Strong Protection by Bazedoxifene Against Chemically-Induced Ferroptotic Neuronal DeathIn Vitro and In Vivo

doi:10.21203/rs.3.rs-4961621/v1

Download PDF

Research Article

Strong Protection by Bazedoxifene Against Chemically-Induced Ferroptotic Neuronal DeathIn Vitro and In Vivo

https://doi.org/10.21203/rs.3.rs-4961621/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Ferroptosis, a form of regulated cell death associated with iron-dependent lipid peroxidation, can be induced in cultured cells by chemicals (e.g., erastin and RSL3). It has been shown that protein disulfide isomerase (PDI) is a mediator of chemically-induced ferroptosis and also a crucial target for ferroptosis protection. The present study reports that bazedoxifene (BAZ), a selective estrogen receptor modulator, is an inhibitor of PDI and can strongly protect against chemically-induced ferroptosis in neuronal cells. We find that BAZ can directly bind to PDI and inhibit its catalytic activity. Computational modeling analysis reveals that BAZ forms a hydrogen bond with PDI’s His256 residue. Inhibition of PDI by BAZ markedly reduces iNOS and nNOS dimerization and NO accumulation, and these effects of BAZ are associated with reductions in cellular ROS and lipid-ROS and protection against chemically-induced ferroptosis. In addition, the direct antioxidant activity of BAZ may also partially contribute to its protective effect against chemically-induced ferroptosis. In vivo animal experiments have shown that mice treated with BAZ are strongly protected against kainic acid-induced memory deficits and hippocampal neuronal damage. Together, these results demonstrate that BAZ is a potent inhibitor of PDI and can strongly protect against chemically-induced ferroptosis in hippocampal neurons both in vitro and in vivo. This work also provides evidence for an estrogen receptor-independent, PDI-mediated mechanism of neuroprotection by BAZ.

Ferroptosis

Protein disulfide isomerase

Selective estrogen receptor modulator

Bazedoxifene

Nitric oxide synthase

Nitric oxide

Reactive oxygen species

Ferroptosis is an iron- and lipid peroxidation-dependent form of regulated cell death. Recent evidence has shown that protein disulfide isomerase (PDI) is an important mediator of chemically-induced ferroptosis and also a new target for ferroptosis protection. We find that bazedoxifene is an inhibitor of PDI, which can strongly protect against chemically-induced ferroptotic neuronal death in vitro and in vivo. Additionally, the molecular mechanism of PDI‒bazedoxifene binding interaction is defined. This work provides evidence for an estrogen receptor-independent, PDI-mediated mechanism of neuroprotection by bazedoxifene.

Ferroptosis is a form of regulated cell death closely associated with glutathione (GSH) depletion and/or reduction in glutathione peroxidase 4 (GPX4) activity, both of which can lead to accumulation of lipid reactive oxygen species (ROS), and ultimately an iron-dependent oxidative cell death (1–7). There is considerable amount of evidence revealing that ferroptosis is an important contributor in many forms of ischemic organ injuries (e.g., ischemic heart disease, kidney failure, and liver damage) (8–10) and in chemically-induced organ injuries (e.g., acetaminophen-induced liver and kidney damage) (11, 12). Studies have shown that pharmacological inhibition of ferroptosis significantly reduced ischemia/reperfusion-associated organ damage (13, 14) and chemically-induced liver injury (12, 15, 16). In addition, mounting evidence is also linking ferroptosis to various neurodegenerative conditions, such as hemorrhagic stroke, Alzheimer’s disease, Parkinson’s disease and Huntington’s disease (17–21). These neurodegenerative conditions often exhibit ferroptosis-related characteristics, such as elevated lipid peroxidation, mitochondrial dysfunction, and reduced level of GPX4 (22–25). A number of ferroptosis inhibitors have been shown to have a protective effect in animal models of neurodegeneration and injury (22, 24, 26). Interestingly, it was recently reported that the spinal cord of human amyotrophic lateral sclerosis exhibits typical features of ferroptosis, and the use of a centrally-active ferroptosis inhibitor (Cu^II-ATSM) is neuroprotective and effectively ameliorates the markers of ferroptosis in a mouse model (26).

Protein disulfide isomerase (PDI or PDIA1) is a prototype of the PDI family proteins, which is a ubiquitous dithiol/disulfide oxidoreductase of the thioredoxin superfamily (27–29). PDI is primarily localized in the endoplasmic reticulum of mammalian cells, although a small fraction of this protein is also found in the nucleus, cytosol, mitochondria, plasma membrane and extracellular space (29). PDI is involved in protein processing by catalyzing the formation of intra- and inter-molecular disulfide bridges in proteins (30). Earlier we have demonstrated that PDI plays an important role in mediating chemically-induced, GSH depletion-associated oxidative cytotoxicity in HT22 cells, an immortalized mouse hippocampal neuronal cell line (31). Mechanistically, we have shown that glutamate- or erastin-induced GSH depletion can lead to activation of PDI, which then mediates ferroptosis by catalyzing NOS dimerization, followed by accumulation of cellular NO, ROS and lipid-ROS, and ultimately oxidative cell death (ferroptosis) (31, 32). Pharmacological inhibition of PDI’s catalytic function or selective PDI knockdown each can effectively abrogate erastin-induced ferroptosis in HT22 cells (31, 32). In addition, our recent study has shown that PDI plays a similar role in mediating erastin-induced, GSH depletion-associated ferroptotic cell death in the estrogen receptor (ER)-negative MDA-MB-231 human breast cancer cells (33, 34). These studies jointly reveal that PDI plays an important role in mediating chemically-induced, GSH depletion-associated ferroptosis, which also highlights PDI as a potential cellular target for protection against ferroptotic cell death.

Bazedoxifene (BAZ), a synthetic selective ER modulator (SERM) (structure shown in Fig. 1), has been approved for use in the U.S. for treatment of osteoporosis in postmenopausal women (35, 36). BAZ is presently also being studied for its anticancer activity in humans, including human breast cancer (37). In addition to its anticancer activity as a monotherapy, BAZ has been shown to enhance the chemotherapeutic efficacy of clinically-used anticancer agents such as paclitaxel, cisplatin, oxaliplatin and palbociclib in multiple neoplasms (38–41). Besides, there have been studies in recent years reporting that some of the synthetic SERMs (including BAZ) have a protective effect in neurons and glial cells against toxic insults (42–44). It has been suggested that the mechanism of the protective action of SERMs may involve activation of the estrogen receptors and the G protein-coupled receptor for estrogens (GRP30), through increased expression of antioxidants and activation of kinase-mediated survival signaling pathways (45). However, the exact mechanism by which BAZ exerts its neuroprotective action is still not clear at present, which is the focus of our present study.

The present study seeks to determine the neuroprotective effect of BAZ against chemically-induced ferroptotic neuronal death using both in vitro and in vivo models, with a focus on determining whether BAZ exerts its neuroprotection through altering PDI function and its downstream pathways. In this study, erastin and RSL3 are used as in-vitro ferroptosis inducers in cultured HT22 mouse hippocampal neuronal cells. Erastin is an inhibitor of the system Xc⁻, which mediates the influx of extracellular cystine (46). Depletion of intracellular cystine leads to reduced cysteine and GSH biosynthesis, and ultimately ferroptotic cell death resulting from GSH depletion (46). In comparison, RSL3 induces ferroptosis by jointly inhibiting GPX4 and thioredoxin reductase 1 (TrxR1) (47, 48), which then results in PDI–NOS activation and accumulation of cellular lipid-ROS (48). For the in-vivo study, kainic acid was used as a ferroptosis inducer in a mouse hippocampal neuronal injury model. It has been reported that the brains of kainic acid-treated mice have reduced levels of GSH, which are accompanied by increased levels of MDA, intracellular superoxide and lipid peroxides, increased PTGS2 expression and decreased GPX expression (49–51). These changes indicate the induction of ferroptotic neuronal death. We find that BAZ can strongly protect against chemically-induced ferroptosis both in vitro and in vivo. Mechanistically, BAZ can bind to PDI and inhibit its enzyme activity, resulting in reduced NOS activation (dimerization) and NO accumulation, ultimately reduced ROS/lipid-ROS accumulation and ferroptotic neuronal death.

Chemicals

BAZ (#HY-A0031) and kainic acid (#HY-N2309) were obtained from MedChemExpress (Monmouth Junction, NJ, USA), and dissolved in pure dimethyl sulfoxide (DMSO) and saline, respectively, to prepare their stock solutions (at 10 mM). Erastin (#S7242) and methyl-(1S,3R)-2-(2-chloroacetyl)-1-(4-methoxycarbonylphenyl)-1,3,4,9-tetrahydropyrido[3,4-b]indole-3-carboxylate (RSL3, #S8155) were purchased from Selleck Chemicals (Houston, TX, USA), and their stock solutions (at 1 mM) were prepared in DMSO. Urea was purchased from Sigma-Aldrich (Waltham, MA, USA), and its stock solution (at 100 mM) was prepared in double distilled water. 2',7'-Dichlorodihydrofluorescein diacetate (DCFH-DA, #S0033S) and 3-amino,4-aminomethyl-2',7'-difluorescein diacetate (DAF-FM-DA, #S0019S) were purchased from Beyotime Biotechnology (Shanghai, China). MitoSOX (#M36008), MitoTracker green (#M7514) and BODIPY-581/591-C11 (#D3861) were obtained from ThermoFisher (Waltham, MA, USA). O58 (#BB-460652) was obtained from BestBio (Shanghai, China).

Cell culture and cell viability assay

The HT22 mouse hippocampal neuronal cells, MDA-MB-231 human breast cancer cells, H9C2 rat myocardium cells and BRL-3A rat liver cells were obtained from the Cell Bank of Chinese Academy of Sciences (Shanghai, China), and were maintained in DMEM supplemented with 10% (v/v) fetal bovine serum (FBS, ThermoFisher, Waltham, MA, USA) and antibiotics (containing 100 U/mL penicillin and 100 µg/mL streptomycin; Sigma-Aldrich). Cells were cultured at 37℃ under 5% CO₂. Cell viability was determined by the MTT assay as described earlier (33). Cells were authenticated by STR profiling and routinely tested for mycoplasma contamination.

Staining of live and dead cells

Live and dead cells in culture were distinguished using the calcein-AM and propidium iodide (PI) double staining method, according to the instructions of the manufacturer (Solarbio, Beijing, China). Briefly, after treatment of HT22 cells with selected chemicals, 1 µM calcein-AM and 2.5 µM PI were added to the culture medium and the cells were cultured for an additional 30 min at 37°C in the dark. Images of the cultured cells were then taken using a Nikon Eclipse Ti-U inverted microscope (Nikon, Tokyo, Japan).

Quantitative real-time polymerase chain reaction (RT-qPCR)

Total RNAs in cells were sequentially extracted with the TRIzol reagent (#15596018; Invitrogen, Waltham, Massachusetts, USA) and chloroform, precipitated with isopropyl alcohol, and then washed with 75% ethanol to dissolve RNAs in the RNase-free sterile water. The cDNAs were synthesized with the Hifair III 1st Strand cDNA Synthesis Kit (#R312, Vazyme Biotech, Nanjing, China). Subsequently, RT-qPCR was performed using PerfectStart Green qPCR SuperMix (#AQ602, TransGen Biotech, Beijing, China) on an Applied Biosystems Quant Studio 3 (ThermoFisher, Waltham, MA, USA). Relative gene expression was calculated using the 2 − ΔΔC_t method, with GAPDH serving as an internal control. All primers (sequences are shown in Table 1) were synthesized by Sangon Biotech (Shanghai, China).

