luminal LPS stimulation affects the mBECs through their expression of TLR4, while abluminal stimulation results in both TLR4 activation of mBECs and MGCs while co-culturing mBECs with pre-stimulated MGCs represent a response solely from the cytokine production. It has previously been reported that the addition of either TNF-α, IL-1β, or IL-6 can result in a significant reduction in TEER (De Vries et al., 1996b; Poetsch et al., 2010). These cytokines are all secreted by the activated MGCs and may therefore be responsible for the affected barrier integrity, as seen in the abluminal LPS and aMGCs model. Despite the decreased BBB integrity seems to occur via different pathways, neither of them seems to be through decreased gene expression levels of Cld5, Ocln, or Tjp1, but rather through post-transcriptional changes resulting in decreased protein levels or functional changes of the tight junction organization (Alkabie et al., 2016; Cardoso et al., 2012; Haileselassie et al., 2020; Park et al., 2023; Shigemoto-Mogami et al., 2018; Veszelka et al., 2007). To further investigate how the integrity of the mBECs in the aMGC model was affected, we measured TEER and the passive permeability of 3H-D-Mannitol, 24 hours after the model was established. The control barriers did not decrease in TEER and some even showed increased integrity, whereas the mBECs of the aMGC model still showed a 25% decrease in TEER after 24 hours and a significantly higher permeability to 3H-D-Mannitol. This is a lower decrease in TEER than previously reported by Banks, where they observed a 40% decrease when 100 ng/mL LPS was given directly to the BECs. We furthermore observed an uneven and non-consistently expression of tight junction proteins revealing small gaps between adjacent cells, which could reflect a disrupted function of the TJ proteins, rather than a downregulation of gene expression. Several studies have observed similarly displaced alteration in the arrangement of the tight junction proteins ZO1, OCLN, and CLD5 (Banks et al., 2015; Cardoso et al., 2012; Veszelka et al., 2007).

Increased trafficking of leukocytes across the inflamed BBB is an early event in some neurodegenerative diseases, and it is known that the adhesion molecules ICAM-1 and VCAM-1 are of great importance for this process (Abadier et al., 2015; Lopes Pinheiro et al., 2016; Wong et al., 1999). The mBECs had an increased expression of the adhesion molecules ICAM-1 and VCAM-1 especially in the mBECs of the aMGC model, supporting the findings of previous studies (Coisne et al., 2006; Haileselassie et al., 2020). In normal physiological conditions, the mBECs express very low levels of adhesion molecules, increasing this expression significantly during inflammation. This corresponds highly with the observation made in the present study where mBECs of the aMGCs model also displayed a strong upregulation of both ICAM and VCAM at a protein level. Direct luminal LPS stimulation of the mBECs did not have a significant impact on the expression of Icam1, suggesting that this gene is regulated by the cytokines secreted from the LPS-stimulated MGCs such as KC/GRO, as mentioned previously, rather than through TLR4 activation of mBECs. The increased expression of cell adhesion molecules in the mBECs of the aMGCs model makes this model very suitable for further studies on leukocyte migration across the BBB in a setting with inflammation.

TEER and tight junction degradation represent histological BBB disruption, whereas alterations in the expression of specific BBB transporters represent molecular BBB disruption. The transporters Glut1, Tfr, and CD98hc were investigated to determine the relative gene expression upon direct and indirect LPS stimulation. The expression of Tfr did not seem to be affected by LPS or cytokine secretion from activated MGC. However, the relative gene expression of Glut1 showed a tendency for a decreased expression as an effect of direct luminal LPS. Alzheimer's disease has been associated with decreased GLUT1 expression in brain endothelial cells, leading to BBB dysfunction (Liebner et al., 2018; Montagne et al., 2017). Slc3a2 did, however, present a tendency towards increased expression, when stimulated abluminally with LPS, reaching a significant increase when stimulated directly with LPS, suggesting that secretion of cytokines from LPS-stimulated MGCs affects the gene expression of this potential BBB target. Unfortunately, no protein expression of CD98hc was included in this study due to unsuccessful immunolabeling with CD98hc antibodies. If the finding of CD98hc being upregulated as a consequence of neuroinflammation can be verified on a protein level, and in vivo, it might increase the potential of this receptor as a target for BBB transfer of neurodegenerative drugs.

