An epidemiological survey of bovine piroplasmosis in Kashgar, Xinjiang, China

doi:10.21203/rs.3.rs-4963741/v1

Piroplasmosis is an important tick-borne disease in several regions, leading to significant economic losses in the development of animal husbandry. The present research aimed to systematically grasp the infection of bovine Piroplasma in Kashgar, Xinjiang, to provide a reference for the effective prevention and control of bovine piroplasmosis in the region. Based on the universal primers of Piroplasma and the specific primers of Theileria annulata, a total of 1403 bovine blood samples from 12 sampling sites were detected by PCR. The 18S rRNA gene sequence was amplified and sequenced. Species of Piroplasma were identified and phylogenetic relationship was analyzed using MEGA 7 and BLASTn tool of NCBI GenBank database. The overall infection rate of bovine Piroplasma was 65.93%(925/1403), a total of 3 species pathogens of Theileria including T. annulata, T. orientalis, and T. sinensis were detected out, and the infection rates were 65.07%༈913/1403) 、 0.50%༈7/1403) 、 0.07%༈1/1403). The mixed infection rate of T. orientalis and T. annulata was 0.29% (4/1403). No Babesia was detected in this study. In conclusion, bovine Piroplasmosis was still more serious in Kashgar. T. annulata is the dominant species, and there is a mixed infection of T. annulata and T. orientalis. In addition, it is noteworthy that T. sinensis was first detected in this region. Therefore, the prevention and control of bovine piroplasmosis should be strengthened.

tick-borne diseases

prevention and control

bovine piroplasmosis

PCR

Piroplasmosis is a tick-borne haemo protozoan disease caused by the parasites of Theileria and Babesia that infect leukocytes and erythrocytes. The disease has obvious seasonality, mainly related to ticks' activity (Shen et al. 2020). Infected animals often show clinical symptoms such as anemia, hyperpyrexia, jaundice, and hemoglobinuria (Zhang et al. 2023). In severe cases, they may cause death (Onyiche et al. 2019), which has caused tremendous economic losses to the animal husbandry industry.

Theileriasis is a tick-borne parasite disease caused by blood protozoan. It usually infects ruminant animals in tropical and subtropical regions and is most harmful to bovines (Nazifi et al. 2009). Theileria spp. is mainly distributed in the northeast, northwest, and northern China (Yi et al. 2014). China has reported and confirmed Theileria spp., including T. annulata, T. oriental, and T. sinensis (Sun et al. 2020). They are widely distributed and seriously harmful in China. T. annulata is a malignant Theileria, with strong pathogenicity and high mortality, and each age group bovine is susceptible (Brühlmann et al. 2024). T. oriental and T. sinensis belong to benign Theileria, and the harm is relatively weak, but they are common in China. The outbreak of Theileriasis disease in bovines is closely related to tick activity. The disease is more likely to occur during the hot season because ticks are more active. If the farm adopts grazing, it will increase the chance of contact between ticks and cattle. Ticks will enter the enclosure with cattle, increasing the risk of disease transmission. The vector ticks of T. annulata are the tick species of Hyalomma, mainly including H. anatolicum、H. detritum and H. scupense (Xie. 2021). Haemaphysalis longicornis is carriers of T. orientalis(Dong. 2018) and T. sinensis is H. qinghaiensis (Wang. 2021).

The Xinjiang Uygur Autonomous Region (Xinjiang) is situated in northwest China and the hinterland of the Eurasian Continent. It borders eight countries: Mongolia, Russia, Kazakhstan, Kyrgyzstan, Tajikistan, Afghanistan, Pakistan, and India. Xinjiang has a typical temperate continental arid climate with a large temperature difference, sufficient sunshine, and little precipitation. Xinjiang is one of the five major grazing areas in China. The vast grassland, suitable climatic conditions, and abundant water resources have laid a certain foundation for the development of animal husbandry. Kashgar region (Kashgar) is in southern Xinjiang, with agriculture and animal husbandry as the primary industries, of which the cattle industry occupies an important position. Owing to its complicated and various geographical environment and abundant species resources, it creates favorable conditions for the survival of ticks. Piroplasmosis is one of the most important tick-borne diseases that cause huge economic losses in many parts of the world. The pathogen of piroplasmosis is transmitted by bloodsucking of hard ticks, and its natural foci are closely related to the distribution of vector ticks (Sun. 2023). Because it can infect a variety of mammals, it is widely distributed. The present research aimed to evaluate the transmission of bovine piroplasmosis in Kashgar, to provide a reference for the comprehensive prevention and control of bovine piroplasmosis in this region.

