Prevalence, Molecular Characterization, Pathogenicity and Antimicrobial Susceptibility Pattern of Clostridioides Difficile From Clinical Samples in South Eastern Nigeria.

doi:10.21203/rs.3.rs-4955956/v1

Download PDF

Research Article

Prevalence, Molecular Characterization, Pathogenicity and Antimicrobial Susceptibility Pattern of Clostridioides Difficile From Clinical Samples in South Eastern Nigeria.

https://doi.org/10.21203/rs.3.rs-4955956/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

The prevalence, molecular characterization, pathogenicity and antibioticsensitivity pattern of Clostridioides difficile from clinical samples in South-Eastern Nigeria wereevaluated in this study. Stool samples (450) were collected from patientsinsome selected public and private-owned clinics in the five South-Eastern states. Standard bacteriological methods were employed for enumeration of total anaerobes. Culture of Clostridioides difficile isolates were performed on Clostridium difficile differential agar (supplemented with C. difficile selective supplement). Biochemical tests like catalase, oxidase and reverse CAMP test were conducted before extraction of genomic bacterial DNA for suspected C. difficile isolates. Purification and amplification of bacterial DNA was carried out on 2% agarose gel. Amplified bacteria DNA was sequenced and blasted on the National Centre for Biotechnology Information (NCBI) website. Antibiotics susceptibility was carried out for C. difficile isolates using the Kirby-Bauer disc diffusion technique. PCR technique was employed for the detection of virulence (tcdA, tcdB, cdtAandcdtB) and resistance genes (tetS, tetAandermB) in C. difficile isolates. Anaerobe counts for stool samples obtained showed that samples had a mean count of 5.63±0.09 log₁₀CFU/g (Anambra state) while counts of 5.61±0.11 log₁₀CFU/g and 5.65±0.07 log₁₀CFU/g were obtained from Ebonyi and Enugu States. The antibacterial sensitivity revealed that the isolates were sensitive to gentamicin, meropenem and amoxicillin-clavulanic acid. The isolates were resistant to tetracyclines and erythromycin, and the multiple antibiotic resistance index of theisolates showed that the multi-drug resistant isolates had a MAR index of 0.44. All (14 C. difficile isolates) (100%) of C. difficile isolates were found to possess tcdBgenes, and 69.56% expressed tcdAgenes. One (4.34%) of the C. difficile isolatespossessed cdtAand cdtBgenes for binary toxin production.

prevalence

molecular characterization

pathogenicity

Antibiogram

Clostridioides difficile

South-East

Standard healthcare facilities are essential for survival in a world dominated by superbugs,which have also been implicated in infections and the re-occurrence of infection even after the treatment regimen. Pathogenic organisms have recorded unparalleled success in their ability to cause diseases as well as induce therapeutic failure through drug resistance (Adegokeet al., 2016).Clostridioides difficile has been reported as the leading cause of healthcare-associated diarrhea (Markantonis et al., 2024). Antibiotic exposure, which reduces the population of non-pathogenic anaerobes that normally inhabit the gut, has been pointed out asthe most important risk factor for Clostridioides difficile infection (CDI) (Markantonis et al., 2024).Thus, CDI occurs when there is a shift in the microbial flora of the colon, allowingtoxin-producing strains of the Gram-positive, spore-forming, anaerobic bacillus toproliferate (Smits et al., 2016; Markantonis et al., 2024). Other events implicated in gut microbiota disruption includeproton pump inhibitors (PPI) use and inflammatory bowel diseases (Buddle and Fagan, 2023; Xiaolu et al., 2024). Researchers have attributed the pathogenicity of C. difficile to the two major virulence factors produced by toxigenic C. difficile strains, enterotoxin A (TcdA) and cytotoxin B (TcdB) (Buddle and Fagan 2023; Xiaolu et al., 2024)

On September 16th, 2013, the Centre for Disease Control (CDC) declared Clostridioides difficile as a threat with “urgent” concern to public health in the United States due to the identification of antimicrobial resistance among human and animal-derived Clostridioides difficile isolates to drugs commonly used in humans and also to their increased rates of associated patient mortality since the early 2000s(CDC, 2013).

In all the studies, some strains of C. difficile appear to be species-specific, while other strains were isolated from multiple species, including man. The organism was initially described as part of the normal flora in stool samples from healthy infants in 1935 (Parija, 2023), as well as its detection in significant numbers in healthy asymptomatic children (Khoder et al., 2019). It was afterwardidentified as a pathogen associated with several diseases, and even now, in hospitals and long-term care facilities, it has become the most common cause of diarrhea, causing the loss of billions of dollars in healthcarecosts (Panhwar, 2022).The symptoms of infection usually appear mild in some cases, and in others, they appear to be life-threatening or fatal(Mondal, 2019). Diarrhea associated with C. difficile is accompanied by the passage of occult blood or mucus in the stool, but hematochezia and melena are other rare symptoms (Sheen et al., 2021; Xiaoluet al., 2024). Certain other symptoms are found in less than 50% of infected patients, including abdominal discomfort, fever, and peripheral leukocytosis (Voutsinaset al., 2020).Disease caused by C. difficile is linked most commonly to nosocomial infections in humans, especially after empiric antibiotic treatment. Humans develop a spectrum of diseases when infected with some strains of C. difficile. It has been shown that not all people who are on prolonged antibiotic medication, as well as those above the age of 60 years, are susceptible to CDI(Jaceket.al, 2019). The advent of some virulent new strains of C. difficile has triggered an increase in CDI rates even in younger populations originally thought to be at low risk of contracting C. difficile infection (Doyle, 2013).To date, little is known about CDI in Southeastern Nigeria as inadequate attention has been given to the understanding of the molecular epidemiology of CDI in Nigeria, a high-burden country.Thus, the research was aimedatdeterminingthe prevalence, molecular characterization, pathogenicity, and antimicrobial susceptibility pattern of Clostridioides difficile from clinical samples in the South-Eastern states of Nigeria.

