2.1 Experimental animals
Male SD rats aged 6–8 weeks and weighing 180–220 g were purchased from Lanzhou Veterinary Research Institute. They were kept in a room with a 25 ± 2°C temperature range, 45–60% relative humidity, and a 12 h/12 h light–dark cycle for one week. During the breeding season, the rats were given unrestricted access to food and drink. The Ethics Committee of the First Hospital of Lanzhou University approved the use of the experimental animals (No. LDYYLL2021–327).
2.2 Mouse Myocardial I/R Model
The four groups of SD rats, each consisting of nine rats, were created at random and included the following groups: the ischemia‒reperfusion model group (I/R), sham operation group (sham), and ischemia‒reperfusion + feroxamine group (100 mg/kg, intraperitoneal injection) (DFO). Following the intraperitoneal injection of sodium pentobarbital to induce anesthesia in the rats, a thoracotomy was carried out at the third or fourth intercostal space along the left edge of the sternum. The heart was then exposed, the left anterior descending branch of the coronary artery was ligated, and the heart was then returned to its initial position following ligation. After the heart was subjected to ischemia for 30 minutes, the ligated thread was cut, the heart was put back in place, and it was perfused for an additional 120 minutes.
2.3 Enzyme-linked immunosorbent assay
ELISAs were used to measure the levels of ferritin, LDH, MDA, SOD, and GSH in rat serum and cardiomyocytes according to the manufacturer's instructions (Ruixin Biotech).
2.4 TTC staining
The myocardial tissue was cut approximately 3 mm thick near the ligature and the midpoint of the rat cardiac apex, and the tissue was placed in TTC solution (1% concentration, pH 7.4). Then, the samples were incubated in 37°C water for approximately 5 to 8 minutes, the tissue slices were immediately removed, and the samples were soaked in a 10% formalin solution for approximately 1 hour. Results: Myocardial ischemia but noninfarction tissue appeared brick red (damaged area) (TTC+); infarction myocardial tissue appeared grayish white (TTC-); and nonischemic myocardial tissue appeared blue (Evan's blue+). The anatomical features of each group of rats included the myocardial infarction area (INF), the myocardial damage area (AAR), and the ratio of the two (INF/AAR).
2.5 Hematoxylin and eosin staining
A 4% paraformaldehyde solution was used to preserve the heart tissues of the rats. After being immersed in paraffin and washed with cold saline, the fixative was cut to a thickness of approximately 5–8 µm. Hematoxylin‒eosin (HE) was applied to the slices, which were then dried and shaken. Using an optical microscope, the pathological alterations in the cardiac tissue slices were noted and studied.
2.6 Immunofluorescence
The regular steps involved dewaxing the pathological sections of each group, hydrating them with gradient ethanol, heat-repairing them with sodium citrate, and inactivating them at room temperature with 30% H2O2. Next, 0.25% Triton-prepared 5% BSA blocking solution was added, and the mixture was blocked for 30 minutes. After the blocking solution was removed, the blocking solution-prepared primary antibody was added, and the mixture was incubated for an additional night at 4°C. The secondary antibody was applied, and the sections were then rinsed with PBS, allowed to sit at room temperature for an hour, captured on a camera via a fluorescence microscope and subjected to analysis via ImagePro Plus software.
2.7 RT‒PCR
Total RNA was extracted via the TRIzol method, and cDNA was synthesized via reverse transcription of the RNA according to the manufacturer’s instructions (SYBR Green Pro Taq HS premixed qPCR kit; EvoM-MLV reverse transcription premix kit). Quantitative real-time PCR was performed via an MA-6000 real-time fluorescence quantitative PCR instrument to confirm the RT‒PCR amplification curve and melting curve to evaluate the reliability of the data. The GAPDH gene was used as the internal reference to calculate the target gene 2−△△Ct. The primer sequences are shown in Table 1.