Blood sampling

In August 2023, a total of 1403 blood samples of cattle were collected from 7 counties (Marabishi, Makit, Yarkant, Payzawat, Atushi, Yengisar, Yecheng) in Kashgar, numbering as sampling points 1 ~ 12. Samples were collected in EDTA anticoagulation tubes and transported to the laboratory with an ice bag in a foam box, where they were frozen at -20°C.

DNA extraction

Genomic DNA was extracted from 200 µL of blood for each sample, using a commercial DNA extraction kit according to the instructions. The extracted DNA samples were stored at − 20℃.

Primer synthesis and PCR amplification

PCR method was used to amplify the 18S rRNA of Piroplasma and the COB gene of T. annulata. PCR primers were determined according to the methods of Hamšíková et al. (2016) and Liu et al. (2015), The primers were synthesized by Xinjiang Youkang Biotechnology Co., Ltd. (Table 1).

The PCR system was 20 µL: 2 × Taq PCR MasterMix II 10 µL, DNA 2 µL, upstream and downstream primers 0.5 µL, ddH2O 7 µL; The PCR reaction of 18S rRNA gene was: 94°C 5 min; 94°C 30 s, 55°C 30 s, 72°C 30 s, 35 cycles; 72°C for 10 min; The PCR reaction of COB gene was: 94°C 3 min; 94°C 1 min, 61. 5°C 45 s, 72°C 30 s, 35 cycles; 72°C for 7 min. 10 µL PCR products were electrophoresed on a 1% agarose gel in TAE buffer at 120 V for 30 min. After electrophoresis, the results were observed in the gel imager.

Table 1

Primer sequence
Species	Target gene	Primer name	sequences (5′–3′)	Tm (°C)	Sequence length (bp)
Piroplasma	18S rRNA	18S rRNA-F	GTCTTGTAATTGGAATGATGG	55	450
Piroplasma	18S rRNA	18S rRNA-R	TAGTTTATGGTTAGGACTACG	55	450
T. annulata	COB	COB-F	CGGTTGGTTTGTTCGTCTTT	61.5	393
T. annulata	COB	COB-R	GCCAATGGATTTGAACTTCC	61.5	393

Sequencing and analysis

The PCR products of Piroplasma positive samples from different sampling points were sent to Xinjiang Youkang Biotechnology Co., Ltd. The accuracy of the sequence was verified by bidirectional sequencing. Species of Piroplasma were identified using the BLASTn tool provided by NCBI GenBank. The representative sequences successfully sequenced in this study were compared with the reference sequences downloaded from NCBI by Align by ClustalW of MEGA7 software. The phylogenetic tree was constructed by the neighbor-joining (NJ) method.

1403 bovine blood samples were collected from 12 sampling sites in Kashgar and detected by PCR (Table 2). A total of 3 species of Theileria spp. including T. annulata, T. orientalis, and T. sinensis were detected (shown in Table 2). The overall infection rate of bovine Piroplasma was 65.93% (925/1403). The infection rates of T. annulata, T. orientalis, and T. sinensis were 65.07% (913/1403), 0.50% (7/1403), and 0.07% (1/1403); And the mixed infection rate of T. orientalis and T. annulata was 0.29% (4/1403). No Babesia was detected in this study. Among the 12 sampling sites, T. orientalis and T. annulata mixed infection was only detected in sampling site 6, and no Piroplasma was detected in sampling site 3.