Study Area

The study was conducted after obtaining due ethical approval from the ethical committee of the ChukwuemekaOdumegwuOjukwu University Teaching Hospital (COUTH), Amaku, Awka,for the collection of stool samples in the hospital in Awka andneighbouring states.

Sample Collection

The clinical samples were collected from selectedpublic hospitals.Stool samples were collected in red cap universal bottles from COOUTH in Anambra, Federal Teaching Hospital Abakaliki in Ebonyi, Abia State University Teaching Hospital in Abia, Imo State University Teaching Hospital in Imo and Enugu State Teaching Hospital in Enugu. Samples were collected from patients for analysis in the clinical laboratory, after which they werecollected and preserved in an ice pack for further analysis. The samples were collected and someof the challeges in collection includes: untimely collection, patient unwillingness to cooperate, cross contamination risk,health and safety issues A total of 450 stool samples were collected and evaluated in this study. The sample size was determined using the sample size determination formula below:

$\:Samplesize\:\left(N\right)=\:{(Z}^{2\:}P\left(1-P\right))÷{D}^{2}$ ………….Eq. 1

where: N = Sample size, Z = z score (1.969), P = prevalence (0.45) andD = 0.05

Isolation and Identification of Clostridium difficile

For the isolation of Clostridioides difficile, all samples were pre-treated (heat shocked and alcohol shocked) to reduce competing flora and allow the growth of spore-forming bacilli. AStandard microbiological procedure was employed using Clostridium difficile differential agar CM 0601 (Oxoid) supplemented with Clostridium difficile selective supplement SR0096 (Oxoid) (Bridson, 2006). Stock solutions were prepared for the samples by weighing 20g of the stool samples into 180 ml of sterile saline water in a conical flask. A ten-fold serial dilution from the stock solution was made after mixing. From the fifth tube, 2 ml of the suspension was added to a well-labelled tube containing 2 ml of absolute ethanol (alcohol/ethanol shock method). The mixture was rocked gently to allow for homogenization, and it was left to stand for an hour before plating (of 100µl) was carried out. Heat treatment, also known as heat shocking, was employed by heating the tubes containing a mixture of samples to boil for 5 minutes. The tubes were then allowed to cool before plating was carried out on the media supplemented with Clostridium difficile supplement (Oxoid).The formula employed for the dilution factor is given below in Eq. (2)

$$\:Dilution\:factor\:=\:\frac{final\:volume}{aliquot\:volume\:}\left(2\right)$$

$$\:where:final\:volume=aliquot\:volume\:\left(sample\:volume\right)\:+diluent\:volume$$

Enumeration of the bacterial/fungal isolates was carried out using the formula delineated by Willey et al. (2008), and it is shown in Eq. (3) below.

$$\:\frac{cfu}{g}=\frac{number\:of\:colonies\:x\:dilution\:factor}{volume\:of\:inoculum\:}\:\:\:\:\:\:\:\:\:\:\:\left(3\right)\:$$

The cultural, morphological, microscopic and biochemical properties of the isolates were evaluated after Gram and spore staining was done to select the positive isolates for both stains.

Biochemical tests like catalase, oxidase, indole, urease and sugar fermentation tests were carried out to identify Clostridium species. The identity of Clostridioides difficile was finalized following blasting of sequences obtained using 16sRNA universal primer sets.

Antibiotic Susceptibility Test

The identified C. difficile were subjected to standard antibacterial susceptibility testing (AST). The antibiotic discs (Oxoid UK) containing the following antibiotics Meropenem (10 µg), Erythromycin (15 µg), Metronidazole (50 µg), Amoxicillin/clavulanic acid (20/10 µg), Clindamycin (20 µg), Gentamicin (10 µg), Ciprofloxacin (5 µg), Vancomycin (30 µg), and Tetracycline (30 µg) was used. Briefly, an18-24 hours bacterial culture wascultured on MHA. The inoculum corresponding to 1.5 x 10⁸ cells/ml McFarland standard wasstreaked using a sterile loop onto the MHA plates before the antibiotic discs were aseptically added with extreme care to the plates with the aid of sterile forceps. The susceptibility results were recorded after incubation for 24 hours at 37 ºC and interpreted usingClinical Laboratory Standards Institute breakpoints (CLSI, 2020).

Multiple Antibiotic Resistance Index determination

The MAR index was determined by the formula by Chitanandet al. (2010):

$\:MARindex=\frac{y}{nx}$ ………..Eq. 4

$$\:wherey=numberofresistancescored,\:n=numberofisolates$$

$$\:x=total\:number\:of\:antibioitics$$

Extraction of DNA

DNA was extracted using boiling method described by Chakravorty et al. (2007). 2 ml of 24 h. broth culture of C. difficile was transferred to tube and centrifuged at high speed for 5 min. The supernatant was discarded after which 200 µL of sterile distilled water (SDW) was added to the pellets and vortexed using a vortex mixer for 1 min before it was heated at 100 ^oC for 15 mins. Lastly, it was thereafter centrifuge at high speed for 2 minutes. The supernatant from the second spin was now regarded as the pure DNA and from which, 10 µL of DNA was used for amplification of the gene by PCR.

