Long non-coding RNA HOXC-AS1 promotes the malignancy by sponging miR-195-5p with ANLN in esophageal cancer

doi:10.21203/rs.3.rs-4948297/v1

Download PDF

Research Article

Long non-coding RNA HOXC-AS1 promotes the malignancy by sponging miR-195-5p with ANLN in esophageal cancer

https://doi.org/10.21203/rs.3.rs-4948297/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Long non-coding RNA HOXC cluster antisense RNA 1 (HOXC-AS1) has been found to be upregulated in gastric and prostate cancer, but its role in esophageal cancer (EC) remains unknown. This study aimed to investigate the expression and biological functions of HOXC-AS1 in EC. HOXC-AS1 expression was measured using qRT-PCR in EC cell lines. The effects of HOXC-AS1 on EC cell proliferation, migration, invasion, as well as tumor growth and metastasis in vivo, were assessed using MTT, EdU, transwell, wound healing assays, and animal models. Dual-luciferase reporter and RNA immunoprecipitation (RIP) assays were performed to explore the mechanism of action of HOXC-AS1 in EC. HOXC-AS1 was found to be upregulated in EC tissues according to TCGA database analysis. It exhibited abundant expression in EC cell lines. Suppression of HOXC-AS1 inhibited the proliferation, migration, and invasion of EC cells in vitro, as well as constrained tumor growth and metastasis in vivo. Furthermore, HOXC-AS1 functioned as a sponge for miR-195-5p, and the anillin actin-binding protein (ANLN) was identified as a direct target of miR-195-5p. Inhibition of miR-195-5p or upregulation of ANLN reversed the repressive effects of HOXC-AS1 knockdown on malignant behaviors of EC cells. This study reveals that HOXC-AS1 promotes the progression of EC through modulation of the miR-195-5p/ANLN axis, highlighting its potential as a therapeutic target for EC treatment.

HOXC-AS1

miR-195-5p

ANLN

esophageal cancer

proliferation

migration

invasion

Esophageal cancer (EC) manifests in the upper gastrointestinal tract (Tan et al. 2016) and leads to approximately 5 million deaths each year worldwide (Bray et al. 2018). Despite the advances in surgery, chemotherapy, and radiotherapy, most patients with EC are diagnosed at an advanced stage with a poor prognosis (Bracken-Clarke et al. 2018). The recurrence rate of EC is over 40%, and the overall five-year survival rate is under 20% (Rustgi and El-Serag 2014, Talukdar et al. 2018). Therefore, it is urgent to identify novel therapeutic targets for the early diagnosis, treatment, and prognosis of patients with EC.

Long non-coding RNAs (lncRNAs) are a class of RNA molecules with over 200 nucleotides in length, lacking the protein-coding ability (Esteller 2011). lncRNAs play pivotal roles in human cancers (Huarte 2015). In recent years, lncRNAs have been associated with EC tumorigenesis (Abraham and Meltzer 2017, Su et al. 2018). lncRNA-TTN-AS1 acts as an oncogene in esophageal squamous cell carcinoma (ESCC) by regulating the miR133b/FSCN1 axis (Lin et al. 2018). lncRNA PVT1 is associated with poor differentiation, lymph node metastases, and shorter survival in esophageal adenocarcinoma (Xu et al. 2019). lncRNA CASC9 promotes metastasis in EC by upregulating LAMC2 expression by binding with CBP and modifying histone acetylation (Liang et al. 2018). HOXC cluster antisense RNA 1 (HOXC-AS1) is located on chromosome 12q13 13. Recent studies have been reported that HOXC-AS1 plays a tumorigenic role in gastric and prostate cancer (Dong et al. 2019, Takayama et al. 2020). However, the function of HOXC-AS1 in EC remains uninvestigated.

In our study, we analyzed the TCGA database and discovered that HOXC-AS1 was prominently highly-expressed in EC tissues compared to the normal tissues. The expression of HOXC-AS1 was further upregulated in EC cell lines. Moreover, silencing of HOXC-AS1 could inhibit cell proliferation, migration and invasion in vitro, and tumorigenesis and metastasis in vivo. Further study revealed that HOXC-AS1 increased anillin actin-binding protein (ANLN) expression by sponging miR-195-5p. Our results suggest that HOXC-AS1 could be a new therapeutic target for EC.