In conclusion, the stimulation of MGCs with LPS for three hours increased the expression of multiple pro- and anti-inflammatory cytokines and chemokines. Co-culturing mBECs with the pre-activated MGCs resembles a BBB model with inflammation where the sole influence of the secreted cytokines on the BBB can be studied, without the need to use direct LPS stimulation of mBECs. Comparable to direct LPS stimulation of mBECs, mBECs of the aMGCs model exhibited decreased barrier integrity, without a complete breakdown of the barrier, but rather an altered functional organization of the tight junction proteins. Furthermore, the mBECs of the aMGCs model increased their expression of cell adhesion molecules to a higher degree than when stimulated directly with LPS, making this model highly interesting for studies on leukocyte migration across the BBB during inflammation. mBECs of the aMGCs model therefore display a neuroinflammatory phenotype with glial activation continuing even after the removal of stimuli making this model suitable for directly studying the effects of cytokine secretion on the molecular alterations occurring at the BBB during neuroinflammation.

Actb: Actin beta, aMGCs: Activated mixed glial cells, BBB: Blood-brain barrier, BECs: Brain endothelial cells, CD11b: Cluster of differentiation 11b, CD98hc: Cluster of differentiation 98 heavy chain. CNS: central nervous system, CLD5: Claudin 5, DAMPs: Damage-associated molecular pattern, FCS: fetal calf serum, GFAP: Glial fibrillary acidic protein, Glut1: Glucose transporter 1, Hprt1: Hypoxanthine Phosphoribosyltransferase 1, ICAM-1: Intercellular Adhesion Molecule 1, IL-1β: interleukin 1β, IL-6: interleukin 6, INFg: Interferon-g, KC/GRO: Keratinocyte chemoattractant/growth-regulated oncogene, LPS: Lipopolysaccharides, mBECs: Mouse brain endothelial cells, MGCs: Mixed glial cells, MS: Multiple Sclerosis, NeuN: Neuronal nuclei antigen, OCLN: Occludin, PAMPs: Pathogen-associated molecular patterns, Papp: Apparent permeability, TEER: Trans-endothelial electrical resistance, TFR: Transferrin receptor, Tjp1: Tight junction protein 1, TLR4: Toll-like receptor 4, TNF-α: Tumor necrosis factor α, PBS: phosphate-buffered saline, VCAM-1: Vascular cell adhesion protein 1, ZO-1: Zonula occludens

ETHICS APPROVAL AND CONCENT TO PARTICIPATE
Not relevant

CONCENT FOR PUBLICATION
Not relevant

AVAILABILITY OF DATA AND MATERIALS
Data is provided within the manuscript

COMPETING INTERESTS
None

FUNDING
The present study has been supported by the Danish Multiple Sclerosis Society (Grant no. R588-A40233 to T Moos), the Lundbeck Foundation Research Initiative on Brain Barriers and Drug Delivery (Grant no. R155-2013-14113 to T. Moos), Svend Andersen Fonden and Fonden for Lægevidenskabens Fremme.

AUTHOR CONTRIBUTIONS
Conceptualization: SSH, LGR, MST, Funding acquisition: AB, MST, TM, SSH, Investigation: AB, SSH, YAM, MBF, JNHJ, HH, SED, FP, LGR, KL, MST, Supervision: AB, LGR, MST, TM, Visualization: ABL, SSH, MST, Writing – original draft: AB, SSH, TM, MST, Writing – review and editing: AB, SSH, YAM, MBF, JNHJ, HH, SED, FP, LGR, KL, TM, MST

ACKNOWLEDGEMENTS
We thank Merete Fredsgaard and Hanne Krone Nielsen, Aalborg University, Denmark, for their excellent technical assistance.