Table 1

Primer sets for virulence genes
Genes	Primer	Sequence (5’-3’)	Conc. (µM)	Product size (bp)
TcdA	tcdA-F tcdA-R	GTATGGATAGGTGGAGAAGTCAGTG CGGTCTAGTCCAATAGAGCTAGGTC	0.025	632
tcdB	tcdB-F tcdB-R	GAAGATTTAGGAAATGAAGAAGGTGA AACCACTATATTCAACTGCTTGTCC	0.01	441
cdtA	cdtA-F cdtA-R	ATGCACAAGACTTACAAAGCTATAGTG CGAGAATTTGCTTCTATTTGATAATC	0.2	260
cdtB	cdtB-F cdtB-R	ATTGGCAATAATCTATCTCCTGGA CCAAAATTTCCACTTACTTGTGTTG	0.5	179

The presence of genes which code for virulence (tcdA, tcdB, cdtA and cdtB) was determined using standardized primer sets in the table above.

Table 2

Primer sets for resistance genes
Genes	Primer	Sequence (5’-3’)	Conc. (µM)	Product size (bp)
erm(B	ErmB-F ErmB-R	GAAAAGGTACTCAACCAAATA AGTAACGGTACTTAAATTGTTTAC	0.1	639
tet(S)	TetS-F TetS-R	ATCAAGATATTAAGGAC TTCTCTATGTGGTAATC	0.1	573
tet(A)	tet(A)- F tet(A)- R	TTGGCATTCTGCATTCACTC GTATAGCTTGCCGGAAGTCG	0.1	494

The genes coding for erythromycin (ermB) and tetracycline resistance (tetA and tetS) were screened using polymerase chain reaction (PCR). The previously extracted bacterial DNA sample was used for the analysis. Agarose gel electrophoresis was carried out using each primer (forward and reverse primers) for the target genes (Call et al., 2003; Florez et al., 2014). A thermocycler was used to determine an optimal annealing temperature for the specific binding of the primer set to the DNA template.

Table 3

Total anaerobic bacterial count of stool samples obtained from patients in different states
Location	Number of Samples	Anaerobe count (Log₁₀CFU/g)	p-value(s)
Anambra	90	5.63 ± 0.09^a	0.168
Ebonyi	90	5.62 ± 0.11^ab	0.168
Enugu	90	5.65 ± 0.07^a	0.168
Imo	90	5.37 ± 0.19^b	0.066
Abia	90	5.45 ± 0.09^b	0.066

The results of the anaerobic stool sample count from Eastern Nigeria areshown in Table 3 above.The total anaerobe count (log₁₀CFU/g) for stool samples obtained from patients in different states showed that stool samples obtained from patients in Anambra had counts of 5.63 ± 0.09 log₁₀CFU/g. In contrast, samples from Ebonyi, Enugu and Imo states had counts of 5.61 ± 0.11 log₁₀CFU/g, 5.65 ± 0.07 log₁₀CFU/g and 5.36 ± 0.19 log₁₀CFU/g, respectively.

Plate 1. Agarose gel electrophoresis of bacterial DNA isolated from stool samples

Table 4

Identity of bacterial isolates (anaerobes) from stool samples from Eastern Nigeria
Sample Code	Source	Identity	Query Cover(%)	Homology (%)	Accession number
anStool12	Stool	Clostridioides difficile	100	100.00	MH888201.1
ebstool05	Stool	Clostridioides difficile	98	91.4	CP019858.1
Imstool15	Stool	Clostridioides difficile	99	99.8	CP019860.1
anStool21	Stool	Clostridioides difficile	99	96.75	CP025047.1
anStool22	Stool	Clostridioides difficile	97	90.35	CP020424.2
abstool12	Stool	Clostridioides difficile	100	100.00	MH888202.1
abstool17	Stool	Clostridioides difficile	99	99.8	CP019860.1
imstool83	Stool	Clostridioides difficile	91	94.6	CP028361.1
imstool49	Stool	Clostridioides difficile	91	94.6	CP028361.1
ebstool23	Stool	Clostridioides difficile	91	94.6	CP028361.1
ebstool33	Stool	Clostridioides difficile	99	99.8	CP019860.1
ebstool1	Stool	Clostridioides difficile	99	96.75	CP025047.1
abstool12	Stool	Clostridioides difficile	97	90.35	CP020424.2
anstool70	Stool	Clostridioides difficile	100	100.00	MH888202.1

The identity and Phylogenetic relatedness of anaerobic bacterial isolates obtained from stool samples in Eastern Nigeria are shown in Table 4 above.

Table 5

Prevalence of anaerobes from stool samples using standard cultural methods
Samples	Samples Number	Anambra	Ebonyi	Enugu	Imo	Abia	Total Sample(study)	Study Total (%)
Stool Samples	90	55(61)	45(50)	50(55)	41(46)	50(55)	450	241(54)

The prevalence of anaerobes from stool samples using standard cultural methods (Table 5) revealed that all stool samples but Imo (46%) had anaerobic counts equal to or greater than 50% following a cultural phenotypic standard. In comparison, a total of 54% was obtained in the entire study.

Table 6

Prevalence of *Clostridioides difficile* from stool samples in the study
Samples	Sample Number	Anambra	Ebonyi	Enugu	Imo	Abia	Total sample (study)	Study Total (%)
Stool Samples	90	4(44.4)	2(22.2)	2(22.22)	3(33.3)	3(33.3)	450	14(3.11)

The prevalence of Clostridioides difficile from stool samples (Table 6) revealed a total study prevalence of 3.11% for stool samples. Stool samples from Ebonyi and Enugu states had a prevalence of 2.22% apiece. In comparison, Imo and Abia states had a 3.33% prevalence of C. difficile from stool samples, with Anambra state having the highest prevalence of 4.44%.