Table 1

Primer sequences used in the RT-qPCR analysis.
Target gene	Forward primer (5’→3’)	Reverse primer (5’→3’)
GPX4 (mouse)	GCCTGGATAAGTACAGGGGTT	CATGCAGATCGACTAGCTGAG
PTSG2 (mouse)	TTCAACACACTCTATCACTGGC	AGAAGCGTTTGCGGTACTCAT
SLC1A5 (mouse)	CATCAACGACTCTGTTGTAGACC	CGCTGGATACAGGATTGCGG
ACSL4 (mouse)	CTCACCATTATATTGCTGCCTGT	TCTCTTTGCCATAGCGTTTTTCT
GAPDH (mouse)	AGGTCGGTGTGAACGGATTTG	TGTAGACCATGTAGTTGAGGTCA

Measurement of cellular NO, ROS and mitochondrial ROS by fluorescence microscopy

Cells were plated in 24-well places at a density of 5 ⨯ 10⁴ per well and treated with drugs or chemicals for selected durations. For fluorescence staining, cells were first washed twice with HBSS and then incubated with DAF-FM-DA (5 µM, for cellular NO), DCFH-DA (5 µM, for cellular ROS), MitoSOX (5 µM, for mitochondrial ROS) or MitoTracker green (5 µM) in 200 µL DMEM (free of phenol red and serum) for 20 min at 37°C. Following three washes with HBSS, fluorescence images were captured using an AXIO fluorescence microscope (Carl Zeiss Corporation, Germany).

Measurement of cellular NO, ROS, lipid-ROS and peroxynitrite by flow cytometry

Cells were seeded in 6-well plates at a density of 15 × 10⁴ cells/well 24 h before treatment with different drugs. Following drug treatment, cells were trypsinized, collected and suspended in phosphate-buffered saline (PBS). Cells were then centrifuged, and the resulting cell pellets were resuspended in DMEM (free of phenol red and serum) containing DAF-FM-DA (5 µM), DCFH-DA (5 µM), BODIPY-581/591-C11 (5 µM) or O58 (1:2000 dilution of the original solution; for detection of peroxynitrite). After a 20-min incubation at 37°C, the cells were washed three times with HBSS to remove any remaining fluorescent dyes. Levels of cellular NO, ROS, lipid-ROS and peroxynitrite were measured using flow cytometry (Beckman Coulter, Brea, CA, USA) and analyzed using the FlowJo software (FlowJo, LLC, Ashland, USA).

Measurement of lipid-ROS by confocal microscopy

Cells were seeded at a density of 10 ⨯ 10⁴ per well on coverslips placed inside the 12-well plates. Twenty-four h later, cells were treated with selected chemicals as indicated. Coverslips were then washed in HBSS and incubated in HBSS containing BODIPY-581/591-C11 (5 µM) for 20 min at 37°C. Coverslips were then mounted on microscope slides for visualization. Cells on the slides were visualized using a LSM-900 confocal laser scanning microscope (LSM 900; Carl Zeiss, Oberkochen, Germany), and images were analyzed with the Zen software (Carl Zeiss).

Immunoblotting assay

Following drug treatment of HT22 cells as indicated, the cells were lysed on ice for 15 min with the RIPA buffer (#P0013B, Beyotime Biotechnology, Shanghai China) containing 1% protease inhibitor cocktail (100⨯; Selleck Chemicals, Houston, TX, USA). After centrifugation for 15 min at 4°C at 13,000 rpm, the supernatants were mixed with 5⨯ SDS sample buffer (Beyotime Biotechnology, Shanghai, China) and the proteins of interest were separated by electrophoresis with SDS-PAGE. For immunoblot analysis of the dimeric and monomeric forms of iNOS and nNOS, protein samples were prepared with a non-reducing sample buffer without heating (52). The primary antibodies against PDI (#3501S) were from Cell Signaling Technology (Beverly, MA, USA), iNOS and nNOS (#ab178945 and #ab76067, respectively) from Abcam (Cambridge, MA, USA), and anti-β-actin (1:5000; #GB12001-100; ServiceBio, Wuhan, China). The anti-rabbit (#7074S) and the anti-mouse HRP-conjugated secondary antibodies (#7076S) from Cell Signaling Technology (Beverly, MA, USA).

Cellular thermal shift assay (CETSA)

CETSA was conducted according to the protocols described earlier (53, 54). Briefly, after the cells were treated with the vehicle or indicated chemicals for 3 h, they were washed with ice-cold PBS, harvested by trypsinization, centrifuged and re-suspended in PBS supplemented with a protease inhibitor cocktail (Selleck Chemicals, Houston, TX, USA). Equal amounts of cell suspensions were aliquoted into 0.2 mL PCR microtubes. Subsequently, aliquots of the cell suspension were heated in a Ristretto Thermal Cycler (VWR, Darmstadt, Germany) at the indicated temperatures for 3 min, followed by cooling for 3 min at room temperature. Finally, the cells were lysed using three cycles of freeze–thawing, and the soluble fractions were isolated by centrifugation and analyzed by SDS-PAGE followed by Western blotting as described above. For isothermal dose-response CETSA (ITDR_CETSA), the fold of change in PDI (which is normalized to the β-actin control) is plotted as a function of temperature to generate the PDI melting curve for selected treatments.

Protein expression and purification

The mutant PDI-Ala256 protein was prepared from the full-length wild-type human PDI-His256 cDNA using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). For protein purification, PCR products of the wild-type PDI-His256 and the mutant PDI-Ala256 were subcloned into pET28a, and the proteins were expressed in the E. coli strain JM109 (DE3) cultured in Luria-Bertani (LB) medium. After the bacteria were cultured at 37°C to reach an OD value of approximately 0.8, then 1 mM isopropyl-β-D-1-thiogalactopyranoside (IPTG) was added into LB medium, and the bacteria were further cultured at 22°C for 8 h. The bacteria were harvested by centrifugation at 5000 × g for 30 min at 4°C, and lysed in the presence of a protease inhibitor cocktail. The supernatant was isolated by centrifugation at 20,000 × g for 30 min and then incubated with Ni-NTA agarose (QIAGEN) at 4°C for 1 h. The columns were washed and eluted with 20 mM imidazole. The proteins were concentrated and analyzed by SDS-PAGE.

Assay of PDI catalytic activity and its inhibition by BAZ

The effect of BAZ on the catalytic activity of purified wild-type PDI-His256 and mutant PDI-Ala256 was determined by analyzing PDI-mediated aggregation of the insulin B chain as described earlier with some modifications (55, 56). Briefly, insulin (125 µM) was incubated in a 96-well plate in 10 mM sodium phosphate buffer (pH 7.4) and 5 mM DTT with or without the recombinant wild-type PDI-His256 or mutant PDI-Ala256 (at approximately 0.2 µg/µL). The aggregation was monitored at 37°C using a Synergy Plate Reader (Biotek, Winooski, VT, USA), with the wavelength set at 650 nm.

Molecular docking analysis

The PDI‒ligand interaction was analyzed using the molecular docking method. The structures of human PDI (PDB code 6I7S; chain A) (57) and BAZ (extracted from the ER‒BAZ complex; PDB code 6PSJ, ligand ID 29S) (58) were downloaded from the Protein Data Bank (https://www.rcsb.org/) (59) and adopted as the receptor and ligand, respectively.

The structures were processed using the Protein Preparation Wizard in Schrodinger Suite (Maestro 12.8, 2021; Schrodinger LLC, New York, NY, USA). The hydrogen atoms were added, and the protein structures were optimized using OPLS4 force field (60). The protein‒ligand docking decoys were generated using Glide-XP (extra precision) in Schrodinger Glide software (61). The nearby torsional minima of the lowest energy binding poses were sampled using Monte Carlo (MC) procedure. The Cα atom of His256 in the b’ domain of PDI was used as the center of the docking grid box with dimensions set at 30 × 30 × 30 Å³.

Lastly, three representative scoring functions, X-Score (62), PRODIGY-LIG (63) and Δ_vinaRF₂₀ (64) were employed for further filtering of the docking results. The two linear empirical scoring functions, i.e., X-Score (62) and PRODIGY-LIG (63), were developed for calculating protein‒ligand binding affinity. The former employs energy and geometric terms such as van der Waals energy, hydrogen bonding energy, deformation penalty and hydrophobic effect (62), and the latter uses the number of atomic contacts and electrostatic energy (63). Δ_vinaRF₂₀ is a random forest-based method for binding affinity prediction based on 20 descriptors (64).

To investigate the importance of His256 in the interactions between PDI and BAZ, His256 was mutated to alanine (Ala) in the representative predicted structures of the PDI‒BAZ complex. The binding energies were predicted using X-Score (62), PRODIGY-LIG (63) and Δ_vinaRF₂₀ (64).

Molecular dynamics simulations

The stability of the binding poses of BAZ in the predicted structures of PDI‒BAZ complex was investigated using molecular dynamics (MD) simulations. The complexes were processed using CHARMM-GUI (https://charmm-gui.org/) to generate the topology files (65). The force field parameters of BAZ were generated based on CHARMM general force field (66), those of protein were generated based on CHARMM36m force field (67). The systems were embedded into a rectangular water box extending the solvent 10 Å in x, y, z directions, and the TIP3P water model (68) was used. K⁺ and Cl^– ions with parameters approximated by Roux et al. (69) were added to neutralize the charges of the systems. The energy minimization (10000 steps), equilibrium simulation (0.25 ns) in NVT ensemble and production simulation (100 ns) in NPT ensemble were carried out using NAMD (70). The time step and temperature were set to 2 fs and maintained at 300 K using Langevin dynamics (71), respectively. The periodic boundary conditions were employed, the short-range electrostatic and van der Waals interactions were truncated smoothly with a cutoff (12 Å) and a switching function was employed at 10 Å. Long-range electrostatic interaction was estimated by the particle mesh Ewald algorithm (72, 73). The pressure in NPT ensemble was maintained at 1 atm by the Langevin piston method (74). The number of hydrogen bonds formed between BAZ and PDI and the contact number and binding energies between BAZ and PDI in the representative conformations along the MD trajectories were calculated to confirm the importance of His256 and the stability of the predicted binding poses.

In vivo animal experiments and drug treatments

The procedures involving the use of live animals described in this study were approved by the Institutional Animal Care and Use Committee (IACUC) of The Chinese University of Hong Kong (Shenzhen), and the guidelines for humane care of animals set forth by the U.S. National Institutes of Health were followed. Male mice (6‒8 weeks of age), weighing 20‒30 g, were purchased from Guangdong Charles River Laboratories (Beijing, China). After arrival, the animals were allowed to acclimatize to the new environment for one week before they were used in experimentation. Mice were randomly divided into different experimental groups (n = 6–8) with comparable average body weights. Male mice were used in this study because female mice normally produce and secrete large amounts of endogenous estrogens in a cyclic fashion (depending on their estrous cycle), and our earlier study has shown that the endogenous estrogens and some of their derivatives have a protective effect against neuronal cell death (75). Therefore, the use of male mice would help minimize this endogenous confounding factor.