Table 2

Infection of bovine *Piroplasma* in Kashgar, Xinjiang, China
sampling sites	No. of samples	No. infected/(%) of Piroplasma	No. infected (%) of Theileria spp.
sampling sites	No. of samples	No. infected/(%) of Piroplasma	T. annulata	T. orientalis	T. sinensis	T. orientalis + T. annulata
1	400	88(352/400)	88 (352/400)	-	-	-
2	44	20.45(9/44)	20.45 (9/44)	-	-	-
3	10	-	-	-	-	-
4	252	82.14 (207/252)	82.14 (207/252)	-	-	-
5	30	60 (18/30)	60 (18/30)	-	-	-
6	402	55.47 (223/402)	52.49 (211/402)	1.74(7/402)	0.25 (1/402)	0.10(4/402)
7	40	27.5 (11/40)	27.5 (11/40)	-	-	-
8	20	20 (4/20)	20 (4/20)	-	-	-
9	5	40 (2/5)	40 (2/5)	-	-	-
10	144	62.5 (90/144)	62.5 (90/144)	-	-	-
11	16	25 (4/16)	25 (4/16)	-	-	-
12	40	12.5 (5/40)	12.5 (5/40)	-	-	-
合计	1403	65.93(925/1403)	65.07(913/1403)	0.50(7/1403)	0.07(1/1403)	0.29(4/1403)
Note:“―”: no pathogen infection

Babesia sp. Xinjiang strain (AY726557.1) was used as an outgroup. The tree was constructed based on Neighbor-Joining phylogeny, and1000 bootstrap replicates using MEGA 7. The gene sequences of T. annulata obtained in this study shared 99.80% genetic homology with T. annulata Chinese strain (OM140997.1) (Fig. 1); T. orientalis DF-1 was located in the same branch with the reference strain of T. orientalis Bosnia and Herzegovina strain (ON148462.1), and T. orientalis DF-2 was located in the same branch with the reference strain of T. orientalis Chinese strain (MH208633.1), and the genetic homology was 99.77% and 100.00% respectively (Fig. 2); T. sinensis isolates shared 99.57% genetic homology with a bovine T. sinensis strain from China (KY232122.1) (Fig. 3).

Kashgar is southwest of Xinjiang, northwest China. Adjacent to Tajikistan to the west, Afghanistan and Pakistan to the southwest. Neighboring countries include Kyrgyzstan, Uzbekistan, and India. Kashgar has a unique climate characterized by a warm-temperate continental arid climate. Four seasons are distinct, the light is long, and the annual and daily temperature changes are significant. Owing to its complicated and various geographical environment and abundant species resources, it creates favorable conditions for the survival of ticks. With the influx of the pathogen of Piroplasmosis, the region has become one of the natural foci of bovine Piroplasmosis.

Blood smear is widely used to detect Piroplasma (Tian et al. 2017). However, due to the low sensitivity of smear staining and the low number of parasites in the blood at the early stage of infection or chronic infection, it is only suitable for detecting parasites during the acute infection period. Therefore, the effect of blood smear microscopy is not good (Abedi et al. 2014). Secondly, the method requires detectors familiar with the various forms of Piroplasma and other blood protozoa, otherwise it is easy to cause misdiagnosis. ELISA, IFAT, and other serological detection methods have also been applied, however, due to antigen cross-protection between the various species of Piroplasma, it is easy to cause false positives. In recent years, molecular biology detection technology has developed rapidly. Because of its high specificity, sensitivity, and simple operation, it has been increasingly applied to the detection of Piroplasmosis.

In recent years, with the improvement in living standards, people's demand for meat and dairy products has increased, and the corresponding quality has higher requirements. The prevalence of T. annulata, T. orientalis, and T. sinensis among farms not only causes huge losses to the economy of farms but also seriously damages human health. This study employed PCR to investigate the infection of bovine Piroplasma in Kashgar, to provide a reference for the comprehensive prevention and control of bovine Piroplasmosis in this region.

In this study, 1403 bovine blood samples were collected from 12 sampling sites in Kashgar in August 2023. The results of PCR detection showed that the infection rate of Piroplasma was 65.93% (925 / 1403). Among them, sampling point 1 had the highest infection rate of 88% (352 / 400), followed by sampling point 4, the infection rate was 82.14% (207 / 252). Considering that the climate, altitude, and other conditions of these two sites are suitable for the life of hard ticks, it is easy to cause the spread of bovine Piroplasmosis. The infection rates of sampling point 12 and 2 were low, with 12.5% (5 / 40) and 20.45% (9 / 44) respectively. Sampling point 3 didn't find the situation of Piroplasma infection, which may be related to the sample methods, time, and number. Whether there is a Piroplasma infection in this sample point needs to be further studied.