Table 7

Percentage Recovery of *C. difficile* from stool samples using cultural methods
Sample	Number	Heat Treatment (%)	Alcohol Treatment (%)	Study Total (%)
Stool Samples	450	5(1.11)	14(3.11)	14(3.11)

The prevalence of C. difficile recovered by the heat treatment method (1.11%) was found to be lower than the percentage recovered via alcohol treatment (3.11%).

Table 8

a: Antibiotic sensitivity profile to common antibiotics
Code	Samples	MEM	ERY	MET	AMC	CL	CN	CIP	VA	TET
anStool12	Stool	S	R	S	R	S	S	S	R	R
ebStool05	Stool	S	S	S	R	S	S	S	R	R
imStool15	Stool	S	R	R	S	R	S	R	S	R
anStool21	Stool	S	S	S	S	S	S	S	S	R
anStool22	Stool	S	R	S	S	S	S	R	S	R
abStool12	Stool	R	S	R	S	R	S	S	S	R
abStool77	Stool	S	R	R	S	S	S	R	S	R
imStool83	Stool	S	R	S	S	R	S	R	S	S
imstool49	Stool	S	R	R	S	R	S	R	S	R
ebstool23	Stool	R	R	R	S	S	S	S	S	R
enstool33	Stool	S	R	S	S	S	S	S	S	R
enstool1	Stool	S	R	S	S	R	S	R	S	R
abStool14	Stool	S	S	S	R	S	S	S	R	S
anstool70	Stool	S	S	S	S	S	S	R	S	S
Keys: Meropenem (10 µg), Erythromycin (15 µg), Metronidazole (50 µg), Amoxicillin/clavulanic acid (20/10 µg), Clindamycin (20 µg), Gentamicin (10 µg), Ciprofloxacin (5 µg), Vancomycin (30 µg), Tetracycline (30 µg)

Antibacterial sensitivity pattern and percentage of resistance/susceptibility of C. difficile isolates stool samples to common antibiotics showed susceptibility to carbapenems (82.61%), aminoglycosides (86.98%) and Β-Lactam/combination agents (73.91%). Notable resistance was observed for tetracycline (73.91%), macrolides (73.91%) and fluoroquinolones (43.48%), respectively.

Table 8

b: Percentage of antibiotic resistance and susceptibility profile of common antibiotics
Antibiotics Classes	Antibiotics	Susceptibility profile n = 09
Antibiotics Classes	Antibiotics	Sensitive (%)	Resistant (%)
Carbapenems	MEM	19(82.61)	3(17.39)
Macrolides	ERY	6(26.09)	17(73.91)
Nitroimidazole	MET	16(69.56)	7(30.43)
Β-Lactam/combination agents	AMC	17(73.91)	6(26.09)
Lincosamide	CL	15(65.22)	8(34.78)
Aminoglycosides	CN	20(86.98)	3(13.02)
Fluoroquinolone	CIP	13(56.52)	10(43.48)
Glycopeptides	VA	16(69.56)	7(30.43)
Tetracyclines	TET	6(26.09)	17(73.91)

Key: Meropenem (10 µg), Erythromycin (15 µg), Metronidazole (50 µg), Amoxicillin/clavulanic acid (20/10 µg), Clindamycin (20 µg), Gentamicin (10 µg), Ciprofloxacin (5 µg), Vancomycin (30 µg), Tetracycline (30 µg).

Table 9

Multiple antibiotic resistance distribution of *C. difficile* isolates from clinical sources
Isolate Code	Antibacterial Classes	Number of Antibiotics	Resistance Phenotypes	Resistant phenotypes (%)	MAR Index
anBE7, ebstool05	9	9	AMCR, VAR, TETR	2(8.69)	0.33
enLV4, ebstool23	9	9	MEMR, ERYR, METR, TETR	2(8.69)	0.44
ebLV5	9	9	ERYR, CNR, TETR	1(4.35)	0.33
anStool12	9	9	ERYR, AMCR, VAR, TETR	1(4.35)	0.44
imstool15, imstool49	9	9	ERYR, METR, CLR, CIPR, TETR,	2(8.69)	0.55
anstool21	9	9	TETR	1(4.35)	0.11
anstool222	9	9	ERYR, CIPR, TETR	1(4.35)	0.33
abstool12	9	9	MEMR, ERYR, METR, CLR, TETR	1(4.35)	0.55
enstool33	9	9	ERYR, TETR	1(4.35)	0.22
enstool1	9	9	ERYR, CLR, CIPR, TETR	1(4.35)	0.44
abstool14	9	9	AMCR, VAR	1(4.35)	0.22
anstool70	9	9	CIPR	1(4.35)	0.11
Keys: Meropenem (10 µg), Erythromycin (15 µg), Metronidazole (50 µg), Amoxicillin/clavulanic acid (20/10 µg), Clindamycin (20 µg), Gentamicin (10 µg), Ciprofloxacin (5 µg), Vancomycin (30 µg), Tetracycline (30 µg)

The multiple antibiotic resistance phenotypic distribution of C. difficile isolates from clinical samples (Table 9) showed that isolates with a MAR index of 0.44 had the highest resistance phenotypes. In contrast, isolates with a MAR index of 0.33 had the next highest resistance phenotypes.