Kainic acid (3 µL of 0.2 mM solution in saline) was injected into the left and right lateral ventricles using a microliter syringe under anesthesia with Zoletil50 and xylazine (50 and 5 mg/kg, i.p.), and the control mice were injected with 3 µL of vehicle (saline) without kainic acid [64]. The bilateral intracerebroventricular (i.c.v.) injection parameters were: anterior/posterior, ‒0.5; rostral, ± 1.1; and dorsal/ventral, 2.7. The animals were also given i.p. injection of a solution (100 µL) containing 0.375, 0.75 or 1.25 mg/mL of BAZ (the solvent is 10% DMSO + 90% corn oil) once every 2 days. The three BAZ doses approximately equal to 1.5, 3 or 5 mg/kg of body weight. The first dose of BAZ was given 24 h before i.c.v. injection of kainic acid, and the treatment lasted for 11 days. Note that in this study, the control animals were sham-operated (receiving i.c.v. injection of 3 µL saline solution) and also received i.p. injections of 100 µL vehicle (containing 10% DMSO and corn oil). For kainic acid alone group, the animals received i.p. injections of 100 µL vehicle (10% DMSO and corn oil); for the BAZ alone group, the animals were sham-operated (receiving i.c.v. injection of 3 µL saline solution).

Memory and learning ability tests

The first test used in this study was the classical Y-maze-based method which was intended to determine the degree of memory impairments in mice following different treatments (76, 77). The test started 6 days after i.c.v. injection of kainic acid. The Y-maze (made of polyvinyl plastic) was a three-arm maze with equal angles between the three arms (30 cm in length, 5 cm in width, and 15 cm in wall height). As depicted in Fig. 11B, the test animals were initially placed at the end of one arm, and the sequence and number of arm entries were recorded manually. Based on earlier studies (76, 77), the percentage of trials with all three arms represented, i.e., ABC, CAB or BCA (but not ABA, BAB or CBC), was recorded as an alternation for estimation of the short-term memory. Arms were cleaned between tests with 70% ethanol-containing paper towels to remove odors and residues. The alternation score (%) for each mouse is defined as the ratio of the actual number of alternations to the possible number (defined as the total number of arm entries minus two) multiplied by 100 as in the following Eq. (78):

% alternation = [(number of alternations) / (total arm entries − 2)] × 100

In this study, a new Y-maze-based test was also developed in our laboratory to further evaluate the learning ability and the degree of memory impairments of the same animals. In this method, all tests started from day 10 post i.c.v. injection of kainic acid (see Fig. 11A), and all mice, including the control mice, were food restricted starting 24 h before the test, receiving on average 2‒3 g pellet food only. As depicted in Fig. 11B, in one of the arms the animal food was placed as a bait. The animal was placed in the starting arm, and then it was allowed to freely explore the Y-maze to find the food (which was placed at the end of another arm) and ate it. Then, the animal was placed back at the same starting place and the observation was repeated again. If the animal went straight to where the food was originally placed and ate the food, it was considered that the animal remembered correctly where the food was. In order to evaluate how well the learning ability and memory of each animal, the number of wrong entries the animal made during the initial 20 trials (10 trials per day, in two consecutive days) and the amount of time the animal took to find and start to eat the food in every trial were recorded. To minimize the random variations in each individual trial, the first three consecutive trials (i.e., trials 1‒3) were combined to calculate the average value as the first recording, the next three consecutive trials (i.e., trails 4‒6) were combined to calculate the average value for the second recoding, and the same method was applied to calculate other recording values. The last two trials (i.e., trials 19 and 20) were combined to calculate the average value for the last recording.

Histochemical and fluorescence staining of the brain sections

To perform histochemical and fluorescence staining of the brain sections to determine the degree of brain damage in different treatment groups, separate groups of animals were sacrificed on day 6 post i.c.v. injection of kainic acid. Prior to collecting the brain tissues from the animals for analysis, the animals received ketamine and xylazine (50 and 5 mg/kg, i.p.) for anesthesia, and then they were perfused with physiological saline (0.9% NaCl) and 4% paraformaldehyde via the abdominal aorta. The collected brain tissues were fixed overnight in 4% paraformaldehyde. After cryoprotection in 30% sucrose/phosphate buffer, the whole brain tissues were frozen in liquid nitrogen and sectioned serially (in 30-µm thickness). Brain sections were collected in 0.1 M neutral phosphate buffer, mounted on slides, then air-dried on a slide warmer at 50°C for at least 0.5 h, and stained with hematoxylin and eosin (H/E) for histological analysis. Three brain hippocampal regions (CA1, CA3 and the dentate gyrus DG) were examined bilaterally as described earlier (75).

The apoptotic DNA degradation in brain tissue slides was determined using the terminal deoxynucleotidyl transferase (TdT)-mediated dUDP-biotin nick end labeling (TUNEL) method according to supplier’s instructions (Biosharp, China). The Fluoro-Jade B staining was performed according to supplier’s instructions (Biosensis, Australia). Briefly, the slides were transferred to a solution of 0.06% potassium permanganate for 10 min on a shaker. The Fluoro-Jade B staining solution was prepared from the 0.1-mg/mL stock solution (in distilled water). After 10 min in the staining solution, the slides were rinsed and placed on a slide warmer until they were dry. Images were captured with a light microscope (Carl Zeiss Corporation, Germany) and cell counting was performed using the ImageJ software.

Statistical analysis

Most of the experiments described in this study were repeated three times or more to confirm the observations. Data presented in this study are the mean ± S.D. from multiple replicate measurements taken from one representative experiment. Statistical analyses were performed using the GraphPad Prism 7.0 software (GraphPad Software, La Jolla, CA) by using one-way ANOVA coupled with follow-up tests for multiple comparisons. Statistical significance was denoted by P < 0.05 (* or ^#) and P < 0.01 (** or ^##) for significant and very significant differences, respectively. In most cases, * and ** denote the comparison for statistical significance between the control group (cells treated with the vehicle only) and the cells treated with a cell death inducer (such as erastin or RSL3), whereas ^# and ^## denote the comparison between the cells treated with the cell death inducer alone and the cells jointly treated with the cell death inducer plus a modulating compound (such as BAZ).

BAZ prevents erastin-induced ferroptosis and NO/ROS accumulation

Protection against ferrotosis. Based on changes in gross morphology and cell viability (MTT assay), treatment of HT22 mouse hippocampal neuronal cells with erastin readily induced cell death in a dose-dependent manner (Fig. 2A). Joint treatment of these cells with BAZ (at concentrations ranging from 125 to 2000 nM) abrogated erastin-induced cell death in a concentration-dependent manner (Fig. 2B). The protective efficacy of BAZ was very high as 100% protection was readily observed when 500 nM BAZ was present (Fig. 2B). Further analysis showed that BAZ effectively attenuated cell death when the live and dead cells were analyzed using calcein AM/PI double staining (Fig. 2C).

We have also determined, for comparison, the protective effect of BAZ against erastin-induced cell death in three additional cell lines, i.e., the ER-negative MDA-MB-231 human breast cancer cells, the BRL-3A rat liver cells and the H9C2 rat myocardium cells. We found that BAZ exerted a complete cytoprotection against erastin-induced cell death in these cells (Supplementary Fig. S1A‒S1C).

In this study, RT-qPCR analysis of the mRNA levels of representative key ferroptosis markers was performed in HT22 cells treated with erastin ± BAZ, and it was observed that while erastin exposure reduced the mRNA levels of GPX4 (Fig. 2D) and SLC1A5 (Fig. 2F), it increased the mRNA levels of PTGS2 (Fig. 2E) and ACSL4 (Fig. 2G). These changes are characteristic for erastin-induced ferroptotic cell death. Joint treatment of cells with BAZ abrogated erastin-induced changes in three of the ferroptosis markers (GPX4, PTGS2 and ACSL4) (Fig. 2D, 2E, 2G), whereas the change in SLC1A5 mRNA level was not significant (Fig. 2F).

Effect on NO and ROS accumulation. Our recent studies showed that erastin-induced cell death in HT22 cells is associated with sequential accumulation of cellular NO, ROS and lipid-ROS (32). By using fluorescence microscopy and flow cytometry analyses, we confirmed that erastin caused accumulation of cellular NO (DAF-FM-DA as a probe) in a time-dependent manner in HT22 cells (Supplementary Fig. S2A‒S2C), and NO accumulation in erastin-treated cells was abrogated by joint treatment of these cells with 1 µM BAZ (Fig. 2H, Supplementary Fig. S2D, S2E).

ONOO⁻ is a reactive toxic metabolite of NO formed in the cells. In this study, we also determined the change in cellular ONOO⁻ level (O58 as a probe) in erastin-treated cells. We found that erastin exposure caused a time-dependent increase in cellular ONOO⁻ level (Supplementary Fig. S5A), and this accumulation was strongly abrogated by joint treatment with BAZ (Supplementary Fig. S5B). Similarly, urea, a scavenger of ONOO⁻, partially abrogated erastin-induced ONOO⁻ buildup (Supplementary Fig. S5D), however, urea did not exhibit any cytoprotective effect against erastin-induced cytotoxicity (Supplementary Fig. S5C).

Erastin also caused accumulation of cellular ROS (DCFH-DA as a probe) and lipid-ROS (C11-BODIPY as a probe) in a time-dependent manner (Supplementary Fig. S3A, S3B, S3E), and their accumulation was effectively abrogated by BAZ (Fig. 2I, Supplementary Fig. S3C, S3D; Fig. 2J, 2K, Supplementary Fig. S4A). In addition, erastin-induced accumulation of mitochondrial ROS (MitoSOX as a probe) was also similarly reduced by treatment with BAZ (Fig. 2L).

In summary, these results indicate that BAZ has a strong protective effect against erastin-induced ferroptosis in HT22 neuronal cells. In addition, BAZ has the ability to broadly attenuate cellular NO, ROS, lipid-ROS and mitochondrial ROS levels in erastin-treated HT22 cells.

BAZ protects against RSL3-induced ferroptosis and NO/ROS accumulation

Protection against ferrotosis. We have also determined in this study the protective effect of BAZ against RSL3-induced ferroptotic cell death. While treatment of cells with RSL3 alone elicited a dose-dependent loss of cell viability (Fig. 3A), a strong protection against RSL3-induced cell death was observed when the cells were jointly treated with BAZ (Fig. 3B), and 100% protection was seen when 125 nM BAZ was present. It is evident that the protective effect of BAZ against RSL3-induced cell death has a higher potency than its protection against erastin-induced ferroptosis. Additional experiments using calcein AM/PI double staining confirmed that BAZ effectively attenuated RSL3-induced cell death (Fig. 3C).

Similar to the observations made with erastin, a strong protection against RSL3-induced cell death was observed when the MDA-MB-231 cells, H9C2 cells and BRL-3A cells were jointly treated with BAZ (Supplementary Fig. S1D‒S1F).

In addition, it was observed that RSL3 decreased the mRNA levels for GPX4 (Fig. 3D) and SLC1A5 (Fig. 3F) but increased the mRNA levels of PTGS2 (Fig. 3E) and ACSL4 (Fig. 3G) in HT22 cells. Joint treatment with BAZ abrogated RSL3-induced changes in these mRNA levels (Fig. 3D‒3G).