A. Frankola, K., H. Greig, N., Luo, W., Tweedie, D., 2011. Targeting TNF-Alpha to Elucidate and Ameliorate Neuroinflammation in Neurodegenerative Diseases. CNS Neurol. Disord. - Drug Targets 10, 391–403. https://doi.org/10.2174/187152711794653751
Abadier, M., Haghayegh Jahromi, N., Cardoso Alves, L., Boscacci, R., Vestweber, D., Barnum, S., Deutsch, U., Engelhardt, B., Lyck, R., 2015. Cell surface levels of endothelial ICAM-1 influence the transcellular or paracellular T-cell diapedesis across the blood-brain barrier. Eur. J. Immunol. 45, 1043–1058. https://doi.org/10.1002/eji.201445125
Abbott, N.J., Patabendige, A.A.K., Dolman, D.E.M., Yusof, S.R., Begley, D.J., 2010. Structure and function of the blood-brain barrier . Neurobiol. Dis. 37, 13–25. https://doi.org/10.1016/j.nbd.2009.07.030 [doi]
Abbott, N.J., Ronnback, L., Hansson, E., 2006. Astrocyte-endothelial interactions at the blood-brain barrier . Nat. Rev. 7, 41–53. https://doi.org/nrn1824 [pii]
Alkabie, S., Basivireddy, J., Zhou, L., Roskams, J., Rieckmann, P., Quandt, J.A., 2016. SPARC expression by cerebral microvascular endothelial cells in vitro and its influence on blood-brain barrier properties. J. Neuroinflammation 13. https://doi.org/10.1186/s12974-016-0657-9
Almutairi, M.M.A., Gong, C., Xu, Y.G., Chang, Y., Shi, H., 2016. Factors controlling permeability of the blood-brain barrier. Cell. Mol. Life Sci. https://doi.org/10.1007/s00018-015-2050-8
Banks, W.A., Gray, A.M., Erickson, M.A., Salameh, T.S., Damodarasamy, M., Sheibani, N., Meabon, J.S., Wing, E.E., Morofuji, Y., Cook, D.G., Reed, M.J., 2015. Lipopolysaccharide-induced blood-brain barrier disruption: Roles of cyclooxygenase, oxidative stress, neuroinflammation, and elements of the neurovascular unit. J. Neuroinflammation 12. https://doi.org/10.1186/s12974-015-0434-1
Beurel, E., Jope, R.S., 2009. Lipopolysaccharide-induced interleukin-6 production is controlled by glycogen synthase kinase-3 and STAT3 in the brain. J. Neuroinflammation 6. https://doi.org/10.1186/1742-2094-6-9
Bö, L., Peterson, J.W., Mørk, S., Hoffman, P.A., Gallatin, W.M., Ransohoff, R.M., Trapp, B.D., 1996. Distribution of immunoglobulin superfamily members ICAM-1, -2, -3, and the β2 integrin LFA-1 in multiple sclerosis lesions. J. Neuropathol. Exp. Neurol. 55, 1060–1072. https://doi.org/10.1097/00005072-199655100-00006
Brandl, S., Reindl, M., 2023. Blood–Brain Barrier Breakdown in Neuroinflammation: Current In Vitro Models. Int. J. Mol. Sci. https://doi.org/10.3390/ijms241612699
Calabria, A.R., Weidenfeller, C., Jones, A.R., De Vries, H.E., Shusta, E. V., 2006. Puromycin-purified rat brain microvascular endothelial cell cultures exhibit improved barrier properties in response to glucocorticoid induction . J. Neurochem. 97, 922–933. https://doi.org/JNC3793 [pii]
Cardoso, F.L., Brites, D., Brito, M.A., 2010. Looking at the blood-brain barrier: Molecular anatomy and possible investigation approaches. Brain Res. Rev. 64, 328–363. https://doi.org/10.1016/j.brainresrev.2010.05.003
Cardoso, F.L., Kittel, Á., Veszelka, S., Palmela, I., Tóth, A., Brites, D., Deli, M.A., Brito, M.A., 2012. Exposure to lipopolysaccharide and/or unconjugated bilirubin impair the integrity and function of brain microvascular endothelial cells. PLoS One 7. https://doi.org/10.1371/journal.pone.0035919
Chang, R., Knox, J., Chang, J., Derbedrossian, A., Vasilevko, V., Cribbs, D., Boado, R.J., Pardridge, W.M., Sumbria, R.K., 2017. Blood-Brain Barrier Penetrating Biologic TNF-α Inhibitor for Alzheimer’s Disease. Mol. Pharm. 14, 2340–2349. https://doi.org/10.1021/acs.molpharmaceut.7b00200