Table 10

Prevalence of virulence genes in isolates of *C. difficile* obtained from stool samples
Lanes	Code	Samples	tcdA	tcdB	cdtA	cdtB	Total (%)
1	anStool12	Stool	+	+	-	-	2(50)
2	ebstool05	Stool	+	+	-	-	2(50)
3	Imstool15	Stool	+	+	-	-	2(50)
4	anstool21	Stool	-	+	-	-	1(25)
5	anstool22	Stool	+	+	+	+	4(100)
6	abstool12	Stool	+	+	-	-	2(50)
7	abstool77	Stool	+	+	-	-	2(50)
8	imstool83	Stool	-	+	-	-	1(25)
9	imstool49	Stool	+	+	-	-	2(50)
10	ebstool23	Stool	-	+	-	-	2(50)
11	enstool33	Stool	+	+	-	-	2(50)
12	enstool11	Stool	-	+	-	-	1(25)
13	abstool12	Stool	+	+	-	-	2(50)
14	anstool70	Stool	₊	+	-	-	2(50)
Total Study(%)			16(69.56)	23(100.00)	1(4.34)	1(4.34)

All (100%) of C. difficile isolates were found to possess tcdBgenes. About tcdAgenes, 10 of 14 positive isolates were found to possess the virulence genes, making a total of 69.56% of isolates with positive results for the presence of the genes. None of the isolated C. difficile strains but one possessed cdtAand cdtB genes, thus giving a percentage of 4.34% apiece for the aforementioned genes. The prevalence of virulence genes in Table 10 revealed that 3 isolates possessed 25% (one of the four) of virulence genes analyzed in the study, while 10 isolates possessed two of the four virulence genes (50%)

Table 11

Prevalence of resistant genes to erythromycin and tetracycline found in isolates of *C. difficile* obtained from stool samples
Lanes	Code	Samples	TetA	tetS	ErmB	Total(%)
1	anStool12	Stool	+	+	+	3(100)
2	ebstool05	Stool	+	+	-	2(67)
3	Imstool15	Stool	+	+	+	3(100)
4	anstool21	Stool	+	+	-	2(67)
5	anstool22	Stool	+	+	+	3(100)
6	abstool12	Stool	+	+	+	3(100)
7	abstool77	Stool	+	+	+	3(100)
8	imstool83	Stool	-	-	+	1(33)
9	imstool49	Stool	+	+	+	3(100)
10	ebstool23	Stool	+	+	+	3(100)
11	enstool33	Stool	+	+	+	3(100)
12	enstool1	Stool	+	+	+	3(100)
13	abstool12	Stool	-	-	-	0(0)
14	anstool70	Stool	-	-	-	0(0)
Total study (%)			17(73.91)	17(73.91)	17(73.91)

. Agarose gel electrophoresis of resistance genes present in C. difficile obtained from stool samples is shown in Table 11. In contrast,erm(B)gene PCR products amplified from Clostridioides difficile isolates were found in 73.91%; it was also the same percentage that was present for tetracycline resistance (tet(S) and tet(A) genes). Nine isolates were found to possess all resistance genes analyzed in the study

The majority of bacteria (anaerobes) in the stool are commensals, which oftendo not harm humans unless there is an underlying risk factor or the case of a compromised immune system. The bacterium of interest in this study (C. difficile) is regarded as both a commensal organism and a pathogen to domestic animals (Doyle, 2013). Most of these anaerobes in the gut that have been isolated from the feces are not competitive, and their population can only explode, or they can thrive better in the gut after an array of antibiotic treatments which could destroy much of the intestinal normal flora (Doyle, 2013). The statistical comparison of the total anaerobic count in stool samples showedno significant difference (p>0.05) between samples obtained from Ebonyi and other Eastern states in the study. However, there was a significant difference between samples obtained from Anambra and those from Imo and Abia states, respectively.

The bacterial identity, query cover, and percentage homology were written against the confirmed blasted identity of the isolates,including accession numbers obtained from the National Centre for Biotechnology Information (NCBI) website. The 3.11% prevalence of Clostridiumdifficile obtained in this study is less than several reported prevalences in the literature. This implies that the probability of infection due to C. difficile would be very low.However, the presence of the pathogen (even in its low prevalence) in this study is an indication that there is a likely chance of a CDI outbreak if proper measures are not in place to curtail the infection. Following reports by Warrineret al. (2017), C. difficile was previously thought to be clinically associated alone. Still, with advanced scientific methods, it is now being muted as a community-acquired infection. The prolonged survival of spores of C. difficile in the environment might also increase the possibility of animal and food contamination which is a potential source of infection(Weese, 2010). In Europe, a higher prevalence had also been reported thanthe one obtained in this study, howbeit for hospitalized patients with even higher reports of toxigenic strains of C. difficile recovered from patients’stool (Martirosianet al., 1993; Shehabiet al., 2001). Nonetheless, findings in this study corroborated the report of Mori and Aoki (2015) and Deane et al. (2021),who opined that carriage rates of C. difficile in healthy adults varied from 0% to 3% in Europe to up to 15% in Japan.

Following cultural phenotypic methods, the percentage recovery of C. difficile from stool samples revealed that while both treatment methods (heat and alcohol treatments) yielded positive C. difficile growth, the alcohol shock method was found to be better at recovering the bacterium isolates from clinical samples. The findings in this study about how the spores of the bacterium were recovered from both treatment processes agreed with the findings of Lawley et al. (2009). They reported that spores are difficult to eradicate due to their ability to resist radiation, heat and chemicals (such as alcohols), which are usually employed as disinfectants in both hospital and community settings. In this study, alcohol shock samples (3.11%) had a better recovery rate than heat shock samples (1.11%).However, the susceptibility to Carbapenems and aminoglycosides by most isolates of C. difficile in this study was at variance with what was observed in other studies (Rodriguez-Palacios et al., 2007; Simango and Mwakurudz, 2008; Jöbstlet al., 2010) which separately reported some levels of resistance to the antibiotics by the bacterium of interest.It is noteworthy that some of these antibiotics, as mentioned above, are commonly used for the treatment of diarrhea in humans.In vitro,resistance in C. difficile to several classes of antimicrobial agents hasbeen recognized and reported by Gerding (2004). Thus, there is the possibility of a high risk for CDI to occur in healthcare settings and the community at large. This finding corroborated the report of Freeman et al.(2009), who asserted that the resistance of C. difficile to several antibacterial agents may not be essential for infection because the organismisrelatively susceptible to high-risk antimicrobial agents.