Effect on NO and ROS accumulation. We also determined the effect of BAZ on RSL3-induced accumulation of cellular NO, ROS/lipid-ROS and mitochondrial ROS. We found that RSL3 caused accumulation of cellular NO in a time-dependent manner (Supplementary Fig. S6A‒S6C), and the presence of 1 µM BAZ effectively abrogated RSL3-induced NO accumulation (Fig. 3H, Supplementary Fig. S6D, S6E). Treatment of HT22 cells with RSL3 also caused accumulation of cellular ROS and lipid-ROS in a time-dependent manner (Supplementary Fig. S7A, S7B, S7E). RSL3-induced cellular ROS and lipid-ROS accumulation was similarly abrogated by BAZ (Fig. 3I, Supplementary Fig. S7C, S7D; Fig. 3J, 3K, Supplementary Fig. S8A). In addition, RSL3-induced accumulation of mitochondrial ROS was also abrogated by BAZ (Fig. 3L). Additionally, ONOO⁻ (O58 as a probe) was also increased in RSL3-treated cells in a time-dependent manner (Supplementary Fig. S9A), and its buildup was effectively abrogated by joint treatment with BAZ (Supplementary Fig. S9B). Urea also exhibited a weak effect in reducing RSL3-induced ONOO⁻ buildup (Supplementary Fig. S9D) but it did not have any cytoprotective effect (Supplementary Fig. S9C).

In summary, these results indicate that BAZ has a super-strong protective effect against RSL3-induced ferroptosis in HT22 cells through attenuation of the accumulation of cellular NO, ROS, lipid-ROS and mitochondrial ROS.

BAZ binds directly to PDI

The above observations prompted us to identify the cellular target that mediates the cytoprotective effect of BAZ. Our recent studies have shown that PDI is an important cellular protein that mediates chemically-induced, GSH depletion-associated oxidative cell death (31). Next we sought to determine whether PDI is a cellular protein that mediates the protective effect of BAZ against chemically-induced ferroptosis in HT22 cells. As summarized below, a number of experiments were performed.

We first determined the binding affinity of BAZ with PDI using the surface plasmon resonance assay, and found that BAZ could bind to PDI with a very high binding affinity (K_d = 3.3 nM based on curve fitting and 3.6 nM based on Scatchard plot) (Fig. 4A, 4B).

Next, we performed the cellular thermal shift assay (CETSA) to evaluate the binding affinity between BAZ and PDI in live HT22 cells. Based on Western blot analysis of PDI protein stability, a thermal shift associated with PDI protein was observed in BAZ-treated HT22 cells compared to the control cells (Fig. 4C). A change in the Tm₅₀ values (the temperature at which 50% of the proteins are precipitated by thermal denaturation) was determined to reflect the direct binding interaction of PDI protein with BAZ in cultured live cells. PDI had a Tm₅₀ value of 56.5°C in control cells (in the absence of BAZ), but the presence of BAZ increased its Tm₅₀ to 60°C, resulting in an increase in the Tm₅₀ value (i.e., ΔTm₅₀) by 3.5°C (Fig. 4E).

To provide further support for the above experimental observations, the isothermal dose-response CETSA (ITDR_CETSA) was also performed. The isothermal stability of PDI treated with different doses of BAZ at 59°C showed that PDI protein in live HT22 cells was stabilized by the presence of BAZ in a concentration-dependent manner (Fig. 4D). The CETSA curve nearly reached the plateau when 32 µM concentration of BAZ was present (Fig. 4F). Together, these experimental results show that BAZ can bind to PDI protein in live HT22 cells.

In this study, computational analyses were used to help understand the experimental observations on the PDI‒BAZ binding interactions. Based on computational docking analysis, 7 representative predicted structures of PDI‒BAZ complexes are shown in Fig. 5A and Supplementary Fig. S10A − S15A. BAZ interacts closely with PDI’s b’ domain and forms a hydrogen bond with His256 (Fig. 5B, Supplementary Fig. S10B − S15B). When PDI’s His256 is mutated to Ala256, the hydrogen bond formed between BAZ and His256 disappears (Fig. 5D, Supplementary Fig. S10D − S15D). The surfaces of the binding pockets are shown in Fig. 5C and 5E (Supplementary Fig. S10C − S15C, S10E − S15E). The difference in the binding pockets of the wild-type and mutant PDI proteins is mostly in the region surrounding His256 which is mutated from a basic amino acid to a nonpolar amino acid (Ala256). The predicted binding affinities based on the 7 representative structures are summarized in Table 2. The binding energy values are increased after the His→Ala mutation, indicating that the stability of the interaction between PDI and BAZ is decreased by the mutation.

Table 2

Predicted binding affinities based on the seven representative predicted structures of wild-type PDI‒BAZ complexes or the Ala256 mutant PDI‒BAZ complexes.
PDI‒BAZ complex #	Number of hydrogen bonds between BAZ and PDI proteins		Number of hydrogen bond between BAZ and His256		X-Score (Kcal/mol)		PRODIDY-LIG (Kcal/mol)		Δ_vinaRF₂₀
PDI‒BAZ complex #	PDI-His256	PDI-Ala256	PDI-His256	PDI-Ala256	PDI-His256	PDI-Ala256	PDI-His256	PDI-Ala256	PDI-His256	PDI-Ala256
1	3	2	1	0	−9.44	−9.22	−8.93	−8.69	6.51	6.28
2	2	1	1	0	−9.57	−9.41	−9.11	−8.84	5.74	5.52
3	2	1	1	0	−9.34	−9.15	−9.24	−9.04	5.54	5.35
4	2	1	1	0	−9.63	−9.38	−8.91	−8.66	6.12	5.85
5	3	2	1	0	−9.49	−9.28	−8.96	−8.72	5.85	5.63
6	1	0	1	0	−9.42	−9.25	−9.01	−8.75	5.82	5.6
7	1	0	1	0	−9.26	−9.14	−8.96	−8.75	6.04	5.84

Next, MD simulation was performed to probe how tightly BAZ binds to the wild-type and mutant PDI proteins. In the case of wild-type PDI-His256, it is observed that BAZ still remains bound to PDI-His256 in two of the three MD simulations (Fig. 6A, 6B), but BAZ dissociates from PDI-His256 in one of the MD simulations (Fig. 6C). In comparison, for the mutant PDI-Ala256, BAZ dissociates from PDI-Ala256 in all three MD simulation trajectories (Fig. 6G, 6H, 6I).

It is of interest to note that after MD simulation, the conformation of the wild-type PDI-His256 is changed from its initial open state (as shown in Fig. 5A) to a closed state (Fig. 6A) or partially-closed state (Fig. 6B). Similar observations are also made with the mutant PDI-Ala256, which is changed from its initial open state to the closed-state (Fig. 6H) to the partially-closed states (Fig. 6G, 6I).

After MD simulation, the aromatic ring of BAZ remains buried inside the binding pocket of the wild-type PDI-His256, whereas the other part of the BAZ molecule is rotated (Fig. 5B, 5C, Fig. 6D, 6E). The contact number between BAZ and PDI-His256 (atom pairs within a given cutoff of 5 Å) was shown in Supplementary Fig. S16A. The contact number in the wild-type PDI-His256‒BAZ complex (Supplementary Fig. S16A) along two of the three MD trajectories fluctuates around 800 during the simulation process, and the number of contacts in the mutant PDI-Ala256‒BAZ complex along two of the three MD trajectories nearly goes down to zero after 40-ns MD simulation. While the minimum distance between BAZ and PDI-Ala256 becomes very long in the mutant PDI‒BAZ complex in all three MD simulation trajectories, the distance between BAZ and PDI-His256 remains very close in two of the MD simulation trajectories (Supplementary Fig. S17A).

At the end of the 100-ns MD simulation (three trajectories), the hydrogen bond between BAZ and the wild-type PDI-His256 still exists in one complex (trajectory-2; Fig. 6E), and this hydrogen bond exists for a cumulative duration of 43.1 ns (Supplementary Fig. S17B). In another PDI-His256‒BAZ complex (Fig. 6D), BAZ moves slightly away from His256 at the end of MD simulation (trajectory-1), and the hydrogen bond exists for a cumulative duration of 18.5 ns (Supplementary Fig. S17B). In the third complex shown in Fig. 6F, BAZ moves away from the wild-type PDI-His256 from the start, and no hydrogen bond is formed (trajectory-3; Supplementary Fig. S17B). In contrast, for the three mutant PDI-Ala256‒BAZ complexes, no hydrogen bond is found during the 100-ns MD simulation.

It is observed that during MD simulations, the binding energies of the representative conformations of the wild-type PDI-His256‒BAZ complexes are generally lower than those of the mutant PDI-Ala256‒BAZ complexes, especially after 30-ns MD simulation (Supplementary Fig. S16B‒S16D). The results are in line with the binding energy results for the seven representative PDI‒BAZ complexes (docking structures) for both wild-type and mutant PDI (Table 2). Together, these results illustrate the relative importance of PDI’s His256 in its binding interaction with BAZ from both geometric and energy point of views.

BAZ inhibits PDI’s catalytic activity

Results from our recent study (33) showed that the disulfide isomerase activity of PDI (which catalyzes the formation of disulfide bonds in target proteins in cells) plays a role in mediating erastin-induced ferroptosis. Next, we sought to determine whether BAZ can directly inhibit PDI’s catalytic activity by using the in-vitro insulin aggregation assay. Insulin has two chains cross-linked together by disulfide bonds, and PDI can break these disulfide bonds to facilitate the formation of aggregates, which has been commonly used to reflect PDI’s catalytic activity (55). We found that the PDI’s catalytic activity in vitro was suppressed by the presence of BAZ in a dose-dependent manner (Fig. 7A).

Our computational analysis with both wild-type PDI-His256 and mutant PDI-Ala256 has suggested that PDI’s His256 is important for the binding interaction between PDI-His256 and BAZ. To provide experimental support for the predictions based on computational analysis, next we chose to compare the ability of BAZ to inhibit the catalytic activity of the wild-type PDI-His256 and mutant PDI-Ala256. As shown in Fig. 7A and 7B, while the mutant PDI-Ala256 appeared to have a slightly-reduced catalytic velocity (i.e., it took longer to catalyze the same reaction), its catalytic ability to complete the same maximal level of reaction (i.e., in producing the same maximal level of insulin aggregation) was not changed. Notably, the presence of BAZ no longer showed a meaningful inhibition of PDI-Ala256’s catalytic activity in mediating the aggregation of insulin. This result indicates that BAZ cannot effectively bind to the mutant PDI-Ala256 to exert the same degree of inhibition of PDI-Ala256’s catalytic activity as it does with the wild-type PDI-His256 protein. Together, these results from the in-vitro enzymatic assay demonstrate that BAZ can directly bind to the wild-type human PDI-His256 and inhibit its catalytic activity but it cannot bind and inhibit the mutant PDI-Ala256.

PDI inhibition mediates BAZ’s protection against chemically-induced ferroptosis

Next, we sought to determine whether BAZ can effectively inhibit erastin/RSL3-induced NOS dimerization and accumulation of NO and ROS in HT22 cells through inhibition of PDI. Treatment of HT22 cells with BAZ abrogated erastin-induced increase in total NOS (iNOS and nNOS) proteins and NOS (iNOS and nNOS) dimer levels (Fig. 8A, 8C). In comparison, the PDI protein levels were not significantly altered by joint treatment with BAZ (Fig. 8E).