Table 1
| Gene | Primer sequence | Length(bp) |
| GAPDH | AATGGTGAAGGTCGGTGTGAAC AGGTCAATGAAGGGGTCGTTG | 114 |
| Gpx4 | AAGTACAGGGGTTGCGTGTG GGGCATCGTCCCCATTTACA | 250 |
| Tfr2 | CGGGTGAGATGGATAGCGTC TATGGACAACAGAGGTTACCAGG | 110 |
| HO-1 | AGCGAAACAAGCAGAACCCA ACCTCGTGGAGACGCTTTAC | 160 |
| ACSL4 | TGCTACTGAGCAGATCCCAG AGCTAGTGAGTCGAAGTGCG | 153 |
2.8 High-throughput sequencing
Approximately 20 mg of cardiac tissue frozen with liquid nitrogen was removed, and total miRNA was extracted with a miRNA extraction kit. After miRNA quality assessment, sequencing was performed via the Illumina sequencing platform. Principal component (PCA) analysis, an online Venn Chart data analysis platform and a volcano map were used to analyze the differences in the detected genes according to the miRNA detection results of each group.
2.9 Cell culture
Myocardial H9C2 cells (Procell Life Technology Co., Ltd., Wuhan, China) in the hypoxia model group were first cultured under 95% N2 and 5% CO2 conditions for 1 h. The mixture was placed in an ischemic buffer mixture (1.13 mmol of CaCl2, 5 mM KCl, 0.3 mmol of KH2PO4, 0.5 mmol of MgCl2, 0.4 mmol of MgSO4, 128 mmol of NaCl, 4 mmol of NaHCO3, and 10 mmol of HEPES, pH 6.8), and then, under normal culture conditions, the cells were reoxygenated for 3 h. The experimental groups are shown in Table 2.
Table 2
| Group | Deal with |
| Control | PBS + DMSO |
| I/R | 95% N2、5% CO2 + Ischemic buffer |
| I/R + 541 mimics-NC | Transfection of miRNA-541-5p null set only |
| I/R + 541 mimics | Transfection of miRNA-541-5p group only |
| I/R + 541 inhibitor-NC | Transfection of miRNA-541-5p inhibitor null group only |
| I/R + 541 inhibitor | Transfection of miRNA-541-5p inhibitor group only |
| I/R + 541 + pcDNA3.1 | Transfection of miRNA-541-5p + pcDNA3.1 group only |
2.10 Target gene adenovirus vector construction
Serum or myocardial homogenate was digested with an equal volume of ultrapure nitric acid in a water bath at 50°C for 48 h and diluted with 3.12 mmol/L nitric acid. A standard iron solution was prepared, and a standard curve was generated to calculate the ferritin content in the myocardial tissue.
2.11 CCK8
After trypsin digestion, H9C2 cells were adjusted to a density of 5×105 cells/mL in complete DMEM. One hundred microliters of cell suspension was inoculated into each well of a 96-well plate, and a blank control group was set up. In accordance with the manufacturer’s instructions, the culture plate was placed in a sealed box, placed in an anaerobic bag, placed in a 37°C incubator for anoxic culture for 6 h, and then reoxygenated for 4 h. Then, 10 µL of CCK8 reagent was added to each well, the plate was placed in a 37°C incubator and incubated in the dark for 1 h, and the absorbance at 450 nm was measured via an ELISA reader.
2.12 Western blot
The following primary antibodies were used for conventional Western blotting: GPX-4 (Bs-3884R, BIOSS), ACSL-4 (DF12141, Affinity), TFR1 (41377R, BIOSS), and HO-1 (AF539, Affinity). The secondary antibody used was goat anti-rabbit (G1215-3, Servicebio).
2.13 Statistical analysis
SPSS 21.0 software was used for statistical analysis of the data, and one-way analysis of variance was used to compare the data among groups. GraphPad Prism 8 was used for plotting, and the results are expressed as the means ± standard deviations (SD). p < 0.05 indicated that the difference was statistically significant.