It has been reported that the major pathogenic mechanism of C. difficile is the production of cytotoxin B and enterotoxin A, which are respectively encoded by tcdBandtcdAgenes, co-located in a 19.6 kb region of the chromosome named pathogenicity loci (Paloc) along with other regulatory genes (Freeman et al., 2009;Buddle and Fagan 2023; Xiaolu et al., 2024).Toxin A causes diarrhea, and Toxin B is cytotoxic to the colonic cells. Virtually all studies where C. difficile have been successfully recovered have screened for the ability of the isolates to have had at least one of the three toxins or genes (tcdA, tcdB, cdtA/B) needed to fulfill the criteria for virulence/toxigenicity (Rodriguez-Palacios et al., 2014). The findings in this study (69.56% and 100.00% for tcdA and tcdB genes respectively) are in agreement with the report of Shokoohizadehet al. (2021), who opined that the genes for enterotoxin production tcdA are found in approximately 70% of C. difficile isolates, while the genes for cytotoxin production are found in all strains of C. difficile isolates. The severity of the disease caused by the bacterium is conferred by the presence of the genes (cdtAandcdtBgenes), which code for the production of binary toxins (Rupnik, 2009; Bacciet al., 2011). The pathogenicity of C. difficile is mainly due to the presence of two large protein toxins (toxin A and toxin B) and the fully described binary toxin (Chandrasekaran and Db, 2017). Toxin A is a potent enterotoxinthat causes the accumulation of fluid in the gut, is cytotoxic to cells in tissue culture, and isperhaps lethal to experimental animals (Kuehne et al., 2010).Toxin B has been reported to be a 1,000-fold more potentcytotoxin than toxin A (but is not an enterotoxin) in original animal studies. Still,there are reports that some strains produce toxin B and not toxin A,which causes severe diarrhea in humans (Barbutet al., 2007). More so, the reports of C. difficile strains are toxin A–negative and toxin B–positive, whichhave been associated with human diseases described in certain epidemics around the world (Johnson et al., 2001). The variation in the findings in this study could be a function of geographical differences and environmental conditions with respect to cultural methods and methods used for the analysis of the bacterium.

The findings in this study are consistent with the reports from literature, which have it that the bacterium (C. difficile) from humans or animals are commonly resistant to macrolides (erythromycin) and tetracyclines as well as fluoroquinolones (moxifloxacin) and the lincosamides (clindamycin).The findings in this study are consistent with the reports from theliterature, which have it that the bacterium (C. difficile) from humans or animals are commonly resistant to macrolides (erythromycin) and tetracyclines as well as fluoroquinolones (moxifloxacin) and the lincosamides (clindamycin) (Gerding, 2004; Simango and Mwakurudz, 2008; Jöbstl et al., 2010; ). Also consistent with the finding in this study was the report by Knetschet al. (2018), who opined that the global C. difficile population contained a broad array of antibiotic-resistance genes encoding resistance to tetracycline and erythromycin.

This study provides baseline data for the prevalence of Clostridium difficile in clinical samples in Southeast Nigeria.

Chances of severe infections for this pathogen in the studied location will be rare owing to the low prevalence and non-possession of genes for binary toxin production in most of the isolates in the study.
The study has re-enacted the idea that the alcohol shock method for isolation of Clostridium difficile is more effective than the heat-shock method.
Pathogenic Clostridium difficile isolates in the studied location were multi-drug resistant.

This study evaluated the prevalence, molecular characterization, pathogenicity, and antibiotic sensitivity patterns of Clostridium difficile in South-Eastern Nigeria, revealing high sensitivity to gentamicin, meropenem, and amoxicillin-clavulanic acid, but resistance to tetracyclines and erythromycin, with significant expression of tcdB and tcdA virulence genes.

CONFLICT OF INTEREST

The authors declare that they have no conflict of interest.

FUNDING

No funding received for this study.

Ethics Approval and Consent to Participate

This research was carriedout in line with the principles of the Declaration of Helsinki. Ethical approval for this research was obtained from Ethical Committee, Chuckwuemeka Odumegwu Ojukwu University Teachicng Hosptial Amaku, Awka, Anambra State, Nigeria. The ethics approval number is COOUTH/CMAC/ETH.C/VOL.1/0035 and the approval was granted on 1/08/2018. The committee reviewed and approved all aspects of the study, including the study design, recruitment methods, and data collection procedures, ensuring that they were in compliance with ethical standards and guidelines.

The consent to Participate was obtained from all individuals that participated in this research. Individuals were given detailed information regarding the research’s objectives, procedures, potential risks, and benefits. They were informed that participation was voluntary, that they could withdraw from the research at any given time without any punishment, and their data would be under confidentiality. All these were done prior to sample colections from the individuals

Consent for Publication

This was done by informing all participants involved in this research about the nature of the data/material to be published, the purpose of its publication, and the potential accessibility of the publication to the general public. The individuals agrees that their details may be used in the manuscript titled “Prevalence, Pathogenicity and Antimicrobial Susceptibility Pattern of Clostridioides Difficile From Clinical Samples in South Eastern Nigeria” and published in BMC Microbiology Journal They gave their full consent knowing fully well that this redearch will contribute greatly to scientific knowledge, which could be made available in print and online formats. .Individuals were given full assurance that their confidentiality and privacy would be maintained to the fullest extent possible and that any identifying details will only be published with their explicit permission. They were brief about their right to withdraw their consent at any time before the publication process is completed, without any punishment to their participation in the research.