The results of PCR detection showed that the infection rate of T. annulata was 65.07% (913 / 1403) and was the dominant Piroplasma species in Kashgar. According to the previous literature, there have been many areas of T. annulata infection in Xinjiang (Xie. 2021; Zhang et al. 2021). Ge et al. (2022) collected 356 whole blood samples from cattle in Turpan City, Altay Prefecture, and Ili Kazakh Autonomous Prefecture in Xinjiang, finding that the infection rate of T. annulata was 41.6% (148 / 356). A study was conducted in 2014–2016, the blood smear method was used to detect T. annulata in 835 cattle blood samples in Tuokexun County, and the results showed that the positive rate was 49.46% (413 / 835) (Aihemaiti et al. 2017). Zhang et al. (2021) investigated the infection of bovine Piroplasma in the Xiaohaizi reclamation area of Xinjiang between May and November 2020, it was found that cattle were infected with T. annulata, which was consistent with the results of this experiment.

T. orientalis is a benign or non-transformed Theileria, belonging to the sergenti / Buffalo / orientalis Theileria group. The taxonomic status of this group has been debated for many years 35) (Chihiro et al. 2002). They were previously named based on geographical origin, T. sergenti in Japan, T. buffalo in Australia, and T. orientalis in Europe and elsewhere (Kawazu et al. 1992). Some studies suggest that Theileria sergenti / Buffalo / orientalis has serological differences and should be distinguished. It has been used as a practical classification method in the form of Piroplasma surface protein (MPSP) gene sequencing. Based on molecular studies, MPSP, and 18 S rDNA sequences, the Theileria sergenti / orientalis parasites can be classified as a group (Kamau et al. 2011). Theileriosis orientalis was first discovered in the Russian Far East in 1930 and has spread widely worldwide. The disease has been reported in the United Kingdom, Japan, Australia, and other countries (Dong. 2018; Watts et al. 2016). The disease was first discovered in Guizhou in 1964 in China. In recent years, the incidence of T. orientalis has increased (Yang et al. 2007). T. orientalis has obvious seasonality, and it occurs frequently in imported cattle and cattle in pastoral areas, which is inseparable from the activities of vector ticks. Through research, Li et al. (Li et al. 2022) considered that H. longicornis is a significant factor in the transmission of bovine T. orientalis. There are few reports on T. orientalis in Xinjiang. In this study, T. orientalis was detected in sample 6, and the infection rate was 0.50% (7 / 1403). A mix of T. orientalis and T. annulata was identified in this study, and the infection rate was 0.29% (4/1403). Although the pathogenicity of T. orientalis is lower than T. annulata, it still poses a potential threat to the cattle industry because it can cause acute death of cattle in severe cases.

T. sinensis is a new species isolated from cattle in Gansu province, China (Bai et al. 2002). The distribution of T. sinensis is not fully understood, and there are few reports on T. sinensis in China. Qin et al. (2016) performed PCR detection on 29 bovine blood samples collected from Lhasa Xizang, China. The results showed that the infection rate of T. sinensis was 27.6% (8 / 29) and T. orientalis was 6.9% (2 / 29). Zhong et al. (2019) detected 108 blood samples of yaks in Aba (Ngawa) Tibetan and Qiang Autonomous Prefecture, Sichuan Province, it was found that all the infected species were T. sinensis, with a total infection rate of 26.9% (29 / 108). At present, there are few reports on T. sinensis in Xinjiang. In this study, T. sinensis was first detected in this area. Although the pathogenicity of T. sinensis was lower than T. annulata, it still needs to be highly valued because it can lead to the death of infected animals in severe cases, and it is unknown whether it will spread in this area. Whether the T. sinensis will spread on the farm still needs to be followed up.