Similarly, joint treatment of HT22 cells with BAZ similarly abrogated RSL3-induced increase in total NOS (iNOS and nNOS) protein and NOS (iNOS and nNOS) dimer levels (Fig. 8B, 8D), and the PDI protein levels were not significantly affected by the joint treatment (Fig. 8F).

BAZ protects against kainic acid-induced memory deficit and hippocampal neuronal damage in mice

To determine whether BAZ has neuroprotective effects in vivo, we used the kainic acid-induced neuronal damage in the hippocampal regions of mice as an in vivo model, and the classical Y-maze test was used to evaluate the working memory in these animals. The basic assumption of the classical Y-maze test is that when an animal reaches the center of the maze and is faced with the choice of two new arms, it would tend to explore the arm which has not been explored right before (Fig. 9B). Based on this assumption, the theoretical alternation rate is thought to be 100% for a normal healthy mouse. However, we found that under real experimental conditions, the real alternation rate of the control mice (receiving saline vehicle injections only) was only 71.0 ± 2.6% (Fig. 9C), and this value is largely in agreement with some of the reported values (about 70%) in earlier studies (76, 78, 79). The alternation rate in kainic acid-injected mice was found to be around 50%. This value is as expected since the kainic acid-injected mice would have damaged hippocampus and impaired working memory and thus could not remember as well which arm it had already explored right before, and consequently, it would be more likely to make a random choice when faced with two options. The alternation rates of kainic acid-injected mice jointly treated with 3 and 5 mg/kg BAZ were 65.5 ± 1.8% (P < 0.01) and 64.1 ± 1.7% (P < 0.01), respectively, which were significantly higher than the corresponding rates in animals injected with kainic acid alone. However, in animals treated with the lowest dose (1.5 mg/kg) of BAZ, the animals had a slightly-improved alternation rate compared with kainic acid-injected animals (51.0 ± 3.2% vs 55.5 ± 2.4%; P = 0.026%) (Fig. 9C).

In the present study, a new Y-maze-based behavioral test was designed which enabled us to conduct additional assessment of the protective effect of BAZ on the learning and memory functions using the same kainic acid-injected mice. The procedures of this new behavioral test is described in detail in the methods section, and the data are summarized in Fig. 9D, 9E. As shown in Fig. 9B, the food was placed in one arm of the Y-maze and the mouse was placed at the end of another arm (i.e., the starting arm). Then the animal was allowed to freely explore the maze and would find the food and eat it. It was observed that nearly all the mice in the control group could correctly remember which arm contained food starting from the 7th to 9th trials and onward; in comparison, the kainic acid-injected animals took significantly more trials to correctly remember which arm contained food. Compared to the animals injected with kainic acid alone, those animals jointly treated with 3 mg/kg BAZ and kainic acid had a markedly improved memory, with close to 80% correctness between 7th ‒9th trials and and > 80% correctness thereafter (Fig. 9D).

For comparison, the overall time required for each animal to find the food and start eating it was also recorded in this behavioral test (Fig. 9E). It was observed that with increased number of trials, all mice in different experimental groups progressively improved their time, and eventually reached a similar plateau. This observation indicates that the animals in all treatment groups can gradually learn to perform this relatively simple task (i.e., remembering the correct arm where the food is). However, in the first five trials, the differences among the four groups of animals were quite obvious, and there was a clear difference between the control group and kainic acid-injected group. In animals jointly treated with kainic acid + 1.5 or 3 mg/kg BAZ, the animals took significantly less time than animals injected with kainic acid alone, indicating that joint treatment with BAZ effectively improves the memory function of kainic acid-treated mice (Fig. 9E).

In this study, histological analysis of the representative hippocampal CA3 region of mice at 6 d post kainic acid injection was also analyzed to evaluate the neuroprotective effect of 3 mg/kg BAZ in vivo. Kainic acid-injected animals showed a drastic neuronal loss in the hippocampus, but joint treatment with 3 mg/kg BAZ for 7 d afforded almost complete neuroprotection in this brain region. The extent of neurodegeneration in the CA3 region was assessed using different methods (H/E, Fluoro-Jade B, and TUNEL staining) (Fig. 10A–10C). In H/E staining, kainic acid injection caused a strong loss of neuronal nuclei in the CA3 region, while this region in animals jointly treated with 3 mg/kg BAZ was strongly protected against kainic acid-induced neuronal death, almost making it not too different morphologically from the vehicle-treated control animals (Fig. 10A). This observation indicates that BAZ has a strong protective effect against kainic acid-induced oxidative neuronal loss in vivo. The observation made with the H/E-stained brain histology slides was also consistent with the slides stained with the Fluoro-Jade B and TUNEL assay kit. Fluoro-Jade B is an anionic fluorochrome capable of selectively staining degenerating neurons in brain slices (80). In the CA3 region in kainic acid-injected animals, it was found that a majority of neurons were strongly stained with Fluoro-Jade B (124.3 ± 17.5), whereas animals jointly treated with 3 mg/kg BAZ and kainic acid had a markedly reduced number of neurons in this region stained with Fluoro-Jade B (32.3 ± 8.7, P < 0.01) (Fig. 10B). Similarly, TUNEL assay selectively detects damaged cells that undergo extensive DNA degradation. Strong TUNEL signals in the kainic acid-injected group with mean fluorescence intensity of 69.2 ± 7.2 were detected, but the group jointly treated with BAZ had a markedly-reduced fluorescence intensity (35.9 ± 4.1, P < 0.01) (Fig. 10C). Together, these results demonstrate that joint treatment with BAZ offered a strong protection against kainic acid-induced neuronal death in a mouse model.

In summary, functional studies showed that mice treated with kainic acid alone have an impaired working memory compared to the control animals, but the impaired memory function is protected in a dose-dependent manner when the animals are jointly treated with BAZ. Histochemical analyses confirm that BAZ protects the hippocampal neurons of mice against kainic acid-induced neuronal injury.

A number of natural compounds have recently been reported to have a neuroprotective effect against ferroptosis-associated neuronal injury, displaying different mechanisms of protection (81–83). For instance, sterubin and fisetin, two neuroprotective flavonoids, exhibit anti-oxytosis/ferroptosis activity by improving mitochondrial health and bioenergetic efficiency in HT22 neuronal cells (81). On the other hand, chrysin (another flavonoid) exhibits strong neuroprotection against cerebral ischemia/reperfusion injury (82) through restraining HIF-1α nuclear translocation, thereby inhibiting CP transcription and translation (82). Clausenamide is a natural compound which was recently reported to have a protective effect in dopaminergic neurons both in-vivo and in-vitro by targeting arachidonate 5-lipoxygenase and reducing lipid-ROS accumulation (84). Similar protective effect of clausenamide was also confirmed in erastin- or acetaminophen-induced hepatocyte ferroptosis in vitro and in vivo through reduction of lipid-ROS accumulation (83).

In this study, we demonstrate that BAZ exerts a strong protective effect against chemically-induced ferroptosis in hippocampal neurons both in vitro and in vivo. Using the HT22 mouse hippocampal neuronal cells as an in vitro model, we show that treatment of these cells with erastin or RSL3 can readily induce cell death in a dose-dependent manner, and joint treatment of these cells with BAZ (at 62.5‒1000 nM) can strongly protect the cells against erastin/RSL3-induced cell death in a concentration-dependent manner. The protective efficacy of BAZ is very high, i.e., 100% protection against erastin-induced ferroptosis is observed when 500 nM BAZ is present, and similarly, 100% protection against RSL3-induced ferroptosis is observed when 125 nM BAZ is present. It is clear that the protective effect of BAZ against RSL3-induced cell death has a higher potency than its protection against erastin-induced ferroptosis.

We also show that BAZ can effectively protect against kainic acid-induced memory deficit and hippocampal neuronal damage in male mice. Joint treatment of mice with 1.5, 3 and 5 mg/kg BAZ significantly improves the memory and learning performance. Histochemical analysis of the representative hippocampal CA3 region of mice 6 d post kainic acid injection shows a drastic neuronal loss, but joint treatment with BAZ (at 3 mg/kg) for 7 d affords almost complete neuroprotection in this brain region. The effect of BAZ in improving mouse learning and memory functions observed in this study is in agreement with an earlier study reporting the neuroprotective effect of BAZ in another animal model (44).

Recent studies have suggested that the neuroprotective actions of some SERMs (such as BAZ) may involve the activation of ERs and G protein-coupled receptor for estrogens (GRP30) (45), which then triggers neuroprotective responses such as increasing the expression of antioxidants and activation of kinase-mediated survival signaling pathways. Based on the results obtained in this study, it is suggested that the ER-binding affinity of BAZ does not contribute significantly to the observed neuroprotective actions. In support of this suggestion, we find that the same protective effect of BAZ is also observed in erastin- and RSL3-treated MDA-MB-231 human breast cancer cells, which are deficient in ERs (33). In addition, BAZ has a similarly strong protective effect against erastin- and RSL3-induced cell death in two other cell lines tested in this study (i.e., the BRL-3A rat liver cell line and the H9C2 rat myocardium cells). While the apparent potency of BAZ in these cell lines varies slightly, its overall cytoprotective efficacy against ferroptosis is similar to the observations made in HT22 cells. Together, these results reveal that the protective effect of BAZ is largely independent of ER-mediated signaling pathways.

The results of this study reveals that BAZ has a super-high efficacy in reducing the levels of all cellular ROS, including cytosolic ROS, lipid-ROS and mitochondrial ROS. Since BAZ at concentrations well below 1 µM already exhibits a completion protection against chemically-induced cytotoxicity along with a near-complete abrogation of cellular ROS, lipid-ROS and mitochondrial ROS accumulation, it is almost certain that BAZ does not exert this function solely by serving as a chemical scavenger for all forms of cellular ROS. The reason is rather simple as the levels of all cellular ROS, lipid-ROS and mitochondrial ROS would be much higher than the effective concentration of BAZ. Therefore, it is speculated there must be a highly specific mechanism which mediates the strong antioxidant and neuroprotective actions of BAZ.

To determine the exact mechanism by which BAZ exerts its neuroprotective action, we hypothesize that BAZ may selectively target the cellular protein PDI and inhibits its catalytic activity, reduces PDI-mediated conversion of NOS monomers to its catalytically-active dimers, and ultimately, prevents chemically-induced ferroptotic cell death (as depicted in Fig. 11). As summarized below, several lines of experimental evidence are presented in this study to show that BAZ can bind directly to cellular PDI with high affinity and effectively inhibit its catalytic activity, which then initiates a cascade of downstream changes culminating in ferroptosis protection:

First, surface plasmon resonance assay shows that BAZ can bind to purified PDI protein with a high binding affinity (apparent K_d of 3.3‒3.6 nM). In addition, BAZ can bind to PDI in live HT22 cells and increases PDI protein thermos-stability in a concentration-dependent manner.

Second, computational docking analysis and MD simulations indicate that BAZ can bind tightly inside a rather deep binding pocket in the PDI protein, forming a hydrogen bond with His256. In addition, our docking results indicate that multiple Phe residues in the binding pocket may form hydrophobic interactions with the hydrophobic BAZ molecule, which also partly contributes to its binding interaction with PDI.

Here it is of note that during MD simulations, it is observed that the PDI protein undergoes an open-to-closed movement. In another recent MD simulation study, we also find that PDI can undergo open-to-closed or closed-to-open movements either in the absence or presence of small-molecule ligands (unpublished data). Since the residue-256 is not located in the hinge regions between different domains of PDI, it is speculated that the His256 residue (and its mutant Ala256 residue) likely does not affect the open-to-closed or closed-to-open movements of PDI proteins.

Third, in vitro enzymatic assays further show that BAZ can directly inhibit PDI’s catalytic activity in vitro. This direct inhibition of PDI’s catalytic activity is not observed with the mutant PDI-Ala256 protein. Interestingly, while the catalytic velocity of the mutant PDI-Ala256 is slightly lower than the wild-type PDI-His256, its maximal catalytic ability is still retained. Based on computational modeling analysis, the binding site of PDI-His256 for BAZ is located between its b and b’ domains, whereas its catalytic site lies in the a and a’ domains which contain the CXXC sequences. The reduced catalytic velocity of PDI-Ala256 agrees with the notion that the His256 residue is involved in binding both protein substrates and BAZ (an inhibitor). On the other hand, the mutant PDI-Ala256 still retains its maximal catalytic ability, which also fully agrees with the fact that the catalytic site (which lies between the a and a’ domains) is not affected by the selective mutation (Ala256) and is also not affected by the presence of BAZ.

Fourth, the finding that BAZ can bind tightly to PDI and effectively inhibit its catalytic activity in vitro is also supported by the biochemical changes observed in erastin-treated live HT22 cells. Specifically, it is observed that treatment of the cells with erastin alone results in PDI-mediated iNOS and nNOS activation (i.e., formation of the dimer forms of iNOS and nNOS) along with cellular NO accumulation, and joint treatment of the cells with BAZ abrogates erastin-induced iNOS and nNOS dimerization and NO accumulation. In addition, BAZ also suppresses erastin-induced upregulation of NOS proteins, which also contributes to erastin-induced cytotoxicity.

Here it should be noted that in HT22 cells, we find that erastin-induced ONOO⁻ accumulation is abrogated by joint treatment with BAZ and urea. Interestingly, while BAZ can strongly protect against erastin-induced cell death, urea does not display a meaningful protection. Urea reduces ONOO⁻ level in erastin-treated cells through its direct ONOO⁻-scavenging activity, but BAZ reduces ONOO⁻ level through its inhibition of PDI, which then reduces the formation of the catalytically-active NOS dimers and NO, and ultimately, reduces the conversion of NO to ONOO⁻ as well as its accumulation. Since BAZ elicits a strong cytoprotection but urea does not have this protective effect, it is apparent that ONOO⁻ is not the main culprit that mediates chemically-induced ferroptosis. This observation offers additional support for the notion that NO (but not ONOO⁻) is an important upstream element that drives chemically-induced ferroptosis.

Fifth, based on the observations made in this study, it is evident that PDI is also similarly involved in mediating RSL3-induced ferroptosis in HT22 neuronal cells, and inhibition of PDI’s function by BAZ contributes to its protection against RSL3-induced cell death. RSL3 is a prototypical ferroptosis inducer, and it has long been thought that its ferroptosis-inducing activity is primarily due to its inhibition of GPX4 (85). However, a recent study has reported that RSL3 can also strongly inhibit the enzymatic activity of TrxR1 (47). Theoretically, inhibition of TrxR1 by RSL3 would shift the pool of cellular PDI proteins (a member of the thioredoxin superfamily) toward the catalytically-active oxidized state, thus favoring NOS dimer formation. Therefore, it was recently hypothesized by Hou et al. (48) that in addition to inhibition of GPX4, RSL3 may, through its ability to inhibit TrxR1 enzymatic activity (47), keep more PDI proteins in the oxidized state, thereby promoting RSL3-induced ferroptosis by facilitating NOS dimerization, followed by cellular NO, ROS and lipid-ROS accumulation, and ultimately ferroptotic cell death. A recent study has provided strong experimental evidence for this novel mechanistic explanation of RSL3-induced ferroptosis (48). This novel mechanism of RSL3-induced ferroptosis also provides a good explanation for the strong neuroprotective effect of BAZ against RSL3-induced ferroptosis, which is supported by experimental observations made in this study. For instance, we find that there is a time-dependent increase in total NOS protein levels in HT22 cells treated with 0.08 µM RSL3, and joint treatment of HT22 cells with BAZ abrogates RSL3-induced increase in total NOS protein and its dimer levels.

It is observed that BAZ exhibits a markedly stronger protection against RSL3-induced ferroptotic cell death compared to erastin-induced cell death. It is possible that the direct antioxidant activity of BAZ against lipid-ROS may partially contribute to its cytoprotective effect, in addition to PDI inhibition. This possibility is in somewhat line with the fact that BAZ is a highly hydrophobic compound, and its antioxidant activity would be more readily manifested in protection against cellular lipid peroxides which are induced by treatment with RSL3. This suggestion is also consistent with an earlier study reporting that BAZ is a strong inhibitor of ferroptosis with a potent radical-trapping antioxidant activity (86). It is apparent that the results of our present study indicate that, in addition to its strong antioxidant activity, other mechanisms may also contribute importantly to BAZ’s strong cytoprotective action against chemically-induced ferroptosis.

CONCLUSIONS, LIMITATIONS AND FUTURE DIRECTIONS

As summarized in Fig. 11, the results of our study demonstrates that BAZ, a third generation SERM, exerts its strong protective effect against chemically-induced ferroptosis in hippocampal neurons both in vitro and in vivo through inhibition of PDI-mediated activation of NOS/NO in cells treated with erastin or RSL3, which subsequently results in reduction in cellular ROS and lipid-ROS levels, and ultimately ferroptotic cell death. In addition, the direct antioxidant activity of BAZ may also partially contribute to its protective effect against chemically-induced ferroptosis. These findings reveal a novel mechanism by which BAZ exerts its neuroprotective functions in an ER-independent manner.

The present study, however, also presents limitations. First, the immortalized HT22 hippocampal neuronal cells are used as an in-vitro model in this study, and it is not known whether a similar ferroptosis-protecting effect of BAZ can also be manifested in other neuronal culture models. Another limitation is associated with the animal model and the functional tests used in this study. While the two Y-maze-based tests are employed, it is not known how well these simple learning and memory tests reflect the complex process of cognitive functional impairments in human neurodegenerative conditions (such as Alzheimer’s disease). Lastly, the crucial role of the PDI‒NOS‒NO‒ROS/lipid-ROS signaling cascade in mediating oxidative neuronal death remains to be further verified in the future in human ferroptosis-associated neurodegenerative conditions.

Lastly, it is of note that while BAZ is presently only approved for use as a preventive agent for postmenopausal osteoporosis in women, clearly there are also other clinical benefits associated with BAZ use, such as neuroprotection, cholesterol reduction and lowering of low-density lipoproteins (87, 88). The experimental evidence presented in this study shows that PDI inhibition contributes crucially to BAZ’s neuroprotective actions both in vitro and in vivo. In addition, it is of note that PDI also is a major component of a protein machinery involved in packaging and releasing of low density lipoproteins (89, 90), and inhibition of PDI function is an important potential target for lowering blood cholesterol and lipids. Therefore, the present work provides the basis for future exploration of the broader clinical applications of BAZ as an effective PDI inhibitor for therapeutic purposes.

Funding:

This study was supported by research grants from Shenzhen Key Laboratory of Steroid Drug Discovery and Development (No. ZDSYS20190902093417963), Shenzhen Peacock Plan (No. KQTD2016053117035204), the National Natural Science Foundation of China (No. 81630096), Shenzhen Bay Laboratory (No. SZBL2019062801007), the 2022 Stable Funding Support Program for Shenzhen Institutions of High Learning, and the Longgang District Science and Technology Bureau’s Key Laboratory Program.

Author Contribution

B.T.Z. developed the concept and ideas of this study; obtained financial support; and was responsible for final completion of the manuscript preparation. X.H., Y. W., M. H., L. L., Y. Y. and T. C. took part in performing the experiments and/or data analysis. X. H. also drafted an early version of the manuscript. P.W. and X. C. contributed to development the ideas of this study; involved in the final completion of the manuscript preparation. All authors read and approved the final version of the manuscript.

Dixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, Patel DN, Bauer AJ, Cantley AM, Yang WS, Morrison B, Stockwell BR. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell. 2012;149:1060–72.
Hadian K, Stockwell BR. SnapShot: Ferroptosis. Cell. 2020;181:1188–e11881181.
Feng H, Stockwell BR. Unsolved mysteries: How does lipid peroxidation cause ferroptosis? PLoS Biol. 2018;16:e2006203.
Shimada K, Skouta R, Kaplan A, Yang WS, Hayano M, Dixon SJ, Brown LM, Valenzuela CA, Wolpaw AJ, Stockwell BR. Global survey of cell death mechanisms reveals metabolic regulation of ferroptosis. Nat Chem Biol. 2016;12:497–503.
Yang WS, Stockwell BR. Ferroptosis: Death by Lipid Peroxidation. Trends Cell Biol. 2016;26:165–76.
Cao JY, Dixon SJ. Mechanisms of ferroptosis. Cell Mol Life Sci. 2016;73:2195–209.
Carbone M, Melino G. Lipid metabolism offers anticancer treatment by regulating ferroptosis. Cell Death Differ. 2019;26:2516–9.
Cai W, Liu L, Shi X, Liu Y, Wang J, Fang X, Chen Z, Ai D, Zhu Y, Zhang X. Alox15/15-HpETE Aggravates Myocardial Ischemia-Reperfusion Injury by Promoting Cardiomyocyte Ferroptosis. Circulation. 2023;147:1444–60.
Maremonti F, Meyer C, Linkermann A. Mechanisms and Models of Kidney Tubular Necrosis and Nephron Loss. J Am Soc Nephrol. 2022;33:472–86.
Cui S, Ghai A, Deng Y, Li S, Zhang R, Egbulefu C, Liang G, Achilefu S, Ye J. Identification of hyperoxidized PRDX3 as a ferroptosis marker reveals ferroptotic damage in chronic liver diseases. Mol Cell. 2023;83:3931–e39393935.
Shen Y, Jin X, Chen W, Gao C, Bian Q, Fan J, Luan J, Cao Z, Guo Z, Gu Y, Liu H, Ju D, Mei X. Interleukin-22 ameliorated acetaminophen-induced kidney injury by inhibiting mitochondrial dysfunction and inflammatory responses. Appl Microbiol Biotechnol. 2020;104:5889–98.
Yamada N, Karasawa T, Kimura H, Watanabe S, Komada T, Kamata R, Sampilvanjil A, Ito J, Nakagawa K, Kuwata H, Hara S, Mizuta K, Sakuma Y, Sata N, Takahashi M. Ferroptosis driven by radical oxidation of n-6 polyunsaturated fatty acids mediates acetaminophen-induced acute liver failure. Cell Death Dis. 2020;11:144.
Gao M, Monian P, Quadri N, Ramasamy R, Jiang X. Glutaminolysis and Transferrin Regulate Ferroptosis. Mol Cell. 2015;59:298–308.
Fang X, Wang H, Han D, Xie E, Yang X, Wei J, Gu S, Gao F, Zhu N, Yin X, Cheng Q, Zhang P, Dai W, Chen J, Yang F, Yang HT, Linkermann A, Gu W, Min J, Wang F. Ferroptosis as a target for protection against cardiomyopathy. Proc Natl Acad Sci U S A. 2019;116:2672–80.
Zhu Y-Y, Zhang Q, Zhu BT. (2024) Protein Disulfide Isomerase Plays a Crucial Role in Mediating Chemically-Induced Hepatocyte Injury In Vitro and In Vivo (Submitted).
Jaeschke H, Adelusi OB, Akakpo JY, Nguyen NT, Sanchez-Guerrero G, Umbaugh DS, Ding WX, Ramachandran A. Recommendations for the use of the acetaminophen hepatotoxicity model for mechanistic studies and how to avoid common pitfalls. Acta Pharm Sin B. 2021;11:3740–55.
Han Q, Sun L, Xiang K. Research progress of ferroptosis in Alzheimer disease: A review. Med (Baltim). 2023;102:e35142.
Ryan SK, Ugalde CL, Rolland AS, Skidmore J, Devos D, Hammond TR. Therapeutic inhibition of ferroptosis in neurodegenerative disease. Trends Pharmacol Sci. 2023;44:674–88.
Su Y, Jiao Y, Cai S, Xu Y, Wang Q, Chen X. The molecular mechanism of ferroptosis and its relationship with Parkinson's disease. Brain Res Bull. 2024;213:110991.
Mahoney-Sánchez L, Bouchaoui H, Ayton S, Devos D, Duce JA, Devedjian JC. Ferroptosis and its potential role in the physiopathology of Parkinson's Disease. Prog Neurobiol. 2021;196:101890.
Feng L, Yin X, Hua Q, Ren T, Ke J. Advancements in understanding the role of ferroptosis in hypoxia-associated brain injury: a narrative review. Transl Pediatr. 2024;13:963–75.
Alim I, Caulfield JT, Chen Y, Swarup V, Geschwind DH, Ivanova E, Seravalli J, Ai Y, Sansing LH, Marie S, Hondal EJ, Mukherjee RJ, Cave S, Sagdullaev JW, Karuppagounder BT, S. S., and, Ratan RR. Selenium Drives a Transcriptional Adaptive Program to Block Ferroptosis and Treat Stroke. Cell. 2019;177:1262–e12791225.
Wu JR, Tuo QZ, Lei P. Ferroptosis, a Recent Defined Form of Critical Cell Death in Neurological Disorders. J Mol Neurosci. 2018;66:197–206.
Tuo QZ, Lei P, Jackman KA, Li XL, Xiong H, Li XL, Liuyang ZY, Roisman L, Zhang ST, Ayton S, Wang Q, Crouch PJ, Ganio K, Wang XC, Pei L, Adlard PA, Lu YM, Cappai R, Wang JZ, Liu R, Bush A. I. (2017) Tau-mediated iron export prevents ferroptotic damage after ischemic stroke. Mol Psychiatry 22, 1520–1530.
Skouta R, Dixon SJ, Wang J, Dunn DE, Orman M, Shimada K, Rosenberg PA, Lo DC, Weinberg JM, Linkermann A, Stockwell BR. Ferrostatins inhibit oxidative lipid damage and cell death in diverse disease models. J Am Chem Soc. 2014;136:4551–6.
Liddell JR, Hilton JBW, Kysenius K, Billings JL, Nikseresht S, McInnes LE, Hare DJ, Paul B, Mercer SW, Belaidi AA, Ayton S, Roberts BR, Beckman JS, McLean CA, White AR, Donnelly PS, Bush AI, Crouch PJ. Microglial ferroptotic stress causes non-cell autonomous neuronal death. Mol Neurodegener. 2024;19:14.
Tasanen K, Parkkonen T, Chow LT, Kivirikko KI, Pihlajaniemi T. Characterization of the human gene for a polypeptide that acts both as the beta subunit of prolyl 4-hydroxylase and as protein disulfide isomerase. J Biol Chem. 1988;263:16218–24.
Pihlajaniemi T, Helaakoski T, Tasanen K, Myllylä R, Huhtala ML, Koivu J, Kivirikko KI. Molecular cloning of the beta-subunit of human prolyl 4-hydroxylase. This subunit and protein disulphide isomerase are products of the same gene. Embo j. 1987;6:643–9.
Freedman RB, Hirst TR, Tuite MF. Protein disulphide isomerase: building bridges in protein folding. Trends Biochem Sci. 1994;19:331–6.
Cai H, Wang CC, Tsou CL. Chaperone-like activity of protein disulfide isomerase in the refolding of a protein with no disulfide bonds. J Biol Chem. 1994;269:24550–2.
Okada K, Fukui M, Zhu BT. Protein disulfide isomerase mediates glutathione depletion-induced cytotoxicity. Biochem Biophys Res Commun. 2016;477:495–502.
Hou MJ, Wang P, Zhu BT. Biochemical mechanism of erastin-induced ferroptotic cell death in neuronal cells. Acta Biochim Biophys Sin (Shanghai). 2023;55:853–65.
Wang H, Wang P, Zhu BT. Mechanism of Erastin-Induced Ferroptosis in MDA-MB-231 Human Breast Cancer Cells: Evidence for a Critical Role of Protein Disulfide Isomerase. Mol Cell Biol. 2022;42:e0052221.
Wang H, Hou MJ, Liao L, Li P, Chen T, Wang P, Zhu BT. Strong Protection by 4-Hydroxyestrone against Erastin-Induced Ferroptotic Cell Death in Estrogen Receptor-Negative Human Breast Cancer Cells: Evidence for Protein Disulfide Isomerase as a Mechanistic Target for Protection. Biochemistry. 2024;63:984–99.
Lewiecki EM. Bazedoxifene and bazedoxifene combined with conjugated estrogens for the management of postmenopausal osteoporosis. Expert Opin Investig Drugs. 2007;16:1663–72.
Masaki H, Imanishi Y, Naka H, Nagata Y, Kurajoh M, Mori K, Emoto M, Miki T, Inaba M. Bazedoxifene improves renal function and increases renal phosphate excretion in patients with postmenopausal osteoporosis. J Bone Min Metab. 2020;38:405–11.
Tian J, Chen X, Fu S, Zhang R, Pan L, Cao Y, Wu X, Xiao H, Lin HJ, Lo HW, Zhang Y, Lin J. Bazedoxifene is a novel IL-6/GP130 inhibitor for treating triple-negative breast cancer. Breast Cancer Res Treat. 2019;175:553–66.
Fu S, Chen X, Lo HW, Lin J. Combined bazedoxifene and paclitaxel treatments inhibit cell viability, cell migration, colony formation, and tumor growth and induce apoptosis in breast cancer. Cancer Lett. 2019;448:11–9.
Yadav A, Kumar B, Teknos TN, Kumar P. Bazedoxifene enhances the anti-tumor effects of cisplatin and radiation treatment by blocking IL-6 signaling in head and neck cancer. Oncotarget. 2017;8:66912–24.
Wei J, Ma L, Lai YH, Zhang R, Li H, Li C, Lin J. Bazedoxifene as a novel GP130 inhibitor for Colon Cancer therapy. J Exp Clin Cancer Res. 2019;38:63.
Tsuji J, Li T, Grinshpun A, Coorens T, Russo D, Anderson L, Rees R, Nardone A, Patterson C, Lennon NJ, Cibulskis C, Leshchiner I, Tayob N, Tolaney SM, Tung N, McDonnell DP, Krop IE, Winer EP, Stewart C, Getz G, Jeselsohn R. Clinical Efficacy and Whole-Exome Sequencing of Liquid Biopsies in a Phase IB/II Study of Bazedoxifene and Palbociclib in Advanced Hormone Receptor-Positive Breast Cancer. Clin Cancer Res. 2022;28:5066–78.
Arevalo MA, Santos-Galindo M, Lagunas N, Azcoitia I, Garcia-Segura LM. Selective estrogen receptor modulators as brain therapeutic agents. J Mol Endocrinol. 2011;46:R1–9.
Baez-Jurado E, Rincón-Benavides MA, Hidalgo-Lanussa O, Guio-Vega G, Ashraf GM, Sahebkar A, Echeverria V, Garcia-Segura LM, Barreto GE. Molecular mechanisms involved in the protective actions of Selective Estrogen Receptor Modulators in brain cells. Front Neuroendocrinol. 2019;52:44–64.
Lan YL, Wang X, Zou YJ, Xing JS, Lou JC, Zou S, Ma BB, Ding Y, Zhang B. Bazedoxifene protects cerebral autoregulation after traumatic brain injury and attenuates impairments in blood-brain barrier damage: involvement of anti-inflammatory pathways by blocking MAPK signaling. Inflamm Res. 2019;68:311–23.
Abdelhamid R, Luo J, Vandevrede L, Kundu I, Michalsen B, Litosh VA, Schiefer IT, Gherezghiher T, Yao P, Qin Z, Thatcher GR. Benzothiophene Selective Estrogen Receptor Modulators Provide Neuroprotection by a novel GPR30-dependent Mechanism. ACS Chem Neurosci. 2011;2:256–68.
Ursini F, Maiorino M. Lipid peroxidation and ferroptosis: The role of GSH and GPx4. Free Radic Biol Med. 2020;152:175–85.
Cheff DM, Huang C, Scholzen KC, Gencheva R, Ronzetti MH, Cheng Q, Hall MD, Arnér ESJ. The ferroptosis inducing compounds RSL3 and ML162 are not direct inhibitors of GPX4 but of TXNRD1. Redox Biol. 2023;62:102703.
Hou M-J, Huang X, Zhu BT. (2024) Mechanism of RSL3-induced ferroptotic cell death in HT22 cells: Role of protein disulfide isomerase. (submitted).
Xie R, Zhao W, Lowe S, Bentley R, Hu G, Mei H, Jiang X, Sun C, Wu Y, Yueying L. Quercetin alleviates kainic acid-induced seizure by inhibiting the Nrf2-mediated ferroptosis pathway. Free Radic Biol Med. 2022;191:212–26.
Shao C, Yuan J, Liu Y, Qin Y, Wang X, Gu J, Chen G, Zhang B, Liu HK, Zhao J, Zhu HL, Qian Y. Epileptic brain fluorescent imaging reveals apigenin can relieve the myeloperoxidase-mediated oxidative stress and inhibit ferroptosis. Proc Natl Acad Sci U S A. 2020;117:10155–64.
Yang N, Zhang K, Guan QW, Wang ZJ, Chen KN, Mao XY. (2022) D-Penicillamine Reveals the Amelioration of Seizure-Induced Neuronal Injury via Inhibiting Aqp11-Dependent Ferroptosis. Antioxidants (Basel) 11.
Kolodziejski PJ, Rashid MB, Eissa NT. Intracellular formation of undisruptable dimers of inducible nitric oxide synthase. Proc Natl Acad Sci U S A. 2003;100:14263–8.
Jafari R, Almqvist H, Axelsson H, Ignatushchenko M, Lundbäck T, Nordlund P, Molina M, D. The cellular thermal shift assay for evaluating drug target interactions in cells. Nat Protoc. 2014;9:2100–22.
Martinez Molina D, Nordlund P. The Cellular Thermal Shift Assay: A Novel Biophysical Assay for In Situ Drug Target Engagement and Mechanistic Biomarker Studies. Annu Rev Pharmacol Toxicol. 2016;56:141–61.
Hong BX, Soong L. Identification and enzymatic activities of four protein disulfide isomerase (PDI) isoforms of Leishmania amazonensis. Parasitol Res. 2008;102:437–46.
Tian G, Xiang S, Noiva R, Lennarz WJ, Schindelin H. The crystal structure of yeast protein disulfide isomerase suggests cooperativity between its active sites. Cell. 2006;124:61–73.
Biterova EI, Isupov MN, Keegan RM, Lebedev AA, Sohail AA, Liaqat I, Alanen HI, Ruddock LW. The crystal structure of human microsomal triglyceride transfer protein. Proc Natl Acad Sci U S A. 2019;116:17251–60.
Hosfield DJ, Weber S, Li N-S, Sauvage M, Joiner CF, Hancock GR, Sullivan EA, Ndukwe E, Han R, Cush S, Lainé M, Mader SC, Greene GL, Fanning SW. Stereospecific lasofoxifene derivatives reveal the interplay between estrogen receptor alpha stability and antagonistic activity in ESR1 mutant breast cancer cells. Elife. 2022;11:e72512.
Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, Shindyalov IN, Bourne PE. The Protein Data Bank. Nucleic Acids Res. 2000;28:235–42.
Lu C, Wu C, Ghoreishi D, Chen W, Wang L, Damm W, Ross GA, Dahlgren MK, Russell E, Von Bargen CD, Abel R, Friesner RA, Harder ED. OPLS4: Improving Force Field Accuracy on Challenging Regimes of Chemical Space. J Chem Theory Comput. 2021;17:4291–300.
Friesner RA, Murphy RB, Repasky MP, Frye LL, Greenwood JR, Halgren TA, Sanschagrin PC, Mainz DT. Extra precision glide: Docking and scoring incorporating a model of hydrophobic enclosure for protein-ligand complexes. J Med Chem. 2006;49:6177–96.
Wang R, Lai L, Wang S. Further development and validation of empirical scoring functions for structure-based binding affinity prediction. J Comput Aided Mol Des. 2002;16:11–26.
Vangone A, Schaarschmidt J, Koukos P, Geng C, Citro N, Trellet ME, Xue LC, Bonvin AMJJ. Large-scale prediction of binding affinity in protein–small ligand complexes: the PRODIGY-LIG web server. Bioinformatics. 2018;35:1585–7.
Wang C, Zhang Y. Improving scoring-docking-screening powers of protein-ligand scoring functions using random forest. J Comput Chem. 2017;38:169–77.
Jo S, Kim T, Iyer VG, Im W. CHARMM-GUI: a web-based graphical user interface for CHARMM. J Comput Chem. 2008;29:1859–65.
Vanommeslaeghe K, Hatcher E, Acharya C, Kundu S, Zhong S, Shim J, Darian E, Guvench O, Lopes P, Vorobyov I, Mackerell AD Jr.. CHARMM general force field: A force field for drug-like molecules compatible with the CHARMM all-atom additive biological force fields. J Comput Chem. 2010;31:671–90.
Huang J, Rauscher S, Nawrocki G, Ran T, Feig M, de Groot BL, Grubmuller H, MacKerell AD. CHARMM36m: an improved force field for folded and intrinsically disordered proteins. Nat Methods. 2017;14:71–3.
Jorgensen WL, Chandrasekhar J, Madura JD, Impey RW, Klein ML. Comparison of Simple Potential Functions for Simulating Liquid Water. J Chem Phys. 1983;79:926–35.
Beglov D, Roux B. Finite Representation of an Infinite Bulk System - Solvent Boundary Potential for Computer-Simulations. J Chem Phys. 1994;100:9050–63.
Phillips JC, Braun R, Wang W, Gumbart J, Tajkhorshid E, Villa E, Chipot C, Skeel RD, Kalé L, Schulten K. Scalable molecular dynamics with NAMD. J Comput Chem. 2005;26:1781–802.
Izaguirre JA, Catarello DP, Wozniak JM, Skeel RD. Langevin stabilization of molecular dynamics. J Chem Phys. 2001;114:2090–8.
Darden T, York D, Pedersen L. Particle Mesh Ewald - an N.Log(N) Method for Ewald Sums in Large Systems. J Chem Phys. 1993;98:10089–92.
Essmann U, Perera L, Berkowitz ML, Darden T, Lee H, Pedersen LG. A Smooth Particle Mesh Ewald Method. J Chem Phys. 1995;103:8577–93.
Feller SE, Zhang YH, Pastor RW, Brooks BR. Constant-Pressure Molecular-Dynamics Simulation - the Langevin Piston Method. J Chem Phys. 1995;103:4613–21.
Choi HJ, Lee AJ, Kang KS, Song JH, Zhu BT. 4-Hydroxyestrone, an Endogenous Estrogen Metabolite, Can Strongly Protect Neuronal Cells Against Oxidative Damage. Sci Rep. 2020;10:7283.
Carroll JC, Rosario ER, Chang L, Stanczyk FZ, Oddo S, LaFerla FM, Pike CJ. Progesterone and estrogen regulate Alzheimer-like neuropathology in female 3xTg-AD mice. J Neurosci. 2007;27:13357–65.
Lee GY, Lee C, Park GH, Jang JH. (2017) Amelioration of Scopolamine-Induced Learning and Memory Impairment by α-Pinene in C57BL/6 Mice. Evid Based Complement Alternat Med 2017, 4926815.
Zhang Y, Kurup P, Xu J, Carty N, Fernandez SM, Nygaard HB, Pittenger C, Greengard P, Strittmatter SM, Nairn AC, Lombroso PJ. Genetic reduction of striatal-enriched tyrosine phosphatase (STEP) reverses cognitive and cellular deficits in an Alzheimer's disease mouse model. Proc Natl Acad Sci U S A. 2010;107:19014–9.
Ohno M, Sametsky EA, Younkin LH, Oakley H, Younkin SG, Citron M, Vassar R, Disterhoft JF. BACE1 deficiency rescues memory deficits and cholinergic dysfunction in a mouse model of Alzheimer's disease. Neuron. 2004;41:27–33.
Damjanac M, Rioux Bilan A, Barrier L, Pontcharraud R, Anne C, Hugon J, Page G. Fluoro-Jade B staining as useful tool to identify activated microglia and astrocytes in a mouse transgenic model of Alzheimer's disease. Brain Res. 2007;1128:40–9.
Goujon M, Liang Z, Soriano-Castell D, Currais A, Maher P. (2024) The Neuroprotective Flavonoids Sterubin and Fisetin Maintain Mitochondrial Health under Oxytotic/Ferroptotic Stress and Improve Bioenergetic Efficiency in HT22 Neuronal Cells. Antioxid (Basel) 13.
Liang Z, Zheng Z, Guo Q, Tian M, Yang J, Liu X, Zhu X, Liu S. (2023) The role of HIF-1α/HO-1 pathway in hippocampal neuronal ferroptosis in epilepsy. iScience 26, 108098.
Wang M, Liu CY, Wang T, Yu HM, Ouyang SH, Wu YP, Gong HB, Ma XH, Jiao GL, Fu LL, Wu QS, Kurihara H, Li YF, Shen T, He RR. (+)-Clausenamide protects against drug-induced liver injury by inhibiting hepatocyte ferroptosis. Cell Death Dis. 2020;11:781.
Li K, Wang M, Huang ZH, Wang M, Sun WY, Kurihara H, Huang RT, Wang R, Huang F, Liang L, Li YF, Duan WJ, He RR. ALOX5 inhibition protects against dopaminergic neurons undergoing ferroptosis. Pharmacol Res. 2023;193:106779.
Yang WS, SriRamaratnam R, Welsch ME, Shimada K, Skouta R, Viswanathan VS, Cheah JH, Clemons PA, Shamji AF, Clish CB, Brown LM, Girotti AW, Cornish VW, Schreiber SL, Stockwell BR. (2014) Regulation of ferroptotic cancer cell death by GPX4. Cell 156, 317–331.
Conlon M, Poltorack CD, Forcina GC, Armenta DA, Mallais M, Perez MA, Wells A, Kahanu A, Magtanong L, Watts JL, Pratt DA, Dixon SJ. A compendium of kinetic modulatory profiles identifies ferroptosis regulators. Nat Chem Biol. 2021;17:665–74.
Komm BS, Kharode YP, Bodine PV, Harris HA, Miller CP, Lyttle CR. Bazedoxifene acetate: a selective estrogen receptor modulator with improved selectivity. Endocrinology. 2005;146:3999–4008.
Duggan ST, McKeage K. Bazedoxifene: a review of its use in the treatment of postmenopausal osteoporosis. Drugs. 2011;71:2193–212.
Sirtori CR, Pavanello C, Bertolini S. Microsomal transfer protein (MTP) inhibition-a novel approach to the treatment of homozygous hypercholesterolemia. Ann Med. 2014;46:464–74.
Berberich AJ, Hegele RA. Lomitapide for the treatment of hypercholesterolemia. Expert Opin Pharmacother. 2017;18:1261–8.

No competing interests reported.

Download PDF

Reviews received at journal
16 Sep, 2024
Reviewers agreed at journal
02 Sep, 2024
Reviewers invited by journal
01 Sep, 2024
Editor assigned by journal
29 Aug, 2024
Submission checks completed at journal
29 Aug, 2024
First submitted to journal
23 Aug, 2024

You are reading this latest preprint version

Strong Protection by Bazedoxifene Against Chemically-Induced Ferroptotic Neuronal DeathIn Vitro and In Vivo

Status:

Version 1

Abstract

Figures

SIGNIFICANCE STATEMENT

INTRODUCTION

EXPERIMENTAL PROCEDURES

Chemicals

Cell culture and cell viability assay

Staining of live and dead cells

Quantitative real-time polymerase chain reaction (RT-qPCR)

Measurement of cellular NO, ROS and mitochondrial ROS by fluorescence microscopy

Measurement of cellular NO, ROS, lipid-ROS and peroxynitrite by flow cytometry

Measurement of lipid-ROS by confocal microscopy

Immunoblotting assay

Cellular thermal shift assay (CETSA)

Protein expression and purification

Assay of PDI catalytic activity and its inhibition by BAZ

Molecular docking analysis

Molecular dynamics simulations

Memory and learning ability tests

Histochemical and fluorescence staining of the brain sections

Statistical analysis

RESULTS

BAZ prevents erastin-induced ferroptosis and NO/ROS accumulation

BAZ protects against RSL3-induced ferroptosis and NO/ROS accumulation

BAZ binds directly to PDI

BAZ inhibits PDI’s catalytic activity

PDI inhibition mediates BAZ’s protection against chemically-induced ferroptosis

BAZ protects against kainic acid-induced memory deficit and hippocampal neuronal damage in mice

DISCUSSION

CONCLUSIONS, LIMITATIONS AND FUTURE DIRECTIONS

Declarations

Funding:

Author Contribution

References

Additional Declarations

Supplementary Files

Status:

Version 1