Availibiliy of data and material

Data and materials used in this research are not available for sharing due to privacy concerns protecting individuals confidentiality and privacy, since it is involving human subjects, which might contain sensitive information. Materials are no longer available due to resource constraints or supply chain disruptions

Acknowledgements

Thanks to Dr. A.G. Ogofure and the members of staff of Department of Microbiology, University of Benin, Benin City, Nigeria for their enabling environment for the Laboratory work. The authors wish to also acknowledge support received from TETFUND –Centre of Excellecne for Biomedical, Engineering and Agricultural Translational studies UNIZIK, Awka, Nigeria.

Adegoke, A., Faleye, A., Singh, G. and Stenström, T. (2016). Antibiotic-Resistant Superbugs: Assessment of the Interrelationship of Occurrence in Clinical Settings and Environmental Niches. Molecules: A Journal of Synthetic Chemistry and Natural Product Chemistry 22. https://doi.org/10.3390/molecules22010029.
Bacci, S., Mølbak, K., Kjeldsen, M.K. and Olsen, K.E. (2011). Binary toxin and death after Clostridium difficile infection. Emerging Infectious Diseases 17:976–982.
Barbut F., P. Mastrantonio, M. Delme´e, J. Brazier, E. Kuijper, and I.Poxton (2007). Prospective study of Clostridium difficile-associated disease in Europe with phenotypic and genotypic characterization of the isolates. Clin. Microbiol. Infect.13:1048–1057.
Bridson, E.Y. (2006). The Oxoid Manual (9^th Edition). Oxoid Limited, Basingstoke Hamsphire, England 623 pp.
Buddle, J. E. and Fagan, R. P. (2023). Pathogenicity and virulence of Clostridioides difficile. Virulence14(1): 2150452.
Call, D.R., Bakko, M.K., Krug, M.J. and Roberts, M.C. (2003). Identifying antimicrobial resistance genes with DNA microarrays. Antimicrobial Agents and Chemotherapy47: 3290 – 3295.
Centers for Disease Control and Prevention (CDC) (2013). Antibiotic Resistance Threats in the United States, 2013, CDC, Atlanta, Ga, USA.
Chandrasekaran, R., and Db, L. (2017). The role of toxins in Clostridium difficile infection. FEMS Microbiology Reviews41(6): 723-750. https://doi.org/10.1093/femsre/fux048.
Chitanand, M.P., Kadam, T.A., Gyananath, G., Totewad, N.D. and Balhal, D.K. (2010). Multiple antibiotic resistance indexing of coliforms to identify high-risk contamination sites in aquatic environment. Indian Journal of Microbiology50: 216–220
Clinical Laboratory Standard Institute (CLSI) (2020). Performance Standards for Antimicrobial Susceptibility Testing (30th Ed.). CLSI supplement M100. Wayne, Pennsylvania 332 pp.
Deane, J., Fouhy, F., Ronan, N., Daly, M., Fleming, C., Eustace, J., Shanahan, F., Flanagan, E., Dupont, L., Harrison, M., Haworth, C., Floto, A., Rea, M., Ross, R., Stanton, C., & Plant, B. (2021). A multicentre analysis of Clostridium difficile in persons with Cystic Fibrosis demonstrates that carriage may be transient and highly variable with respect to strain and level: Cystic Fibrosis and Clostridium difficile. The Journal of Infection. https://doi.org/10.1016/j.jinf.2020.12.027.
Doyle, E.M. (2013). Clostridium difficile as a Risk Associated with Animal Sources. FRI Food Safety Reviews. Food Research Institute, University of Wisconsin, pp. 1-18.
Flórez, A.B., Alegría, Á., Rossi, F., Delgado, S., Felis, G.E., Torriani, S. and Mayo, B. (2014). Molecular identification and quantification of tetracycline and erythromycin resistance genes in Spanish and Italian retail cheeses. BioMed Research International. https://doi.org/10.1155/2014/746859
Freeman J., W. N. Fawley, J. Hobbs, P. Else, P. Verity, P. Parnell, S., D., Baines, and M. H. Wilcox (2009). Decreasing metronidazole susceptibility in epidemic Clostridium difficile strains, abstr. C2-1964. Abstract on 49th Interscience Conference on Antimicrobial Agents and Chemotherapy, San Francisco, CA.
Gerding, D. N. (2004). Clindamycin, cephalosporins, fluoroquinolones, and Clostridium difficile-associated diarrhea: this is an antimicrobial resistance problem. Clin. Infect. Dis. 38:646–648.
Jacek, C., Mirosław, D., Hanna, P., Kuijper, J., William, P., Aleksandra, M., Sarah, G., Dorota, W., Aleksander, G., and Grażyna, B., (2019). European Journal of Clinical Microbiology and Infectious Diseases. 38(7): 1211–1221
Jobstl, M., Heuberger, S., Indra, A., Nepf, R., Kofer, J. and Wagner, M. (2010). Clostridium difficile in raw products of animal origin. International Journal of Food Microbiology. 138(2):172–175.
Johnson, S., Kent, S.A. and O’Leary, K.J. (2001). Fatal pseudomembranous colitis
associated with a variant Clostridium difficile strain not detected by toxin A immunoassay. Annals of Internal Medicine.135: 434–438.
Khoder, G., Muhammad, J. S., Mahmoud, I., Soliman, S. S. and Burucoa, C. (2019). Prevalence of Helicobacter pylori and its associated factors among healthy asymptomatic residents in the United Arab Emirates. Pathogens 8(2): 44.