The phylogenetic tree results showed that the gene sequences of T. annulata obtained in this study shared 99.80% genetic homology with T. annulata Chinese strain (OM140997.1). The homology between the sequenced T. sinensis and T. sinensis China strain (KY232122.1) was 99.57%. T. orientalis DF-1 was located in the same branch with the reference strain of T. orientalis Bosnia and Herzegovina strain (ON148462.1), and T. orientalis DF-2 was located in the same branch with the reference strain of T. orientalis Chinese strain (MH208633.1), and the genetic homology were 99.77% and 100.00% respectively; The T. orientalis DF-1 is located in the same branch as the European strain. The first appearance of T. orientalis in traceable sampling site 6 was detected from blood samples of imported cattle from Europe. According to the evolutionary results, it is speculated that T. orientalis is carried by imported cattle and has begun to spread in this area. The T. orientalis DF-2 is in the same branch as the Chinese strain. It is speculated that the T. orientalis detected in this study may be carried by imported cattle but infected with other types of T. orientalis in local cattle.

The results showed that the infection of bovine Piroplasmosis was common in Kashgar, Xinjiang, and the dominant species was T. annulata. This survey found a mixed infection of T. annulata and T. orientalis, and detected T. sinensis, which was not found in the previous study of our team. T. annulata is highly pathogenic and lethal. Although the pathogenicity of T. orientalis and T. sinensis is lower than that of T. annulata, it still causes harm to China's cattle industry. Therefore, according to the test results, farms need to treat and prevent Piroplasmosis, and at the same time prevent ticks and kill ticks, to prevent the spread of Piroplasmosis among cattle by hard ticks and reduce the harm of bovine Piroplasmosis to the animal husbandry.

Acknowledgements

The author would like to thank all the teachers and classmates who participated in the study and all the grassroots veterinarian staff who contributed to the sample collection.

Ethical Approval

Not applicable. This study did not involve human or animal subjects, and thus no ethical approval was required. The study protocol adhered to the guidelines established by the journal.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

Yuxia Zhang: Completed the manuscript, collected experimental samples, consulted the literature, and the overall experimental operation. Xuke Chen: Discussed and modified the manuscript, consulted the literature, and collected experimental samples. Yanyan Zhang: Undertake funding, designed the experiment, and reviewed and edited the manuscript. Na Pu: Collected experimental samples, consulted the literature, and assisted in completing the experiment. Wenqing Zhao: Collected experimental samples, and assisted in completing the experiment. Zhengrong Wang: Analysed experimental data. Yan Sun: Processed experimental data. Chunying Jia: In charge of sample collection. Xinwen Bo: Overall design and supervision of the experiment. All authors contributed to the article and approved the submitted version.

Funding

This work was funded by the Science and Technology Planning Project of the Third Division of Xinjiang Production and Construction Corps (KY2022GG04), and the Key Areas of Science and Technology Research Plan of the Xinjiang Production and Construction Corps (2023CB007-13).

Availability of data and materials

Not applicable

Shen XY, He ZH, Fu GZ, Yao MG, Zhang Y, Jiang JF, Sun Y, Jiang BG, Liu HB, Du CH (2020)．Molecular epidemiological investigation of Piroplasma infection in cattle and sheep in Tengchong, Yunnan Province. Animal Husbandry ＆ Veterinary Medicine 52 ( 3): 61－68．
Zhang GX, Yang F, Cheng JH, Kunbahasi SHY(Kunbahasi·Shaheyi), Yunusi ABD(Yunusi·Abudu), He B, Zhang XX, Zhang ZX, Ma CJ (2023). Epidemiological Investigation on a Suspected Case of Bovine Piroplasmosis in Hami City of Xinjiang. China Animal Health Inspection 40(09):9-14.
Onyiche TE, Suganuma K, Igarashi I, Yokoyama N, Xuan X, Thekisoe O (2019). A review on equine piroplasmosis: epidemiology, vector ecology, risk factors, host immunity, diagnosis and control. International journal of environmental research and public health 16(10): 1736.
Nazifi S, Razavi SM, Esmailnejad Z, Gheisari H (2009). Study on acute phase proteins (haptoglobin, serum amyloid A, fibrinogen, and ceruloplasmin) changes and their diagnostic values in bovine tropical theileriosis. Parasitol Res 105:41–46.
Yi CY, Guo QY, