Exosomes derived from SOX9 overexpressing human umbilical cord mesenchymal stem cells ameliorate osteoarthritis by potentially activating autophagy

doi:10.21203/rs.3.rs-4950954/v1

Download PDF

Article

Exosomes derived from SOX9 overexpressing human umbilical cord mesenchymal stem cells ameliorate osteoarthritis by potentially activating autophagy

https://doi.org/10.21203/rs.3.rs-4950954/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

The exosomes derived from modified mesenchymal stem cells are a promising treatment for osteoarthritis (OA). The aim of this study was to explore the therapeutic effects of SOX9-overexpressing human umbilical cord mesenchymal stem cells (hucMSCs) exosomes on OA and their potential mechanisms. SOX9 was overexpressed in hucMSCs, and the exosomes derived from these modified hucMSCs were isolated (Exos^SOX9). An IL-1β-stimulated OA chondrocytes model and a surgically induced OA rat model were established. These models were subsequently treated with the prepared exosomes. Western blot results indicated that the Exos^SOX9 markedly enhanced the synthesis of cartilage extracellular matrix and inhibited its degradation in vitro. Histological, imaging, immunohistochemical, and chip analysis demonstrated that the Exos^SOX9 markedly alleviated OA progression and decreased serum inflammatory markers in OA rats. Furthermore, the autophagy/Wnt signaling axis served as a potential target pathway for the Exos^SOX9 in both in vivo and in vitro studies. Consequently, the Exos^SOX9 may alleviate OA by simultaneously inhibiting the Wnt pathway and inducing autophagy. The findings indicate that the Exos^SOX9 may represente a promising approach for cell-free therapy in OA.

Biological sciences/Cell biology

Biological sciences/Stem cells

Biological sciences/Zoology

exosomes

SOX9

autophagy

osteoarthritis

MSC

OA is a prevalent chronic condition that has seen its incidence rise annually due to an aging population.¹ OA not only results in joint pain and functional limitations but also significantly diminishes patients' quality of life.² Pathologically, cartilage degeneration and joint inflammation in OA are interconnected.^3,4 Inflammatory environments prompt chondrocytes to release enzymes such as metalloproteinases, which degrade collagen and other extracellular matrix components, accelerating cartilage damage and degeneration.⁵ The inflammatory response is pivotal in the progression of osteoarthritis.⁶ Research indicates that cytokines like tumor necrosis factor-alpha (TNF-α) and interleukin-1 (IL-1) are elevated in OA joints, inducing chondrocytes to generate more inflammatory mediators and proteases, thereby worsening joint damage.^6,7 Thus, controlling the inflammatory response and reducing the production of inflammatory cytokines are crucial for slowing osteoarthritis progression.⁸ Furthermore, oxidative stress and metabolic dysfunction also play roles in OA's development. Oxidative stress can inflict oxidative damage on chondrocytes and activate protease expression such as matrix metalloproteinases (MMPs), leading to extracellular matrix degradation.^9,10 OA treatment primarily aims to alleviate symptoms and improve joint function through pharmacological therapy, physical therapy, and surgical intervention.^11,12 Non-steroidal anti-inflammatory drugs are commonly prescribed to relieve OA pain, though long-term use can cause gastrointestinal and other side effects. Consequently, new treatment strategies targeting inflammatory pathways, antioxidant therapies, and metabolic regulation are being developed, offering potential for more effective OA.^13,14

Mesenchymal stem cells (MSCs) are multipotent stem cells first isolated from bone marrow by Freidenstein et al. in 1976, later found in tissues such as adipose tissue, umbilical cord, and placenta. MSCs possess self-renewal and differentiation capabilities, able to transform into cell types including osteoblasts, chondrocytes, and adipocytes. MSCs can ameliorate various diseases by promoting cell proliferation, providing antioxidant, anti-aging, and anti-inflammatory effects.^15–17 The researchs show that many MSC functions are mediated via exosomes secretion.^17,18 These exosomes, measuring approximately 30-150nm, facilitate intercellular communication and are rich in bioactive lipids, nucleic acids, and proteins, with specific content varying by source.¹⁸ Different cell sources or states yield distinct exosomes with unique functions.^18,19 Exosomes derived from MSCs can enhance chondrocytes proliferation, matrix synthesis, and cartilage repair by modulating inflammatory responses.^20–22 Therefore, engineering MSCs to produce more effective exosomes represents a promising therapeutic approach for OA.^23,24 SOX9, a member of the Sox (SRY-type high-mobility-group Box) gene family, is located on the long arm of human chromosome 17 and remains highly conserved across species such as humans and mice. As a key transcription factor, SOX9 plays an essential role in regulating chondrogenesis during cartilage development.²⁵ During the differentiation of MSCs into chondrocytes, the activation of SOX9 promotes cartilage differentiation.^26,27 SOX9 specifically interacts with the conserved cartilage promoter and enhancer in the COL2A1 gene and also binds to the promoters and enhancers of numerous other cartilage matrix genes, regulating their expression.²⁸ Therefore, it is proposed that exosomes derived from SOX9-overexpressing MSCs could significantly enhance chondrocytes repair.

However, it remains unreported whether exosomes derived from Sox9-modified hucMSCs (Exos^SOX9) are more effective than those from normal hucMSCs (Exos^NC) in treating OA. In this study, we investigated the therapeutic effects of the Exos^SOX9 on OA both in vivo and in vitro, along with their potential mechanisms. The Exos^SOX9 may offer a promising treatment for OA.

2.1 The hucMSCs were successfully isolated and cultured from umbilical cord

Around the 14th day, spindle-shaped cells began to emerge and were cultured for an additional 3 days until the culture dish was filled. These cells retained good morphology even after multiple passages (Fig. 1A). Staining results of the induced differentiated cells demonstrated that the cells can differentiate into osteocytes, adipocytes, and chondrocytes (Fig. 1B). The results showed that there were differences in the expression levels of CD molecules on the cells surface: CD90, CD73, and CD105 had high expression rates, with positive rates all above 95%, but the expression rate of CD35 was low, with a positive rate below 1% (Fig. 1C). These findings confirmed that the cells we isolated were indeed hucMSCs.

Figure 1. Isolation and identification of hucMSCs.

(A) Images of the 0th and 3rd generation hucMSCs (P0 and P3). Scale bar = 200 μm. (B) Alizarin Red S, Oil Red O, and Alcian Blue staining .Scale bar = 200 μm. (C) Flow cytometry results of P3hucMSCs.

2.2 SOX9 promoted Chondrogenic Differentiation of hucMSCs.

To investigate the role of SOX9, it was overexpressed in hucMSCs. Both the control hucMSCs (OE-NC) and the SOX9-overexpressing hucMSCs (OE-SOX9) were induced to form cartilage, which was subsequently compared by immunohistochemistry. Following the introduction of the SOX9 lentivirus into the hucMSCs, green fluorescence was observed in both the nuclei and cytoplasm (Fig. 2A). QPCR results demonstrated that compared to the OE-NC group, the levels of ACAN, COL2A1 and SOX9 were significantly elevated in the OE-SOX9 group (Fig. 2B). Western blot results demonstrated similar changes (Fig. 2C). These observations confirmed that SOX9 was effectively overexpressed in the hucMSCs, thereby enhancing the expression of ACAN and COL2A1. Immunohistochemical analysis revealed that ACAN and COL2A1 expression levels were significantly elevated in the OE-SOX9 group (Fig. 2D, E). These findings suggested that SOX9 promoted the chondrogenic differentiation of hucMSCs.

Figure 2. SOX9 promoted chondrogenic differentiation of hucMSCs.

(A) HucMSCs transfected with lentivirus (72 h), Scale bar = 200 μm. (B) RT-qPCR results of ACAN, COL2A1 and SOX9. (C) Western blotting analysis of ACAN, COL2A1 and SOX9. Original blots are presented in Supplementary Fig. S1. (D) ACAN and (E) COL2A1 immunoassay, Scale bar = 300 μm (top), 50 μm (bottom). *p < 0.05, **p < 0.01, ***p < 0.001

2.3 Identification of the exosomes

The exosomes (Exos^NC or Exos^SOX9) were characterized with western blotting, TEM and NTA. Western blot analysis showed that the exosomes were rich in proteins CD9, CD81, and TSG101, whereas the protein Calnexin was undetectable (Fig. 3A). The TEM and NTA demonstrated that the exosomes had a double-layered membrane structure with a concave disc shape, measuring 30-150 nm in diameter, with an average diameter of approximately 100 nm (Fig. 3B, C). These findings confirm the successful isolation of the exosomes.

Figure 3. Identification of the exosomes

(A) Western blotting analysis of CD9, CD81, Tsg101, Calnexin and GAPDH. Original blots are presented in Supplementary Fig. S2. (B) TEM analysis for the morphology of the exosomes. Scale bar= 600 nm. (C) NTA for measuring the size distribution and concentration of the exosomes.

2.4 The Exos^SOX9 partially reversed IL-1β-induced chondrocytes damage via potentially enhancing autophagy and GSK3β expression in vitro.

Toluidine blue and immunofluorescence staining confirmed the successful extraction of human primary chondrocytes (Fig. 4A-C). The western blot results demonstrated a significant increase in ADAMTS5 and MMP13 levels in the model group compared to the control group. Exosome treatment reversed these changes, with the Exos^SOX9 group showing the most pronounced effect (Fig. 4D). Compared to the control group, the levels of COL2A1 and ACAN in the model group were significantly reduced; however, exosomes treatment reversed these decreases, with the Exos^SOX9group exhibiting the greatest efficacy (Fig. 4E). These findings suggest that the Exos^SOX9is superior to the Exos^NC in inhibiting catabolism and promoting anabolism in OA chondrocytes. Additionally, autophagy proteins (Beclin-1and LC3B) and GSK3β levels were lower in the model group compared to the control group, but exosomes treatment reversed these reductions, with the Exos^SOX9group achieving the best improvement. In contrast, the expression trend of p62 was opposite (Fig. 4E). These results indicated that the therapeutic effects of the Exos^SOX9 may be mediated through the activation of autophagy and enhancement of GSK3β.

Figure 4. Identification of the human chondrocytes and the reversal of IL-1β-induced chondrocytes injury by exosomes. (A) First-generation primary human chondrocytes. Scale bar= 200 um. (B) Toluene blue staining of human chondrocytes. Scale bar= 200 um. (C) COL2A1 immunoassay of chondrocytes. Scale bar= 200 um. (D) Western blotting results of ADAMTS5, MMP13. (E) Western blotting results of ACAN, COL2A1, GSK3β, Beclin-1, LC3B, p62. *p < 0.05, **p < 0.01, ***p < 0.001. Original blots are presented in Supplementary Fig. S3 A-B.

2.5 The Exos^SOX9partially repaired the damaged articular cartilage in OA

Rats.

2.5.1 The Exos^SOX9promoted cartilage repair in OA rats

Safranin O/fast green staining revealed that the OA group, unlike the sham group, exhibited significant joint cracks, cartilage erosion, and a notable reduction in chondrocyte numbers. Notably, exosome treatment substantially alleviated this damage, with the Exos^SOX9 group showing the most remarkable improvement (Fig. 5A). Similar outcomes were observed with H&E and alcian blue staining (Fig. 5B, C). These findings were quantitatively analyzed with OARSI grades and Mankin's scores (Fig. 5D, E). Both μCT and CP results indicated significant osteophyte formation and joint space narrowing in the OA group compared to the sham group. Exosome treatment reversed these changes, with the Exos^SOX9group demonstrating the greatest efficacy (Fig. 5F, G). Furthermore, the chip detection results showed a marked increase in serum pro-inflammatory factors and a significant decrease in anti-inflammatory factors in the OA group, both of which were reversed by exosomes injection (Fig. 6).These findings suggest that the Exos^SOX9partially repaired OA damage and inhibited inflammatory responses, thereby delaying OA progression.

Figure 5. The exosomes facilitated cartilage repair in OA rats.

(A) Safranin O/fast green and (B) H&E staining of rat knee joints. Scale bar = 250μm (top), 50 μm (bottom). (C) Alcian Blue staining, scale bar = 200μm (top), 50 μm (bottom). (D) OARSI grades. (E) Mankin’s scores. (F) 3D reconstruction and 2D images of joints from μCT scans. (G) The knee joint were scanned with X-rays (CP). *p < 0.05, **p < 0.01, ***p < 0.001.

Figure 6. Exosome therapy reduced pro-inflammatory factors and increased anti-inflammatory factors. The chip detected the levels of various inflammatory markers. Each group consisted of serum samples from 4 rats.

2.5.2 The Exos^SOX9may prevent extracellular matrix degradation and enhance its synthesis by activating autophagy and inhibiting β-catenin in OA rats.

To further explore the possible mechanism of the exosomes in treating OA rats, immunohistochemical analyses were performed on the joints. The expression of ACAN and COL2A1was significantly lower in the OA group compared to the Sham group, while MMP13 expression was markedly higher. Treatment with exosomes reversed these changes, with the Exos^SOX9group showing the most pronounced effect (Fig. 7A-C). These findings indicated that the Exos^SOX9enhanced cartilage extracellular matrix synthesis and inhibited its degradation. Furthermore, the OA group exhibited a significant increase in β-catenin expression compared to the Sham group. Exosomes treatment counteracted this alteration, with the Exos^SOX9group again demonstrating superior results (Fig. 7D). Additionally, the OA group showed a notable decrease in Beclin-1 expression and an increase in p62 expression. Exosomes treatment reversed these trends, with the Exos^SOX9group displaying the most effective results (Fig. 7E, F). These observations suggested that the therapeutic effects of the Exos^SOX9may involve inhibiting the Wnt/β-catenin pathway, thereby activating autophagy.

Figure 7. The Exos^SOX9may prevent extracellular matrix degradation and enhance its synthesis by activating autophagy and inhibiting β-catenin in OA rats.

The immunohistochemical analysis of (A) ACAN, (B) COL2A1 and (C) MMP13 in articular cartilage (n=6 rats). Scale bar = 250μm (top), 50μm (bottom). The immunohistochemical analysis of (D) β-catenin, (E) P62 and (F) Beclin-1 in articular cartilage (n=6 rats). Scale bar = 250μm (top), 50 μm (bottom). *p < 0.05, **p < 0.01, ***p < 0.001.

The aim of this study was to investigate the therapeutic effects of the Exos^SOX9 on OA and their underlying mechanisms. Our results firstly demonstrated that in both in vivo and in vitro OA models, the Exos^SOX9 significantly outperformed the Exos^NC in alleviating OA progression. Additionally, we discovered that the Exos^SOX9 markedly reversed OA-induced reductions in autophagy via the GSK3β/β-catenin signal axis. Thus, the therapeutic effect of the Exos^SOX9 on OA may be attributed to the dual action of inhibiting the Wnt/β-catenin pathway and inducing autophagy. Therefore, our results suggested that the Exos^SOX9 may be a new potential therapy for the prevention and treatment of OA.

OA is marked by elevated levels of pro-inflammatory factors and an intensified inflammatory response, resulting in the accelerated degradation of the chondrocyte ECM.⁵ Enzymes such as ADAMTS5 and MMP13 are vital for maintaining cartilage homeostasis, and their overactivation directly contributes to the rapid progression of OA.^29,30 Exosomes derived from MSCs are considered highly effective and promising in OA treatment. MSCs can be sourced from bone marrow, synovial tissue, and umbilical cord, with the latter offering benefits like easy availability, low immunogenicity, and robust reproductive capability.^31–33 Consequently, exosomes frome umbilical cord MSCs have emerged as a superior option for OA therapy. Prior researchs indicated that exosomes from umbilical cord MSCs or modified versions can reduce inflammatory responses and mitigate OA progression.^30,31 However, the therapeutic potential of exosomes derived from SOX9-overexpressing hucMSCs in OA has not been explored. In this study, we discovered that exosomes from SOX9-overexpressing hucMSCs exhibited significantly enhanced therapeutic effects on OA compared to those from unmodified hucMSCs. In both IL-1β-induced in vitro chondrocyte OA models and in vivo surgically induced rat OA models, these Exos^SOX9 inhibited the expression of matrix enzymes ADAMTS5 and MMP13 and increased the levels of matrix proteins ACAN and COL2A1, thus reversing OA damage and slowing its progression. Furthermore, the injection of the Exos^SOX9 in OA rats significantly reduced osteophyte formation and reversed joint space narrowing. This treatment also notably diminished pro-inflammatory factors and increased anti-inflammatory factors, demonstrating the inhibition of the inflammatory response in OA rats. OA-affected articular cartilage exhibits wear, cracks, decreased chondrocytes, fibroblast replacement of chondrocytes, and osteophyte formation, leading to the degeneration of cartilage structure and function. MSC-derived exosomes could promote chondrocyte proliferation, migration, crack reduction, and decreased osteophyte formation, thereby restoring the structure and function of joint cartilages.^34,35

Autophagy is a natural mechanism that degrades unnecessary intracellular components under conditions of nutrient deficiency, metabolic stress, and oxygen deprivation, thereby preventing energy loss and protecting cells.³⁶ Damaged cytoplasmic macromolecules, cell membranes, and organelles are transported to lysosomes via the autophagy pathway for degradation, and the resulting products are reused by cells to maintain homeostasis in cells, tissues, and even entire organs.³⁷ Therefore, the importance of autophagy in regulating chondrocytes homeostasis should not be underestimated.^38–40 Researchs have shown that, compared to healthy cartilages, human OA cartilages exhibited cartilage degeneration and autophagy deffects.^41,42 Activation of mitochondrial autophagy could delay chondrocyte aging, reduce chondrocyte apoptosis, maintain chondrocyte vitality, and consequently slow OA progression.^41–43 Additionally, exosomes derived from MSCs play a role in OA through the regulation of autophagy. Previous studys have reported that these exosomes promoted autophagy in chondrocytes, enhanced their catabolic metabolism, inhibited their synthetic metabolism, and thus protected OA cartilage.^22,44 However, the precise mechanism by which these exosomes activate autophagy in OA remains unclear. Our study showed that the Exos^SOX9 intervention significantly reversed autophagy defects in OA chondrocytes in vitro and in OA rats, with effects superior to those of control group exosomes. We found a positive correlation between autophagy activation and GSK3β expression. GSK3β is a negative regulator of the Wnt/β-catenin signaling pathway; it promotes β-catenin degradation by phosphorylation, reducing its nuclear translocation and inhibiting the pathway. In vivo experiments also demonstrated a negative correlation between autophagy activation and β-catenin expression. Thus, the reversal of OA structure by the Exos^SOX9 might involve the inhibition of the Wnt/β-catenin signaling pathway to activate autophagy. To our knowledge, this is the first study on the mechanism of the Exos^SOX9 in treating OA. However, further investigation is essential to determine which components the Exos^SOX9 within enhance their therapeutic efficacy compared to control group exosomes. This is the focus of our upcoming research.

In conclusion, our study demonstrated that hucMSCs- Exos^SOX9 could activate autophagy, promote extracellular matrix synthesis, inhibit catabolism, reduce inflammatory responses, prevent osteophyte formation, and reverse joint stenosis. Consequently, they effectively alleviated the progression of OA. This effect may be mediated by inhibiting the Wnt/β-catenin pathway through the GSK3β/β-catenin axis. This is the first study exploring the therapeutic effects of hucMSCs- Exos^SOX9 on OA, providing a novel approach for treating OA with hucMSC-derived exosomes.

Isolation and Culture of hucMSCs.

Umbilical cord samples were collected from healthy mothers in the obstetrics department of Suining Central Hospital after they provided informed consent. This study was conducted following the guidelines and approved by the institutional review board of the Ethics Committee at Suining Central Hospital. All procedures complied with the Declaration of Helsinki and the committee's regulations. The obtained umbilical cord tissue must be processed within 4 hours to maintain cellular activity. After the blood vessels were removed, the tissue was cut into small pieces. The tissue fragments were placed in a culture-flask with 5% CO2 at 37°C. The culture medium used was α-MEM, supplemented with 10% serum substitute (PALL Ultroser G 15950-017, US) and 1% penicillin-streptomycin antibiotic (15140148, Gibco, US). Once the cells were fully grown, the tissue fragments were removed. The cells were passaged and the medium was changed every 2 days. The hucMSCs utilized in this experiment were derived from the 3rd to 6th generations (P3-P6 hucMSCs).

Identification of hucMSCs

To identify specific surface markers of stem cells, P3hucMSCs were analyzed with flow cytometry (BD catalog number 562245). To verify their differentiation potential, P3 hucMSCs were cultured in osteogenic (PD017, Pricella, China), adipogenic (PD019, Pricella, China), and chondrogenic (HUXUC-90041, Cyagen, China) induction media, respectively. The cultures were then subjected to specific staining (Alizarin Red S, Oil Red O or Alcian Blue) for validation.

Transfection of Lentiviral Particles

All plasmids, including SOX9 gene plasmids, empty plasmids, and packaging plasmids, were synthesized by Shanghai GeneChem Company and packaged into lentiviruses in 293T cells(LPK001, GeneChem, China). The lentiviruses were then transfected into P3hucMSCs, and the cells were screened with puromycin after the appearance of green fluorescence. Further, the transfection effect was validated by detecting the mRNA and the protein levels of SOX9.

QPCR

Total RNA was isolated using an RNA extraction kit (ER101-01, Transgen, China), followed by cDNA synthesis with a reverse transcription kit (RT kit, FSQ-301, TOYOBO). Real-time fluorescence quantitative PCR was then performed using a PCR kit (QPK-201, TOYOBO). The relative mRNA expression levels of each gene were determined using the 2^−ΔΔCT method and were displayed in a bar chart. All primer sequences can be found in Table 1 of the supplementary materials.

Table 1

Primer sequences used in this study
Gene	Forward primer( 5′-3′)	Reverse primer( 5′-3′)
SOX9	ATGAAGATGACCGACGAGCA	CAGTCGTAGCCTTTGAGCAC
ACAN	TGAGCGGCAGCACTTTGAC	TGAGTACAGGAGGCTTGAGG
COL2A1	AGAACTGGTGGAGCAGCAAGA	AGCAGGCGTAGGAAGGTCAT
b-actin	AGCGAGCATCCCCCAAAGTT	GGGCACGAAGGCTCATCATT

Western Blot Analysis

Proteins were extracted from cells or exosomes using RIPA lysis buffer (P0013B, Beyotime, China), followed by Western Blot analysis. The results can be semi-quantitatively analyzed with ImageJ software and depicted in bar charts. The antibodies used in this experiment are as follows: COL2A1 (1:1000; ER1906-49), ACAN (1:500; ET1704-57), SOX9 (1:10000; ET1611-56), MMP13(1:2000; ET1702-14), P62(1:5,000; HA721171), ADAMTS5(1:2000; HA722011), Beclin-1 (1:500; HA721216), LC3B (1:1000; ET1701-65), β-catenin (1:1000; ET1601-5), GSK3β (1:1000; ET1607-71), CD81 (1 : 500; ET1611-87), CD9 (1 : 2000; HA721533), TSG101 (1 :2000; ET1701-59), Calnexin (1:2000; ET1611-86) and GAPDH (1:5000; ER1906-49). These antibodies were from the Chinese company Huabio.

Isolation and identifcation of the exosomes

Serum-free medium was used for culturing stem cells, allowing the collection of cell supernatants for exosome extraction. To remove cells, the supernatant was centrifuged at 300g for 15 minutes at 4°C, followed by a second centrifugation at 3000g for 15 minutes at 4°C to eliminate cell debris. The resulting supernatant was filtered through a 0.22 µm filter and centrifuged at 100,000g for 150 minutes at 4°C. The supernatant was discarded, and the pellet was resuspended in PBS to obtain the exosomes. These exosomes were then packaged and stored at -80°C. To identify the exosomes, we performed western blot analysis to verify surface marker proteins and used transmission electron microscopy (TEM) and nanoparticle tracking analysis (NTA) to analyze their morphology, size, and concentration.

Isolation of human chondrocytes and Treatment of OA chondrocytes in vitro.

Primary chondrocytes were isolated from cartilage specimens obtained from patients undergoing joint replacement surgery at Suining Central Hospital, who had provided informed consent. This study was conducted following the guidelines and approved by the institutional review board of the Ethics Committee at Suining Central Hospital. All procedures complied with the Declaration of Helsinki and the committee's regulations. The cartilage was washed and digested with 0.25% trypsin (25200056, Thermo Scientific, US) for 20 minutes. After a 5-minute centrifugation at 800g, the supernatant was discarded. The tissue block was then cut into pieces and digested with collagenase II (C8150-100, Solarbio, China) at 37°C until it was completely dissolved. During digestion, the supernatant was filtered through a 100µm filter every 4 hours. After the filtrate was centrifuged at 800g for 5 minutes, the supernatant was returned to the tissue block, and the cell pellet was resuspended in 2 ml of medium. The suspension was cultured in DMEM containing 10% fetal bovine serum (164210-500, Pricella, China) at 37°C with 5% CO2. The medium was replaced every 5 days and, after cells passage, every 3 days. The chondrocytes used in this experiment were second-generation. Toluene blue staining (G3660, Solarbio, China) and COL2A1 immunofluorescence confirmed their identity.

To establish an OA chondrocytes model in vitro, chondrocytes were treated with IL-1β (10 ng/mL) (CG93, Novoprotein, China) for 24 hours. To evaluate the therapeutic effects of exosomes, IL-1-induced OA chondrocytes were treated with 200 µg/mL of exosomes (Exos^NC or Exos^SOX9) for 48 hours, followed by western blotting analysis.

Establishment of Rats OA model and Treatment

Our study received approval from the Animal Experiment Welfare and Ethics Review Committee of Suining Central Hospital [IRB No. KYLLKS20230117]. The research adhered to the ARRIVE guidelines and the regulations of the Animal Center of North Sichuan Medical College. Thirty-two 8-week-old male Sprague-Dawley rats (weighing 200-250g) were procured from the Animal Center of North Sichuan Medical College. Twenty-four rats were randomly selected for the induction of the osteoarthritis (OA) model by surgically removing the medial meniscus and shearing the medial collateral ligament of the knee joint. The remaining rats underwent sham surgery as controls. Postoperatively, for 6–8 weeks, all rats were made to run for 30 minutes daily to ensure the establishment of the OA model. Beginning in the 8th week post-surgery, injection therapy was administered twice a week for three weeks. The rats were divided into four groups based on the injection materials: Sham (sham surgery + PBS), OA (OA surgery + PBS), Exos^NC (OA surgery + Exos^NC), and Exos^SOX9 (OA surgery + Exos^SOX9). Each rat received an injection of 100 µL, with exosomes concentrations (Exos^NC or Exos^SOX9) maintained at 3.5µg/µL. At week 12, all rats were euthanized under excessive anesthesia through an intraperitoneal injection of 0.1% pentobarbital.

Histological analyses

The harvested knee joints were fixed in 4% paraformaldehyde for 24 hours. They were then soaked in a decalcifying solution (Servicebio Biological Technology, Wuhan, China) for 25 days, with the solution being refreshed every 3 days. Afterwards, the knee joint underwent safranin O/fast green staining, hematoxylin/eosin (H&E) staining, and alcian blue staining analyses (Servicebio Biological Technology, Wuhan, China). Finally, quantitative analysis was conducted using OARSI grades and Mankin's scores.

Immunohistochemical analyses

Immunohistochemical analysis (PV-6000, ZSGB-Bio, China) was performed on the obtained knee joints. The antibodies used are as follows: COL2A1 (1:200, ER1906-49), ACAN (1:100, ET1704-57), MMP13 (1:100, ET1702-14), β-catenin (1:500; ET1601-5), P62 (1:1000, HA721171), and Beclin-1 (1:200, HA721216). These antibodies were from the Chinese company Huabio. The results were semi-quantitatively analyzed with ImageJ software and displayed in various color bar charts.

Imaging and Chip analyses

The knee joints of the rats were scanned using micro-CT to obtain 2D and 3D images, following the method previously described.²⁹ Concurrently, X-ray scans were performed to capture images of the knee joints for each group (CP). Blood samples from the rats were collected and centrifuged to isolate the supernatant. Subsequently, the levels of various inflammatory factors were measured using the Luminex liquid suspension chip (12005641, Bio-Plex Pro Rat Cytokine Grp I Panel 23-plex). The results are displayed in a series of color bar charts.

Statistical analysis

The data from this experiment were presented as mean ± standard deviation, and generally illustrated using bar charts. T-tests were used for comparisons between two datasets, while one-way ANOVA was applied for comparisons involving more than two groups. A p value of less than 0.05 was considered statistically significant.

Ethical statement

This study was performed in line with the guidelines and after the approval of the institutional review board of Hospital's Ethics Committee (IRB No. KYLLKS20230117). Informed consent was confirmed by the IRB.

Competing interests

The authors declare no competing interests.

Author Contribution

S Z. Q.: collection and/or assembly of data, data analysis and interpretation, and manuscript writing. A J. Z., H B. L., F. W., L H. L., P. X. and L. D.: collection and/or assembly of data, data analysis, and interpretation. F. L. and M C. Z.: Conception and design, financial support, manuscript writing. All authors have critically reviewed and approved the final manuscript for publication.

Acknowledgement

The authors would like to thank Drs. Xiao Fang Liu and Quan Jiang He for all of their hard work and significant contributions toward the study.

Data Availability

All data are provided within the manuscript or supplementary information files.

Lammi, M. J. & Qu, C. Regulation of Oxygen Tension as a Strategy to Control Chondrocytic Phenotype for Cartilage Tissue Engineering and Regeneration. Bioeng. (Basel). 11. https://doi:10.3390/bioengineering11030211 (2024).
Motta, F., Barone, E., Sica, A. & Selmi, C. Inflammaging and Osteoarthritis. Clin. Rev. Allergy Immunol. 64, 222–238. 10.1007/s12016-022-08941-1 (2023).
Mao, H. et al. Quercetin-3-O-β-D-glucuronide attenuates osteoarthritis by inhibiting cartilage extracellular matrix degradation and inflammation. J. Orthop. Translat. 45, 236–246. https://doi:10.1016/j.jot.2024.01.007 (2024).
Li, Y. et al. The Protective Effect of Selenium Nanoparticles in Osteoarthritis: In vitro and in vivo Studies. Drug Des. Devel Ther. 17, 1515–1529. https://doi:10.2147/dddt.S407122 (2023).
De Roover, A., Escribano-Núñez, A., Monteagudo, S. & Lories, R. Fundamentals of osteoarthritis: Inflammatory mediators in osteoarthritis. Osteoarthr. Cartil. 31, 1303–1311. https://doi:10.1016/j.joca.2023.06.005 (2023).
Meng, H. et al. YAP activation inhibits inflammatory signalling and cartilage breakdown associated with reduced primary cilia expression. Osteoarthr. Cartil. 31, 600–612. https://doi:10.1016/j.joca.2022.11.001 (2023).
Liu, L. et al. The physiological metabolite α-ketoglutarate ameliorates osteoarthritis by regulating mitophagy and oxidative stress. Redox Biol. 62, 102663. https://doi:10.1016/j.redox.2023.102663 (2023).
Yao, Q. et al. Osteoarthritis: pathogenic signaling pathways and therapeutic targets. Signal. Transduct. Target. Ther. 8, 56. https:/ (2023).
Cao, H. et al. Bio-nanoparticles loaded with synovial-derived exosomes ameliorate osteoarthritis progression by modifying the oxidative microenvironment. J. Nanobiotechnol. 22, 271. https://doi:10.1186/s12951-024-02538-w (2024).
Kumar, P. et al. Supplementing Glycine and N-Acetylcysteine (GlyNAC) in Older Adults Improves Glutathione Deficiency, Oxidative Stress, Mitochondrial Dysfunction, Inflammation, Physical Function, and Aging Hallmarks: A Randomized Clinical Trial. J. Gerontol. Biol. Sci. Med. Sci. 78, 75–89. https://doi:10.1093/gerona/glac135 (2023).
Li, G. et al. An injectable liposome-anchored teriparatide incorporated gallic acid-grafted gelatin hydrogel for osteoarthritis treatment. Nat. Commun. 14, 3159. https://doi:10.1038/s41467-023-38597-0 (2023).
Liu, C. et al. A multifunctional nanogel encapsulating layered double hydroxide for enhanced osteoarthritis treatment via protection of chondrocytes and ECM. Mater. Today Bio. 26, 101034. https://doi:10.1016/j.mtbio.2024.101034 (2024).
Han, G., Zhang, Y. & Li, H. The Combination Treatment of Curcumin and Probucol Protects Chondrocytes from TNF-α Induced Inflammation by Enhancing Autophagy and Reducing Apoptosis via the PI3K-Akt-mTOR Pathway. Oxid Med Cell Longev 5558066, (2021). https://doi:10.1155/2021/5558066 (2021).
Qu, Q. et al. miR-126-3p containing exosomes derived from human umbilical cord mesenchymal stem cells promote angiogenesis and attenuate ovarian granulosa cell apoptosis in a preclinical rat model of premature ovarian failure. Stem Cell. Res. Ther. 13, 352. https://doi:10.1186/s13287-022-03056-y (2022).
Zhao, R. et al. Inhalation of MSC-EVs is a noninvasive strategy for ameliorating acute lung injury. J. Control Release. 345, 214–230. https://doi:10.1016/j.jconrel.2022.03.025 (2022).
Li, C. et al. Mesenchymal stem cells-derived extracellular vesicles ameliorate lupus nephritis by regulating T and B cell responses. Stem Cell. Res. Ther. 15, 216. https://doi:10.1186/s13287-024-03834-w (2024).
Deng, D. et al. Biotin-Avidin System-Based Delivery Enhances the Therapeutic Performance of MSC-Derived Exosomes. ACS Nano. 17, 8530–8550. https://doi:10.1021/acsnano.3c00839 (2023).
Kalluri, R. & LeBleu, V. S. The biology, function, and biomedical applications of exosomes. Science. 367 https://doi:10.1126/science.aau6977 (2020).
Liang, Y., Duan, L., Lu, J. & Xia, J. Engineering exosomes for targeted drug delivery. Theranostics. 11, 3183–3195. https://doi:10.7150/thno.52570 (2021).
Pang, L. et al. Treatment with Mesenchymal Stem Cell-Derived Nanovesicle-Containing Gelatin Methacryloyl Hydrogels Alleviates Osteoarthritis by Modulating Chondrogenesis and Macrophage Polarization. Adv. Healthc. Mater. 12, e2300315. https://doi:10.1002/adhm.202300315 (2023).
Yin, Z. et al. Injectable hyperbranched PEG crosslinked hyaluronan hydrogel microparticles containing mir-99a-3p modified subcutaneous ADSCs-derived exosomes was beneficial for long-term treatment of osteoarthritis. Mater. Today Bio. 23, 100813. https://doi:10.1016/j.mtbio.2023.100813 (2023).
Lou, C. et al. MiR-146b-5p enriched bioinspired exosomes derived from fucoidan-directed induction mesenchymal stem cells protect chondrocytes in osteoarthritis by targeting TRAF6. J. Nanobiotechnol. 21, 486. https://doi:10.1186/s12951-023-02264-9 (2023).
Wang, Z. et al. Exosomes derived from miR-155-5p-overexpressing synovial mesenchymal stem cells prevent osteoarthritis via enhancing proliferation and migration, attenuating apoptosis, and modulating extracellular matrix secretion in chondrocytes. Cell. Biol. Toxicol. 37, 85–96. https://doi:10.1007/s10565-020-09559-9 (2021).
Liu, Y. et al. Exosomes Derived From Human Urine-Derived Stem Cells Overexpressing miR-140-5p Alleviate Knee Osteoarthritis Through Downregulation of VEGFA in a Rat Model. Am. J. Sports Med. 50, 1088–1105. https://doi:10.1177/03635465221073991 (2022).
Ichiyama-Kobayashi, S. et al. Chromatin profiling identifies chondrocyte-specific Sox9 enhancers important for skeletal development. JCI Insight. 9 https://doi:10.1172/jci.insight.175486 (2024).
Song, H. & Park, K. H. Regulation and function of SOX9 during cartilage development and regeneration. Semin Cancer Biol. 67, 12–23. https://doi:10.1016/j.semcancer.2020.04.008 (2020).
Kim, P. et al. Mast4 determines the cell fate of MSCs for bone and cartilage development. Nat. Commun. 13, 3960. https:/ (2022).
Harley, V. R., Clarkson, M. J. & Argentaro, A. The molecular action and regulation of the testis-determining factors, SRY (sex-determining region on the Y chromosome) and SOX9 [SRY-related high-mobility group (HMG) box 9]. Endocr. Rev. 24, 466–487. https://doi:10.1210/er.2002-0025 (2003).
Feng, T. et al. Inhibition of miR-199b-5p reduces pathological alterations in osteoarthritis by potentially targeting Fzd6 and Gcnt2. Elife 12, (2024). https://doi:10.7554/eLife.92645
Yang, H. et al. Effects of human umbilical cord mesenchymal stem cell-derived exosomes in the rat osteoarthritis models. Stem Cells Transl Med. https://doi:10.1093/stcltm/szae031 (2024).
Cao, H. et al. Cell-Free Osteoarthritis Treatment with Sustained-Release of Chondrocyte-Targeting Exosomes from Umbilical Cord-Derived Mesenchymal Stem Cells to Rejuvenate Aging Chondrocytes. ACS Nano. 17, 13358–13376. https://doi:10.1021/acsnano.3c01612 (2023).
Li, F. et al. Adipose mesenchymal stem cells-derived exosomes alleviate osteoarthritis by transporting microRNA – 376c-3p and targeting the WNT-beta-catenin signaling axis. Apoptosis. 28, 362–378. https://doi:10.1007/s10495-022-01787-0 (2023).
Yu, H., Huang, Y. & Yang, L. Research progress in the use of mesenchymal stem cells and their derived exosomes in the treatment of osteoarthritis. Ageing Res. Rev. 80, 101684. https://doi:10.1016/j.arr.2022.101684 (2022).
Liu, Q., Wu, J., Wang, H., Jia, Z. & Li, G. Human Infrapatellar Fat Pad Mesenchymal Stem Cell-derived Extracellular Vesicles Purified by Anion Exchange Chromatography Suppress Osteoarthritis Progression in a Mouse Model. Clin. Orthop. Relat. Res. 482, 1246–1262. https://doi:10.1097/corr.0000000000003067 (2024).
Shao, L. T., Luo, L., Qiu, J. H. & Deng, D. Y. B. PTH (1–34) enhances the therapeutic effect of bone marrow mesenchymal stem cell-derived exosomes by inhibiting proinflammatory cytokines expression on OA chondrocyte repair in vitro. Arthritis Res. Ther. 24, 96. https://doi:10.1186/s13075-022-02778-x (2022).
Mizushima, N. & Komatsu, M. Autophagy: renovation of cells and tissues. Cell. 147, 728–741. https://doi:10.1016/j.cell.2011.10.026 (2011).
Levine, B. & Kroemer, G. Biological Functions of Autophagy Genes: A Disease Perspective. Cell. 176, 11–42. https:// (2019).
Chen, X. et al. METTL3-mediated m(6)A modification of ATG7 regulates autophagy-GATA4 axis to promote cellular senescence and osteoarthritis progression. Ann. Rheum. Dis. 81, 87–99. https://doi:10.1136/annrheumdis-2021-221091 (2022).
Wang, J. et al. The role of autophagy in bone metabolism and clinical significance. Autophagy. 19, 2409–2427. https://doi:10.1080/15548627.2023.2186112 (2023).
Zhao, C. et al. CircFOXO3 protects against osteoarthritis by targeting its parental gene FOXO3 and activating PI3K/AKT-mediated autophagy. Cell. Death Dis. 13, 932. https://doi:10.1038/s41419-022-05390-8 (2022).
Zhou, X. et al. Down-regulated ciRS-7/up-regulated miR-7 axis aggravated cartilage degradation and autophagy defection by PI3K/AKT/mTOR activation mediated by IL-17A in osteoarthritis. Aging (Albany NY). 12, 20163–20183. https://doi:10.18632/aging.103731 (2020).
Liao, S. et al. HECTD1-Mediated Ubiquitination and Degradation of Rubicon Regulates Autophagy and Osteoarthritis Pathogenesis. Arthritis Rheumatol. 75, 387–400. https://doi:10.1002/art.42369 (2023).
Kuwahara, M. et al. C10orf10/DEPP activates mitochondrial autophagy and maintains chondrocyte viability in the pathogenesis of osteoarthritis. Faseb j. 36, e22145. https://doi:10.1096/fj.202100896R (2022).
Zhao, S. et al. Engineering exosomes derived from subcutaneous fat MSCs specially promote cartilage repair as miR-199a-3p delivery vehicles in Osteoarthritis. J. Nanobiotechnol. 21, 341. https://doi:10.1186/s12951-023-02086-9 (2023).

No competing interests reported.

Download PDF

Reviewers agreed at journal
14 Oct, 2024
Reviewers invited by journal
09 Sep, 2024
Editor assigned by journal
09 Sep, 2024
Editor invited by journal
03 Sep, 2024
Submission checks completed at journal
03 Sep, 2024
First submitted to journal
21 Aug, 2024

You are reading this latest preprint version

Exosomes derived from SOX9 overexpressing human umbilical cord mesenchymal stem cells ameliorate osteoarthritis by potentially activating autophagy

Status:

Version 1

Abstract

Figures

1 Introduction

2 Results

3 Discussion

4 Conclusion

5 Materials and Methods

Declarations

Ethical statement

Competing interests

Author Contribution

Acknowledgement

Data Availability

References

Additional Declarations

Supplementary Files

Status:

Version 1