TCGA data analysis

Gene expression data for 160 EC and 11 normal tissues were downloaded from the Cancer Genome Atlas (TCGA) database and processed using R software (version 3.6.1). Differentially expressed genes were | log2(fold change (FC)) | > 1.0 and adjusted the p-value < 0.05.

Cell culture

The esophageal epithelial cell line HEEC and two esophageal cancer cell lines (Eca-109 and EC9706) were procured from Jennio Biotech (Guangzhou, China). All cells were maintained in DMEM (Life Technologies, Carlsbad, CA, USA) containing 10% FBS (Sigma Aldrich, St. Louis, MO, USA) and 100 U/mL penicillin/streptomycin (Life Technologies, Carlsbad, CA, USA).

Lentivirus, oligonucleotide, plasmid, and transfection

HOXC-AS1 short hairpin RNA (sh-HOXC-AS1), CBP short hairpin RNA (sh-CBP) or negative control (NC) lentivirus were obtained from GenePharma (Shanghai, China). The EC cell lines were infected with the virus using 5 mg/ml polybrene for 48 h. Puromycin (5 µg/ml) was used to select stable cell clones for two weeks. qRT-PCR was performed to assess the knockdown efficiency. The full-length ANLN complementary DNA (cDNA) was cloned into the pcDNA3.1 vector. The mimics and inhibitors of miR-195-5p and their negative control were bought from RiboBio (Guangzhou, China). The plasmids, mimics, or inhibitors were then transfected into Eca-109 and EC9706 cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA).

Quantitative real-time reverse transcription polymerase chain reaction

The total RNA of EC cells was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and reverse-transcribed to cDNA using RNA Reverse and MicroRNA Reverse Transcription kits (Applied Biosystems, Foster City, CA, USA). Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) was performed using SYBR Select Master Mix and ABI Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). β-actin and U6 were chosen as references for mRNA and miRNA, respectively. Relative expression was quantified according to the 2^−ΔΔCt method. The sequences of the primers used are as follow: miR-195-5p RT primers: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCCAAT, PCR primers: forward 5′-GTACTAGCAGCACAGAAAT-3′, reverse 5′- CTGGGAAGGAGAGAGGGAGA-3′; U6 primers: forward 5′-CTCGCTTCGGCAGCACA-3′, reverse 5′-AACGCTTCACGAATTTGCGT-3′; HOXC-AS1 primers: forward 5′-ACCGAGCTTGAAGAAGTGTAGG-3′, reverse 5′-AAGTGTCGCAGAGATGGAGTTG-3′; CBP primers: forward 5′-CATCTTCCCAACACCTGA-3′, reverse 5′-GTCCCCTTCCACTTTCTT-3′; ANLN primers: forward 5′-CACCTATCACCTTTAAACGCCT-3′, reverse 5′-CAATGACAGGAGGTGACAGAA-3′; β-actin primers: forward 5′-GAGGGAAATCGTGCGTGAC-3′, reverse 5′-TTCTGACCCATTCCCACC-3′.

2.5 Western blot

Radioimmunoprecipitation buffer (Beyotime Biotechnology, Shanghai, China) was used to extract the total protein. Protein concentrations were measured using a BCA Protein Assay Kit (Beyotime Biotechnology, Shanghai, China). Equivalent proteins were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and subsequently transferred to a polyvinylidene fluoride membrane. the membranes were blocked with a blocking buffer and incubated overnight with the primary antibody targeting ANLN (1:1000; Abcam, Cambridge, MA, USA) and GAPDH (1:3000; Cell Signaling Technology, Beverly, MA, USA) at 4°C. Then, they were probed with the secondary antibody HRP-labeled rabbit IgG (1:5000; Cell Signaling Technology, Beverly, MA, USA) for 1 h at room temperature. The protein bands were detected using enhanced chemiluminescence.

Immunohistochemistry staining

Tissues were fixed in 4% paraformaldehyde, embedded in paraffin, and cut into 4 µm-thick slices. They were dewaxed and rehydrated using graded ethanol. antigen retrieval was incubated in Retrieval Solution, and the sections were probed with primary antibody PCNA (1:1000; abcam, Cambridge, MA, USA) and incubated with secondary antibody (1:3000, abcam, Cambridge, MA, USA). The DAB Kit (Beyotime Biotechnology, Shanghai, China) was applied to detect protein expression, and the nuclei were counterstained using hematoxylin (Sigma Aldrich, St. Louis, MO, USA).

MTT assay

Cells were seeded at 1 × 10⁴ cells per well in a 96-well plate. they were cultivated for 24 h, 48 h, 72 h, and 96 h. Then, 20 µl of MTT reagents (Sigma Aldrich, St. Louis, MO, USA) were added to each well and incubated for 4 h at 37°C. Subsequently, 150 µl of dimethylsulfoxide was added to dissolve the formazan precipitates. The optical density (OD) was measured at 490 nm using a Microplate Reader (Thermo Fisher Scientific, Waltham, MA, USA).

5-ethynyl-2′-deoxyuridine assay

Cell proliferation was measured using the 5-ethynyl-2′-deoxyuridine (EdU) assay kit (RiboBio, Guangzhou, China). Briefly, cells were inoculated into a 24-well plate and cultured for 48 h. Cells were then incubated with EdU for 2 h. Then, the cells were fixed, permeabilized, incubated with Apollo® 567, and stained using 4′,6-diamidino-2-phenylindole (Thermo Fisher Scientific, Waltham, MA, USA). The EdU positive cells were observed under a fluorescence microscope (Olympus, Tokyo, Japan).

Transwell invasion assay

Cell invasions were carried out using a 24-transwell chamber with 8 µm pore size (Corning Costar, Cambridge, MA, USA) coated with Matrigel (Corning Costar, Cambridge, MA, USA). EC cells were seeded in the upper chamber using a serum-free medium. The DMEM medium containing 10% FBS was added to the lower chamber. After incubating for 24 h, the invaded cells in the lower chamber were fixed and stained using paraformaldehyde and 0.1% crystal violet, respectively. Then, the cells were counted and photographed under a microscope with a digital camera (Olympus, Tokyo, Japan).

Wound healing assay

Cells were seeded in a 6-well plate at a density of 1×10⁵ cells per well and cultured to a 90% confluence state. Cells were scratched off using a 200 µl pipette tip. The cells were cultured for 24 h after washing. Images of wound closure were captured at 0 h and 24 h under the microscope with a digital camera (Olympus, Tokyo, Japan). The images were analyzed using ImageJ software.

Dual-Luciferase reporter assay

The wild (wt) and mutant (mut) types in HOXC-AS1 and 3′-untranslated region (UTR) of ANLN containing miR-195-5p binding site (HOXC-AS1-wt/mut, ANLN-3′UTR-wt/mut) were subcloned into psiCHECK-2 plasmids (Promega, Madison, WI, USA). Cells were co-transfected with HOXC-AS1-wt, HOXC-AS1-mut, ANLN-3′UTR-wt/mut, or ANLN-3′UTR-mut, and miR-195-5p, or control mimics using Lipofectamine 2000. they were harvested after 48 h. The luciferase activity was assessed using the dual-luciferase assay kit (Promega, Madison, WI, USA).

RNA immunoprecipitation assay

An RNA immunoprecipitation (RIP) kit (Millipore, Bedford, MA, USA) was utilized to detect the binding relationship between HOXC-AS1 and miR-195-5p. briefly, cells were lysed with RIPA lysis buffer (JRDUN, Shanghai, China). The lysates were incubated overnight with magnetic beads conjugated with Ago2 or control IgG antibody at 4°C. The magnetic bead-protein complexes were collected treated with proteinase K to digest protein complexes and recovered the RNAs from the beads. Immunoprecipitated RNA was purified and quantified using qRT-PCR.

In vivo model

All animal procedures were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals with the approval of the Ethics Committee of the First Affiliated Hospital of Xiamen University (No. 202109899). Nude mice were used for this study. The animals were sourced from Xiamen University Laboratory Animal Center (Xiamen, Fujian, China). Eca-109 cells (1×10⁷ cells/ml) infected with sh-HOXC-AS1 or NC lentiviruses were subcutaneously inoculated into the axilla of the nude mice. Tumor size was measured every 6 d. Tumor volume was calculated using the formula V = width²×length×1/2. After four weeks, the nude mice were euthanized by using CO₂ inhalation, and the tumors were collected and weighed. For the lung metastasis model, 2 × 10⁶ NC or sh-HOXC-AS1 stable Eca-109 cells co-transfected with with a Luc-lentivirus (GenePharma, Suzhou, China) which expresses luciferase were injected into the tail veins of mice. After 6 weeks, mice were evaluated lung metastasis ability using an in vivo imaging system (IVIS, PerkinElmer, Waltham, USA). After mice were sacrificed, the lungs were collected and lung metastasis was measured by hematoxylin-eosin (H&E) staining. Dmetrix software by combining the number and area of lung metastatic nodules in each mouse were calculated the metastatic foci.

ChIP assay

ChIP assays were performed with Eca-109 and EC9706 cells via ChIP Assay Kit (Thermo Fisher Scientific). In brief, Eca-109 and EC9706 cells with 1% of formaldehyde were incubated for 10 minutes to form DNA-protein cross‐links, and then cross‐linked chromatin DNAs were broken into 200 to 1000 bp‐sized segments by using an ultrasound machine. Anti‐H3K27ac antibody, anti‐CBP, antibody or IgG antibody (Abcam) was used to precipitate the chromatin the lysate. ChIP samples were analyzed via RT‐qPCR.

RNA fluorescence in situ hybridization (FISH)

Cy3-labeled HOXC-AS1 probe was purchased from GenePharma Ribo Bio (Guangzhou, China). FISH was performed using a FISH kit (Ribo Bio). EC cells were incubated with cy3-labeled HOXC-AS1 at 37℃ overnight after fixation. Nuclei were stained with DAPI. Finally, the Spinning Disc Laser Confocal Microscope (Dragonfy 200, Oxford Instruments Andor, USA) was utilized to determine the locations of HOXC-AS1 in EC cells.

Statistical analysis

Statistical analyses were performed using SPSS21.0 (SPSS Inc., Chicago, IL, USA). The data were presented as mean ± standard deviation. Differences between the two groups were compared using the student’s t-test. Differences among multiple groups were analyzed using the two-way analysis of variance. Statistical significance was set at P < 0.05.

HOXC-AS1 is upregulated in esophagus cancer tissues and cell lines

RNA sequencing data of 160 EC and 11 normal tissues from the TCGA database were analyzed to uncover the lncRNAs potentially involved in tumorigenesis and progression of EC. Figure 1A shows a heatmap with the top 30 differentially expressed lncRNAs between EC and normal tissues. As shown in Fig. 1B, the expression of HOXC-AS1 was significantly higher in EC tissues. Similar results were observed in both EC cell lines (Fig. 1c), suggesting that HOXC-AS1 might be an important factor in EC proliferation.

Effect of HOXC-AS1 on EC cell proliferation, migration, and invasion

we constructed the stable HOXC-AS1 knockdown Eca-109 and EC9706 cells using sh-HOXC-AS1 lentivirus to investigate the role of HOXC-AS1 in EC (Fig. 2A). We found that HOXC-AS1 inhibition distinctly suppressed the proliferation of Eca-109 and EC9706 cells (Fig. 2B). Similar results were obtained in the EdU proliferation assay (Fig. 2C). we discovered that the migratory rate of Eca-109 and EC9706 cells was significantly decreased after HOXC-AS1 knockdown using the wound healing assay (Fig. 2D). Consistent with the results from the wound healing assay, depletion of HOXC-AS1 impeded the cell invasion capacity of Eca-109 and EC9706 cells (Fig. 2E). These results suggest that silencing HOXC-AS1 inhibits EC progression in vitro.

Knockdown of HOXC-AS1 hinders xenograft tumor growth and metastasis in vivo

Eca-109 cells infected with sh-HOXC-AS1 lentivirus were injected into the nude mice to investigate the effects of HOXC-AS1 on EC tumor growth. As shown in Figs. 3A-C, the mice injected with sh-HOXC-AS1-transfected Eca-109 cells exhibited smaller tumors with decreasing tumor weight and volume compared to the control. The expression of HOXC-AS1 in the HOXC-AS1-knockdown tumors was lower compared to the control tumors (Fig. 3D). Moreover, immunohistochemical analysis showed reduced expression of the proliferation marker PCNA in xenograft tumor tissues from the HOXC-AS1-silencing group compared to the control group (Fig. 3E). We next assessed the effect of HOXC-AS1 on the metastasis of EC cells. The results revealed that metastasis ability can be significantly suppressed in the HOXC-AS1-knockdown group compared with the control group (Fig. 3F). H&E staining was used to confirm the lung metastatic nodules (Fig. 3G). These results suggest that downregulation of HOXC-AS1 suppresses the growth and metastasis of EC in vivo.

Increased CBP mediates the high expression of HOXC-AS1 via H3K27 acetylation modification

Thereafter, we investigated the mechanism behind the upregulation of HOXC-AS1 in EC cells. By utilizing UCSC genome browsing (http://genome.ucsc.edu/), we observed a significant enrichment of H3K27ac in the promoter region of HOXC-AS1 (Figure. 4A). As a result, we hypothesized that the increased expression of HOXC-AS1 could be attributed to H3K27ac specifically at its promoter region. To validate this hypothesis, we examined the levels of H3K27ac on the HOXC-AS1 promoter in normal cells (HEEC) as well as two EC cell lines, Eca-109 and EC9706. Our findings revealed higher levels of H3K27ac on the HOXC-AS1 promoter in both EC cell lines compared to normal cells (Figure. 4B). Subsequently, we treated EC cells with C646, an inhibitor targeting histone acetyltransferase (HAT), and observed a decrease in HOXC-AS1 expression compared to control cells treated with dimethyl sulfoxide (Figure. 4C). These results strongly suggested that induction of HOXC-AS1 was indeed mediated by H3K27ac.

Given that CBP is widely recognized as a crucial regulator of histone acetylation and gene transcription, our next objective was to determine whether CBP played a role in mediating H3K27ac on the HOXC-AS1 promoter and subsequently influencing its upregulation. We confirmed elevated expression levels of CBP in EC cell lines (Figure. 4D). Following this observation, we silenced CBP expression in Eca-109 and EC9706 cells (Figure. 4E). Consequently, there was reduced expression of HOXC-AS1 upon CBP knockdown in EC cells (Figure. 4F). ChIP analysis further supported these findings by demonstrating enrichment of the HOXC- AS1 promoter within CBP precipitates (Figure. 4G), indicating an interaction between CBP and the HOXC‐ AS1 promoter region.

Furthermore, through ChIP assay validation experiments, it was determined that silencing CBP2 resulted in decreased levels of H3K27ac on the HOX-C ASI promoter (Figure. 4H). Collectively, the afore mentioned data provide compelling evidence suggesting that CBP- mediated H327ac in EC cells.

HOXC-AS1 could sponge with miR-195-5p in EC cells

we used lncLocator to predict the subcellular localization of HOXC-AS1 to explore its function. We discovered that HOXC-AS1 was primarily located in the cytoplasm. qRT-PCR and Fish verified the results (Fig. 5A, B). These results suggest that HOXC-AS1 functions as a miRNA sponge. we found that miR-195-5p has a potential binding site targeting HOXC-AS1 using the online database lncRNASNP (Fig. 5C). TCGA database revealed that miR-195-5p was downregulated in EC tissues, which suggests that miR-195-5p might function as a tumor suppressor gene (Fig. 5D). qRT-PCR analysis showed that HOXC-AS1 suppression significantly increased the expression of miR-195-5p and vice versa (Fig. 5E-G). the dual-luciferase reporter plasmids containing wild type (wt) and mutated (mut) putative binding sites of HOXC-AS1 were established to confirm the interaction between HOXC-AS1 and miR-195-5p in EC cells. They were co-transfected into Eca-109 and EC9706 cells with miR-195-5p or control mimics. Forced expression of miR-195-5p repressed the luciferase reporter activity of the HOXC-AS1-wt vector (Fig. 5H). Moreover, HOXC-AS1 and miR-195-5p were highly enriched in Eca-109 and EC9706 cells as suggested by the RIP assay using the Ago2 antibody (Fig. 5I).

HOXC-AS1 regulates EC cells via miR-195-5p

we analyzed the biological processes of the cell by transfecting sh-HOXC-AS1 lentivirus and miR-195-5p inhibitor to confirm that HOXC-AS1 suppresses the malignant behaviors of Eca-109 cells by targeting miR-195-5p. In EC cells, sh-HOXC-AS1 enhanced the expression of miR-195-5p, which was partially reduced by the miR-195-5p inhibitor (Fig. 6A). HOXC-AS1 silencing suppressed the proliferation, migration, and invasion of EC cells. However, these effects were counteracted by the miR-195-5p inhibitor (Fig. 6B-E). These data suggest that the anti-tumor effects of sh-HOXC-AS1 are regulated by miR-195-5p inhibitor.

HOXC-AS1 restores ANLN expression by binding to miR-195-5p

Targetscan was used to predict the binding sequence between ANLN and miR-195-5p to elucidate the target of miR-195-5p in EC (Fig. 7A). ANLN was upregulated in EC tissues in the TCGA database (Fig. 7B). The miR-195-5p mimics inhibited ANLN mRNA and protein levels, and the miR-195-5p inhibitor had opposite effects (Fig. 7C-E). Dual-luciferase reporter assay confirmed that miR-195-5p targets the 3′UTR of ANLN (Fig. 7F). Moreover, miR-195-5p inhibitor partially counteracted the inhibitory effects of HOXC-AS1 knockdown on the expression levels of ANLN, which was confirmed by qRT-PCR and western blot (Fig. 7G, H). These data indicate that ANLN is a target of miR-195-5p, and HOXC-AS1 competitively binds with miR-195-5p to increase the ANLN expression.

ANLN alters the HOXC-AS1 regulation of EC cells

the rescue assays were performed to verify whether ANLN affects EC cell functions regulated by HOXC-AS1. The sh-HOXC-AS1-transfected Eca-109 cells were transfected with ANLN overexpressed vector. suppression of the ANLN mRNA and protein expression by sh-HOXC-AS1 could be upregulated by overexpressing ANLN (Fig. 8A, B). Overexpression of ANLN partially reversed the knockdown of HOXC-AS1 suppressed EC cell functions (Fig. 8C-E). Our results suggest that HOXC-AS1 acts as a ceRNA to exhibit carcinogenesis in EC via the miR-195-5p/ANLN axis.

Recent studies have revealed that lncRNAs play important roles in tumorigenesis. As a cancer-related lncRNA, HOXC-AS1 is upregulated in gastric cancer tissues and functions as a tumor promoter for cell growth and metastasis (Dong et al. 2019) Moreover, Takayama KI et al. found that HOXC-AS1 is highly expressed in castration-resistant prostate cancer tissues. It might be an androgen receptor regulator and a potential biomarker in castration-resistant prostate cancer (Takayama et al. 2020). In this study, we found that HOXC-AS1 is significantly upregulated in EC tissues and cell lines, indicating that it might be an oncogenic lncRNA in EC. Moreover, sh-HOXC-AS1 reduced cell growth, invasion and migration in vitro, and tumor growth and metastasis in vivo.

lncRNA is a molecular sponge that competitively binds with miRNAs (Tan et al. 2015). a study has reported that lncRNA PCAT1 promotes ESCC cell proliferation by sponging miR-326 and serves as a non-invasive biomarker for ESCC (Huang et al. 2019). we found that HOXC-AS1 is mainly located in the cytoplasm. We also found that miR-195-5p contained a binding site targeting HOXC-AS1 with the help of online bioinformatics software. Moreover, the interaction between HOXC-AS1 and miR-195-5p was confirmed using RIP assay and dual-luciferase reporter assay. Many types of miRNAs regulate tumorigenesis and act as biomarkers for cancer diagnosis and potential therapy (Jeon et al. 2020, Mitra et al. 2020). miR-195-5p is abnormally expressed and inhibits tumor progression in a variety of cancers. Shen S et al. revealed that miR-195-5p is downregulated in EC tumor tissues and cell lines. overexpression of miR-195-5p reduces EC cell proliferation, migration, invasion, blocks cell cycle entry, and elevates apoptosis (Shen et al. 2020). Yang R et al. found that miR-195-5p represses the triple-negative breast cancer progression by targeting cyclin E1 (Yang et al. 2019). In our study, we found that miR-195-5p showed lower expression in EC tissues in the TCGA database, and sh-HOXC-AS1 promoted its expression. Moreover, miR-195-5p inhibitor partially rescued the effects of sh-HOXC-AS1 on EC cell proliferation, migration, and invasion.

As oncogenes, lncRNAs indirectly regulate the expression of functional genes by sequestering miRNAs from target mRNAs (Li et al. 2022, Li et al. 2022, Wu et al. 2022). According to our results, miR-195-5p could target ANLN in EC cells. ANLN promotes tumorigenesis and tumor growth in various tumor models, including HBV-related hepatocellular carcinoma, breast cancer, pancreatic cancer, and bladder urothelial carcinoma (Zeng et al. 2017, Lian et al. 2018, Guo et al. 2020, Wang et al. 2020). Lian YF et al. reported that patients with higher expression of ANLN are associated with worse clinical outcomes and a shorter survival time. inhibition of ANLN restrains the growth of hepatocellular carcinoma, decreases colony formation, and lowers sphere number in suspension culture (Lian et al. 2018). Wang D et al. showed that loss of ANLN significantly repressed migration, invasion, and anchorage-independent growth of breast cancer cells in vitro and attenuated primary tumor growth and metastasis of breast cancer in vivo (Wang et al. 2020). These results suggest that ANLN promotes tumor progression. However, the role of ANLN in EC is unknown. In our study, we found that ANLN is upregulated in EC tissues from the TCGA database, and overexpression of ANLN reversed the function of HOXC-AS1 in the proliferation, invasion, and migration of EC cells. Therefore, HOXC-AS1 exerts carcinogenesis in EC by regulating the miR-195-5p/ANLN axis.

we are the first to reveal the role of HOXC-AS1 in EC and provide evidence that it plays an oncogenic role by acting as a miR-195-5p sponge to modulate the expression of ANLN. Therefore, HOXC-AS1 might be a potential target for the diagnosis and treatment of EC.

Authors’ contributions (1) Writing-original draft, methodology and supervision: FK. (2) Data curation and Methodology: QC. (3) Investigation, formal analysis and validation: YL.(4) Formal analysis and visualization: RJ.(5) Methodology and software: LH.(6) Conceptualization, project administration, resources and writing-review & editing: HG.All authors approved the final version of manuscript.

Data availability The data that support the findings of this study are available from the corresponding author, upon reasonable request.

Ethics approval All animal procedures were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals with the approval of the Ethics Committee of the First Affiliated Hospital of Xiamen University (No. 202109899).

Funding This study was funded by the science and technology planning project of XIAMEN medical health system (No. 3502Z20194008).

Conflicts of Interest The authors declare no competing interests.

Informed consent Not applicable

Abraham, J. M. and S. J. Meltzer (2017) Long Noncoding RNAs in the Pathogenesis of Barrett's Esophagus and Esophageal Carcinoma. Gastroenterology 153: 27–34.
Bracken-Clarke, D., et al. (2018) Management of Locally Advanced and Metastatic Esophageal Cancer in the Older Population. Curr Oncol Rep 20: 99.
Bray, F., et al. (2018) Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 68: 394–424.
Dong, Y., et al. (2019) HOXC-AS1-MYC regulatory loop contributes to the growth and metastasis in gastric cancer. J Exp Clin Cancer Res 38: 502.
Esteller, M. (2011) Non-coding RNAs in human disease. Nat Rev Genet 12: 861–874.
Guo, H. H., et al. (2020) High mobility group AT-hook 2 promotes tumorigenicity of pancreatic cancer cells via upregulating ANLN. Exp Cell Res 393: 112088.
Huang, L., et al. (2019) Long noncoding RNA PCAT1, a novel serum-based biomarker, enhances cell growth by sponging miR-326 in oesophageal squamous cell carcinoma. Cell Death Dis 10: 513.
Huarte, M. (2015) The emerging role of lncRNAs in cancer. Nat Med 21: 1253–1261.
Jeon, J., et al. (2020) Temporal Stability and Prognostic Biomarker Potential of the Prostate Cancer Urine miRNA Transcriptome. J Natl Cancer Inst 112: 247–255.
Li, D., et al. (2022) The EMT-induced lncRNA NR2F1-AS1 positively modulates NR2F1 expression and drives gastric cancer via miR-29a-3p/VAMP7 axis. Cell Death Dis 13: 84.
Li, Q., et al. (2022) LINC00520 up-regulates SOX5 to promote cell proliferation and invasion by miR-4516 in human hepatocellular carcinoma. Biol Chem.
Lian, Y. F., et al. (2018) Anillin is required for tumor growth and regulated by miR-15a/miR-16-1 in HBV-related hepatocellular carcinoma. Aging (Albany NY) 10: 1884–1901.
Liang, Y., et al. (2018) LncRNA CASC9 promotes esophageal squamous cell carcinoma metastasis through upregulating LAMC2 expression by interacting with the CREB-binding protein. Cell Death Differ 25: 1980–1995.
Lin, C., et al. (2018) Functional Role of a Novel Long Noncoding RNA TTN-AS1 in Esophageal Squamous Cell Carcinoma Progression and Metastasis. Clin Cancer Res 24: 486–498.
Mitra, R., et al. (2020) Pan-cancer analysis reveals cooperativity of both strands of microRNA that regulate tumorigenesis and patient survival. Nat Commun 11: 968.
Rustgi, A. K. and H. B. El-Serag (2014) Esophageal carcinoma. N Engl J Med 371: 2499–2509.
Shen, S., et al. (2020) Silencing lncRNA AGAP2-AS1 Upregulates miR-195-5p to Repress Migration and Invasion of EC Cells via the Decrease of FOSL1 Expression. Mol Ther Nucleic Acids 20: 331–344.
Su, M., et al. (2018) Long non-coding RNAs in esophageal cancer: molecular mechanisms, functions, and potential applications. J Hematol Oncol 11: 118.
Takayama, K. I., et al. (2020) Identification of long non-coding RNAs in advanced prostate cancer associated with androgen receptor splicing factors. Commun Biol 3: 393.
Talukdar, F. R., et al. (2018) Molecular landscape of esophageal cancer: implications for early detection and personalized therapy. Ann N Y Acad Sci 1434: 342–359.
Tan, C., et al. (2016) Potential biomarkers for esophageal cancer. Springerplus 5: 467.
Tan, J. Y., et al. (2015) Extensive microRNA-mediated crosstalk between lncRNAs and mRNAs in mouse embryonic stem cells. Genome Res 25: 655–666.
Wang, D., et al. (2020) Anillin regulates breast cancer cell migration, growth, and metastasis by non-canonical mechanisms involving control of cell stemness and differentiation. Breast Cancer Res 22: 3.
Wu, W., et al. (2022) Long Noncoding RNA PCAT6 Regulates Cell Proliferation and Migration in Human Esophageal Squamous Cell Carcinoma. J Cancer 13: 681–690.
Xu, Y., et al. (2019) LncRNA PVT1 up-regulation is a poor prognosticator and serves as a therapeutic target in esophageal adenocarcinoma. Mol Cancer 18: 141.
Yang, R., et al. (2019) The circRNA circAGFG1 acts as a sponge of miR-195-5p to promote triple-negative breast cancer progression through regulating CCNE1 expression. Mol Cancer 18: 4.
Zeng, S., et al. (2017) Transcriptome sequencing identifies ANLN as a promising prognostic biomarker in bladder urothelial carcinoma. Sci Rep 7: 3151.

No competing interests reported.

Download PDF

Reviewers invited by journal
18 Sep, 2024
Editor assigned by journal
21 Aug, 2024
Submission checks completed at journal
21 Aug, 2024
First submitted to journal
20 Aug, 2024

You are reading this latest preprint version

Long non-coding RNA HOXC-AS1 promotes the malignancy by sponging miR-195-5p with ANLN in esophageal cancer

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

TCGA data analysis

Cell culture

Lentivirus, oligonucleotide, plasmid, and transfection

Quantitative real-time reverse transcription polymerase chain reaction

2.5 Western blot

Immunohistochemistry staining

MTT assay

5-ethynyl-2′-deoxyuridine assay

Transwell invasion assay

Wound healing assay

Dual-Luciferase reporter assay

RNA immunoprecipitation assay

In vivo model

ChIP assay

RNA fluorescence in situ hybridization (FISH)

Statistical analysis

Results

HOXC-AS1 is upregulated in esophagus cancer tissues and cell lines

Effect of HOXC-AS1 on EC cell proliferation, migration, and invasion

Knockdown of HOXC-AS1 hinders xenograft tumor growth and metastasis in vivo

Increased CBP mediates the high expression of HOXC-AS1 via H3K27 acetylation modification

HOXC-AS1 could sponge with miR-195-5p in EC cells

HOXC-AS1 regulates EC cells via miR-195-5p

HOXC-AS1 restores ANLN expression by binding to miR-195-5p

ANLN alters the HOXC-AS1 regulation of EC cells

Discussion

Declarations

References

Additional Declarations

Status:

Version 1