Chew, K.S., Wells, R.C., Moshkforoush, A., Chan, D., Lechtenberg, K.J., Tran, H.L., Chow, J., Kim, D.J., Robles-Colmenares, Y., Srivastava, D.B., Tong, R.K., Tong, M., Xa, K., Yang, A., Zhou, Y., Akkapeddi, P., Annamalai, L., Bajc, K., Blanchette, M., Cherf, G.M., Earr, T.K., Gill, A., Huynh, D., Joy, D., Knight, K.N., Lac, D., Leung, A.W.S., Lexa, K.W., Liau, N.P.D., Becerra, I., Malfavon, M., McInnes, J., Nguyen, H.N., Lozano, E.I., Pizzo, M.E., Roche, E., Sacayon, P., Calvert, M.E.K., Daneman, R., Dennis, M.S., Duque, J., Gadkar, K., Lewcock, J.W., Mahon, C.S., Meisner, R., Solanoy, H., Thorne, R.G., Watts, R.J., Zuchero, Y.J.Y., Kariolis, M.S., 2023. CD98hc is a target for brain delivery of biotherapeutics. Nat. Commun. 14. https://doi.org/10.1038/s41467-023-40681-4
Coisne, C., Faveeuw, C., Delplace, Y., Dehouck, L., Miller, F., Cecchelli, R., Dehouck, B., 2006. Differential expression of selectins by mouse brain capillary endothelial cells in vitro in response to distinct inflammatory stimuli. Neurosci. Lett. 392, 216–220. https://doi.org/10.1016/j.neulet.2005.09.028
Cunningham, C., 2013. Microglia and neurodegeneration: The role of systemic inflammation. Glia 61, 71–90. https://doi.org/10.1002/glia.22350
Daneman, R., Prat, A., 2015. The blood–brain barrier. Cold Spring Harb. Perspect. Biol. 7. https://doi.org/10.1101/cshperspect.a020412
De Vries, H.E., Blom-Roosemalen, M.C.M., De Boer, A.G., Van Berkel, T.J.C., Breimer, D.D., Kuiper, J., 1996a. Effect of endotoxin on permeability of bovine cerebral endothelial cell layers in vitro. J. Pharmacol. Exp. Ther. 277, 1418–1423.
De Vries, H.E., Blom-Roosemalen, M.C.M., Van Oosten, M., De Boer, A.G., Van Berkel, T.J.C., Breimer, D.D., Kuiper, J., 1996b. The influence of cytokines on the integrity of the blood-brain barrier in vitro. J. Neuroimmunol. 64, 37–43. https://doi.org/10.1016/0165-5728(95)00148-4
Eugster, H. Pietro, Frei, K., Kopf, M., Lassmann, H., Fontana, A., 1998. IL-6-deficient mice resist myelin oligodendrocyte glycoprotein-induced autoimmune encephalomyelitis. Eur. J. Immunol. 28, 2178–2187. https://doi.org/10.1002/(SICI)1521-4141(199807)28:07<2178::AID-IMMU2178>3.0.CO;2-D
Gaillard, P.J., de Boer, A.G., 2000. Relationship between permeability status of the blood-brain barrier and in vitro permeability coefficient of a drug . Eur. J. Pharm. Sci. 12, 95–102. https://doi.org/S0928-0987(00)00152-4 [pii]
Gaillard, P.J., De Boer, A.G., Breimer, D.D., 2003. Pharmacological investigations on lipopolysaccharide-induced permeability changes in the blood-brain barrier in vitro. Microvasc. Res. 65, 24–31. https://doi.org/10.1016/S0026-2862(02)00009-2
Galea, I., 2021. The blood–brain barrier in systemic infection and inflammation. Cell. Mol. Immunol. 18, 2489–2501. https://doi.org/10.1038/s41423-021-00757-x
Gruol, D.L., Nelson, T.E., 1997. Physiological and pathological roles of interleukin-6 in the central nervous system. Mol. Neurobiol. 15, 307–339. https://doi.org/10.1007/BF02740665
Haileselassie, B., Joshi, A.U., Minhas, P.S., Mukherjee, R., Andreasson, K.I., Mochly-Rosen, D., 2020. Mitochondrial dysfunction mediated through dynamin-related protein 1 (Drp1) propagates impairment in blood brain barrier in septic encephalopathy. J. Neuroinflammation 17. https://doi.org/10.1186/s12974-019-1689-8
He, Y., Taylor, N., Yao, X., Bhattacharya, A., 2021. Mouse primary microglia respond differently to LPS and poly(I:C) in vitro. Sci. Rep. 11. https://doi.org/10.1038/s41598-021-89777-1
Hede, E., Christiansen, C.B., Heegaard, C.W., Moos, T., Burkhart, A., 2021. Gene therapy to the blood–brain barrier with resulting protein secretion as a strategy for treatment of Niemann Picks type C2 disease. J. Neurochem. 156, 290–308. https://doi.org/10.1111/jnc.14982
Helms, H.C., Abbott, N.J., Burek, M., Cecchelli, R., Couraud, P.O., Deli, M.A., Förster, C., Galla, H.J., Romero, I.A., Shusta, E. V., Stebbins, M.J., Vandenhaute, E., Weksler, B., Brodin, B., 2016. In vitro models of the blood-brain barrier: An overview of commonly used brain endothelial cell culture models and guidelines for their use. J. Cereb. Blood Flow Metab. 36, 862–890. https://doi.org/10.1177/0271678X16630991
Hou, Y., Dan, X., Babbar, M., Wei, Y., Hasselbalch, S.G., Croteau, D.L., Bohr, V.A., 2019. Ageing as a risk factor for neurodegenerative disease. Nat. Rev. Neurol. 15, 565–581. https://doi.org/10.1038/s41582-019-0244-7
Hultman, K., Björklund, U., Hansson, E., Jern, C., 2010. Potentiating effect of endothelial cells on astrocytic plasminogen activator inhibitor type-1 gene expression in an in vitro model of the blood-brain barrier. Neuroscience 166, 408–415. https://doi.org/10.1016/j.neuroscience.2010.01.002
Johnsen, K.B., Bak, M., Melander, F., Thomsen, M.S., Burkhart, A., Kempen, P.J., Andresen, T.L., Moos, T., 2019. Modulating the antibody density changes the uptake and transport at the blood-brain barrier of both transferrin receptor-targeted gold nanoparticles and liposomal cargo. J. Control. Release 295. https://doi.org/10.1016/j.jconrel.2019.01.005
Johnsen, K.B., Burkhart, A., Melander, F., Kempen, P.J., Vejlebo, J.B., Siupka, P., Nielsen, M.S., Andresen, T.L., Moos, T., 2017. Targeting transferrin receptors at the blood-brain barrier improves the uptake of immunoliposomes and subsequent cargo transport into the brain parenchyma. Sci. Rep. 7. https://doi.org/10.1038/s41598-017-11220-1
Johnsen, Kasper Bendix, Burkhart, A., Thomsen, L.B., Andresen, T.L., Moos, T., 2019. Targeting the transferrin receptor for brain drug delivery. Prog. Neurobiol. 181. https://doi.org/10.1016/j.pneurobio.2019.101665
Kielian, T., 2006. Toll-like receptors in central nervous system glial inflammation and homeostasis. J. Neurosci. Res. 83, 711–730. https://doi.org/10.1002/jnr.20767
Kong, L.Y., Lai, C., Wilson, B.C., Simpson, J.N., Hong, J.S., 1997. Protein tyrosine kinase inhibitors decrease lipopolysaccharide-induced proinflammatory cytokine production in mixed glia, microglia-enriched or astrocyte-enriched cultures. Neurochem. Int. 30, 491–497. https://doi.org/10.1016/S0197-0186(96)00086-1
Kwon, H.S., Koh, S.H., 2020. Neuroinflammation in neurodegenerative disorders: the roles of microglia and astrocytes. Transl. Neurodegener. https://doi.org/10.1186/s40035-020-00221-2
Lécuyer, M.A., Kebir, H., Prat, A., 2016. Glial influences on BBB functions and molecular players in immune cell trafficking. Biochim. Biophys. Acta - Mol. Basis Dis. 1862, 472–482. https://doi.org/10.1016/j.bbadis.2015.10.004
Li, X., Lin, W.J., Chen, C.Y., Si, Y., Zhang, X., Lu, L., Suswam, E., Zheng, L., King, P.H., 2012. KSRP: A checkpoint for inflammatory cytokine production in astrocytes. Glia 60, 1773–1784. https://doi.org/10.1002/glia.22396
Liddelow, S.A., Guttenplan, K.A., Clarke, L.E., Bennett, F.C., Bohlen, C.J., Schirmer, L., Bennett, M.L., Münch, A.E., Chung, W.S., Peterson, T.C., Wilton, D.K., Frouin, A., Napier, B.A., Panicker, N., Kumar, M., Buckwalter, M.S., Rowitch, D.H., Dawson, V.L., Dawson, T.M., Stevens, B., Barres, B.A., 2017. Neurotoxic reactive astrocytes are induced by activated microglia. Nature 541, 481–487. https://doi.org/10.1038/nature21029
Liebner, S., Dijkhuizen, R.M., Reiss, Y., Plate, K.H., Agalliu, D., Constantin, G., 2018. Functional morphology of the blood–brain barrier in health and disease. Acta Neuropathol. 135, 311–336. https://doi.org/10.1007/s00401-018-1815-1
Liu, S., Lu, C., Liu, Y., Zhou, X., Sun, L., Gu, Q., Shen, G., Guo, A., 2018. Hyperbaric Oxygen Alleviates the Inflammatory Response Induced by LPS Through Inhibition of NF-κB/MAPKs-CCL2/CXCL1 Signaling Pathway in Cultured Astrocytes. Inflammation 41, 2003–2011. https://doi.org/10.1007/s10753-018-0843-2
Lopes Pinheiro, M.A., Kooij, G., Mizee, M.R., Kamermans, A., Enzmann, G., Lyck, R., Schwaninger, M., Engelhardt, B., de Vries, H.E., 2016. Immune cell trafficking across the barriers of the central nervous system in multiple sclerosis and stroke. Biochim. Biophys. Acta 1862, 461–71. https://doi.org/10.1016/j.bbadis.2015.10.018
Montagne, A., Zhao, Z., Zlokovic, B. V., 2017. Alzheimer’s disease: A matter of blood-brain barrier dysfunction? J. Exp. Med. 214, 3151–3169. https://doi.org/10.1084/jem.20171406
Okuda, Y., Sakoda, S., Bernard, C.C.A., Fujimura, H., Saeki, Y., Kishimoto, T., Yanagihara, T., 1998. IL-6-deficient mice are resistant to the induction of experimental autoimmune encephalomyelitis provoked by myelin oligodendrocyte glycoprotein. Int. Immunol. 10, 703–708. https://doi.org/10.1093/intimm/10.5.703
Olson, J.K., Miller, S.D., 2004. Microglia Initiate Central Nervous System Innate and Adaptive Immune Responses through Multiple TLRs. J. Immunol. 173, 3916–3924. https://doi.org/10.4049/jimmunol.173.6.3916
Papageorgiou, I.E., Lewen, A., Galow, L. V., Cesetti, T., Scheffel, J., Regen, T., Hanisch, U.K., Kann, O., 2016. TLR4-activated microglia require IFN-γ to induce severe neuronal dysfunction and death in situ. Proc. Natl. Acad. Sci. U. S. A. 113, 212–217. https://doi.org/10.1073/pnas.1513853113
Park, J.S., Choe, K., Khan, A., Jo, M.H., Park, H.Y., Kang, M.H., Park, T.J., Kim, M.O., 2023. Establishing Co-Culture Blood–Brain Barrier Models for Different Neurodegeneration Conditions to Understand Its Effect on BBB Integrity. Int. J. Mol. Sci. 24. https://doi.org/10.3390/ijms24065283
Perrière, N., Demeuse, P.H., Garcia, E., Regina, A., Debray, M., Andreux, J.P., Couvreur, P., Scherrmann, J.M., Temsamani, J., Couraud, P.O., Deli, M.A., Roux, F., Perriere, N., Demeuse, P.H., Garcia, E., Regina, A., Debray, M., Andreux, J.P., Couvreur, P., Scherrmann, J.M., Temsamani, J., Couraud, P.O., Deli, M.A., Roux, F., 2005. Puromycin-based purification of rat brain capillary endothelial cell cultures. Effect on the expression of blood-brain barrier-specific properties . J. Neurochem. 93, 279–289. https://doi.org/JNC3020 [pii]
Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR . Nucleic Acids Res. 29, e45. https://doi.org/10.1093/nar/29.9.e45
Poetsch, V., Neuhaus, W., Noe, C.R., 2010. Serum-derived immunoglobulins neutralize adverse effects of amyloid-β peptide on the integrity of a blood-brain barrier in vitro model. J. Alzheimer’s Dis. 21, 303–314. https://doi.org/10.3233/JAD-2010-090769
Reichel, A., Begley, D.J., Abbott, N.J., 2003. An overview of in vitro techniques for blood-brain barrier studies . Methods Mol. Med. 89, 307–324. https://doi.org/1-59259-419-0-307 [pii]
Rochfort, K.D., Collins, L.E., McLoughlin, A., Cummins, P.M., 2016. Tumour necrosis factor-α-mediated disruption of cerebrovascular endothelial barrier integrity in vitro involves the production of proinflammatory interleukin-6. J. Neurochem. 136, 564–572. https://doi.org/10.1111/jnc.13408
Rochfort, K.D., Collins, L.E., Murphy, R.P., Cummins, P.M., 2014. Downregulation of blood-brain barrier phenotype by proinflammatory cytokines involves NADPH oxidase-dependent ROS generation: Consequences for interendothelial adherens and tight junctions. PLoS One 9. https://doi.org/10.1371/journal.pone.0101815
Rothaug, M., Becker-Pauly, C., Rose-John, S., 2016. The role of interleukin-6 signaling in nervous tissue. Biochim. Biophys. Acta - Mol. Cell Res. 1863, 1218–1227. https://doi.org/10.1016/j.bbamcr.2016.03.018
Samoilova, E.B., Horton, J.L., Hilliard, B., Liu, T.-S.T., Chen, Y., 1998. IL-6-Deficient Mice Are Resistant to Experimental Autoimmune Encephalomyelitis: Roles of IL-6 in the Activation and Differentiation of Autoreactive T Cells. J. Immunol. 161, 6480–6486. https://doi.org/10.4049/jimmunol.161.12.6480
Schain, M., Kreisl, W.C., 2017. Neuroinflammation in Neurodegenerative Disorders—a Review. Curr. Neurol. Neurosci. Rep. 17. https://doi.org/10.1007/s11910-017-0733-2
Shigemoto-Mogami, Y., Hoshikawa, K., Sato, K., 2018. Activated microglia disrupt the blood-brain barrier and induce chemokines and cytokines in a rat in vitro model. Front. Cell. Neurosci. 12. https://doi.org/10.3389/fncel.2018.00494
Skrzypczak-Wiercioch, A., Sałat, K., 2022. Lipopolysaccharide-Induced Model of Neuroinflammation: Mechanisms of Action, Research Application and Future Directions for Its Use. Molecules 27. https://doi.org/10.3390/molecules27175481
Sofroniew, M. V., 2020. Astrocyte Reactivity: Subtypes, States, and Functions in CNS Innate Immunity. Trends Immunol. https://doi.org/10.1016/j.it.2020.07.004
Takata, F., Nakagawa, S., Matsumoto, J., Dohgu, S., 2021. Blood-Brain Barrier Dysfunction Amplifies the Development of Neuroinflammation: Understanding of Cellular Events in Brain Microvascular Endothelial Cells for Prevention and Treatment of BBB Dysfunction. Front. Cell. Neurosci. 15. https://doi.org/10.3389/fncel.2021.661838
Thomsen, M.S., Birkelund, S., Burkhart, A., Stensballe, A., Moos, T., 2017. Synthesis and deposition of basement membrane proteins by primary brain capillary endothelial cells in a murine model of the blood-brain barrier. J. Neurochem. 140, 741–754. https://doi.org/10.1111/jnc.13747
Thomsen, M.S., Humle, N., Hede, E., Moos, T., Burkhart, A., Thomsen, L.B., 2021. The blood-brain barrier studied in vitro across species. PLoS One 16. https://doi.org/10.1371/journal.pone.0236770
Van Wagoner, N.J., Oh, J.W., Repovic, P., Benveniste, E.N., 1999. Interleukin-6 (IL-6) production by astrocytes: Autocrine regulation by IL-6 and the soluble IL-6 receptor. J. Neurosci. 19, 5236–5244. https://doi.org/10.1523/jneurosci.19-13-05236.1999
Varatharaj, A., Galea, I., 2017. The blood-brain barrier in systemic inflammation. Brain. Behav. Immun. 60, 1–12. https://doi.org/10.1016/j.bbi.2016.03.010
Veszelka, S., Pásztói, M., Farkas, A.E., Krizbai, I., Dung, N.T.K., Niwa, M., Ábrahám, C.S., Deli, M.A., 2007. Pentosan polysulfate protects brain endothelial cells against bacterial lipopolysaccharide-induced damages. Neurochem. Int. 50, 219–228. https://doi.org/10.1016/j.neuint.2006.08.006
Vizuete, A.F.K., Fróes, F., Seady, M., Zanotto, C., Bobermin, L.D., Roginski, A.C., Wajner, M., Quincozes-Santos, A., Gonçalves, C.A., 2022. Early effects of LPS-induced neuroinflammation on the rat hippocampal glycolytic pathway. J. Neuroinflammation 19. https://doi.org/10.1186/s12974-022-02612-w
Wang, Y., Jin, S., Sonobe, Y., Cheng, Y., Horiuchi, H., Parajuli, B., Kawanokuchi, J., Mizuno, T., Takeuchi, H., Suzumura, A., 2014. Interleukin-1β induces blood-brain barrier disruption by downregulating sonic hedgehog in astrocytes. PLoS One 9. https://doi.org/10.1371/journal.pone.0110024
Welser-Alves, J. V., Milner, R., 2013. Microglia are the major source of TNF-α and TGF-β1 in postnatal glial cultures; Regulation by cytokines, lipopolysaccharide, and vitronectin. Neurochem. Int. 63, 47–53. https://doi.org/10.1016/j.neuint.2013.04.007
West, P.K., Viengkhou, B., Campbell, I.L., Hofer, M.J., 2019. Microglia responses to interleukin-6 and type I interferons in neuroinflammatory disease. Glia 67, 1821–1841. https://doi.org/10.1002/glia.23634
Wilson, D.M., Cookson, M.R., Van Den Bosch, L., Zetterberg, H., Holtzman, D.M., Dewachter, I., 2023. Hallmarks of neurodegenerative diseases. Cell. https://doi.org/10.1016/j.cell.2022.12.032
Wong, D., Prameya, R., Dorovini-Zis, K., 1999. In vitro adhesion and migration of T lymphocytes across monolayers of human brain microvessel endothelial cells: Regulation by ICAM-1, VCAM-1, E- selectin and PECAM-1. J. Neuropathol. Exp. Neurol. 58, 138–152. https://doi.org/10.1097/00005072-199902000-00004
Wu, F., Zhao, Y., Jiao, T., Shi, D., Zhu, X., Zhang, M., Shi, M., Zhou, H., 2015. CXCR2 is essential for cerebral endothelial activation and leukocyte recruitment during neuroinflammation. J. Neuroinflammation 12. https://doi.org/10.1186/s12974-015-0316-6
Zhao, Y., Gan, L., Ren, L., Lin, Y., Ma, C., Lin, X., 2022. Factors influencing the blood-brain barrier permeability. Brain Res. 1788. https://doi.org/10.1016/j.brainres.2022.147937
Zhen, H., Zhao, L., Ling, Z., Kuo, L., Xue, X., Feng, J., 2018. Wip1 regulates blood-brain barrier function and neuro-inflammation induced by lipopolysaccharide via the sonic hedgehog signaling signaling pathway. Mol. Immunol. 93, 31–37. https://doi.org/10.1016/j.molimm.2017.09.020

No competing interests reported.

Download PDF

Reviews received at journal
14 Sep, 2024
Reviewers agreed at journal
04 Sep, 2024
Reviews received at journal
04 Sep, 2024
Reviewers agreed at journal
04 Sep, 2024
Reviewers invited by journal
04 Sep, 2024
Editor assigned by journal
03 Sep, 2024
Editor invited by journal
03 Sep, 2024
Submission checks completed at journal
02 Sep, 2024
First submitted to journal
20 Aug, 2024

You are reading this latest preprint version

Activation of glial cells induces proinflammatory properties in brain capillary endothelial cells

Status:

Version 1

Abstract

Purpose

Methods

Results

Conclusion

Figures

INTRODUCTION

MATERIALS AND METHOD

Isolation of mixed glia cells (MGCs)

LPS stimulation of MGCs

Mesoscale Multiplex Analysis

Isolation of mouse brain capillary endothelial cells (mBECs)

TEER measurements

Apparent permeability of 3H-D-Mannitol

Immunocytochemistry

Reverse transcriptase quantitative polymerase chain reaction (RT-qPCR)

RNA isolation

cDNA synthesis

qPCR

Statistical analysis

RESULTS

Stimulating MGSs with LPS for only three hours is sufficient for MGC activation

mBECs of the aMGCs model have increased expression of cell-adhesion molecules

DISCUSSION

mBECs in the aMGC model exhibit a neuroinflammatory phenotype

CONCLUSIONS

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1