Kuehne, S., Cartman, S., Heap, J., Kelly, M., Cockayne, A., & Minton, N. (2010). The role of toxin A and toxin B in Clostridium difficile infection. Nature, 467, 711-713. https://doi.org/10.1038/nature09397.
Lawley, T.D., Croucher, N.J., Yu, L.U., Clare, S., Sebaihia, M., Goulding, D., Pickard, D.J., Parkhill, J., Choudhary, J. and Dougan, G. (2009). Proteomic and genomic characterization of highly infectious Clostridium difficile 630 spores. Journal of Bacteriology. 191:5377–5386.
Markantonis, J.E., Fallon, J.T., Madan, R. and Alam, M.Z. (2024). Clostridioides difficileInfection: Diagnosis and Treatment Challenges. Pathogens13: 118. https://doi.org/10.3390/pathogens13020118
Martirosian, G., Polanski, J., Szubert, A. and Meisel-Mikolajczyk, F. (1993). Clostridium difficile in a department of surgery. Materia medica Polona 25:45-47.
Mondal, S. (2019). Prospective observational study to assess patient profile with Clostridium difficile colitis.
Mori, N. and Aoki, Y. (2015). Clinical characteristics and risk factors for community-acquired Clostridium difficile infection: A retrospective, case-control study in a tertiary care hospital in Japan. Journal of Infection and Chemotherapy: Official Journal of the Japan Society of Chemotherapy21(12): 864-867. https://doi.org/10.1016/j.jiac.2015.09.004.
Panhwar, A., Abro, R., Kandhro, A., Khaskheli, A. R., Jalbani, N., Gishkori, K. A. and Qaisar, S. (2022). Global Water Mapping, Requirements, and Concerns over Water Quality Shortages.
Parija, S. C. (2023). Clostridium. In Textbook of Microbiology and Immunology (pp. 465-488). Singapore: Springer Nature Singapore.
Rodriguez-Palacios, A., Ilic, S. and LeJeune, J.T (2014). Clostridium difficile with Moxifloxacin/Clindamycin Resistance in Vegetables in Ohio, USA, and Prevalence Meta-Analysis. Journal of Pathogens7
Rodriguez-Palacios, A., Staempfli, H. R., Duffield, T., Weese, J. S. (2007). Clostridium difficile in retail ground meat, Canada. Emerging Infectious Diseases.13(3):485–487.
Rupnik, M., Wilcox, M.H. and Gerding, D.N. (2009). Clostridium difficile infection: new developments in epidemiology and pathogenesis. Nature Reviews Microbiology7:526–536.
Sheen, E., Pan, J., Ho, A.andTriadafilopoulos, G. (2021). Lower Gastrointestinal Bleeding. In Geriatric Gastroenterology (pp. 1305-1325). Cham: Springer International Publishing.
Shehabi A. A., Abu-Ragheb H. A. and Allaham N. A. (2001). Prevalence of Clostridium difficile-associated diarrhoea among hospitalized Jordanian patients. Eastern Medical and Health Journal. 7:750-5.
Shokoohizadeh, L., Alvandi, F., Yadegar, A., Azimirad, M., Hamid-Hashemi, S. and Alikhani, M.A. (2021). Frequency of toxin genes and antibiotic resistance pattern of Clostridioides difficile isolates in diarrheal samples among hospitalized. patients in Hamadan, Iran. GastroenterolHepatol Bed Bench 14(2):165-173
Simango, C. and Mwakurudza, S. (2008). Clostridium difficile in broiler chickens sold at marketplaces in Zimbabwe and their antimicrobial susceptibility. International Journal of Food Microbiology. 124: 268–270.
Voutsinas, N., Toussie, D., Jacobi, A., Bernheim, A.and Chung, M. (2020). Incidental CT findings in the lungs in COVID-19 patients presenting with abdominal pain. Clinical Imaging 67: 1-4.
Warriner, K., Xu, C., Habash, M., Sultan, S. and Weese, S. (2017). Dissemination of Clostridium difficile in food and the environment: Significant sources of C. difficile community‐acquired infection?. Journal of Applied Microbiology122. https://doi.org/10.1111/jam.13338.
Weese, J.S., Finley, R., Reid-Smith, R. R., Janecko, N. and Rousseau, J. (2010). Evaluation of Clostridium difficile in dogs and the household environment. Epidemiological Infection. 138:1100–1104.
Willey, L.M., Sherwood, L.J. and Woolverton, L. (2008). Microbiology (7^th Edition). Mc-Graw Hill, New York, 966 pp.
Xiaolu, L., Yizhong, W., Rong, C., Fangfei, X., Xufei, W., Lin, Y., Yongmei, X., Dan, L. and Ting, Z. (2024). Antimicrobial Resistance of Clostridioides difficile in Children from a Tertiary Pediatric Hospital in Shanghai, China. Infection and Drug Resistance 17: 329–339.

Plate 1 is available in the Supplementary Files section.

No competing interests reported.

Plate1.docx

Download PDF

Editorial decision: Revision requested
11 Sep, 2024
Editor assigned by journal
11 Sep, 2024
Submission checks completed at journal
04 Sep, 2024
First submitted to journal
22 Aug, 2024

You are reading this latest preprint version

Prevalence, Molecular Characterization, Pathogenicity and Antimicrobial Susceptibility Pattern of Clostridioides Difficile From Clinical Samples in South Eastern Nigeria.

Status:

Version 1

Abstract

INTRODUCTION

METHOD

Study Area

Sample Collection

Antibiotic Susceptibility Test

Multiple Antibiotic Resistance Index determination

Extraction of DNA

RESULTS

Plate 1. Agarose gel electrophoresis of bacterial DNA isolated from stool samples

DISCUSSION

CONCLUSION

Declarations

References

Plate

Additional Declarations

Supplementary Files

Status:

Version 1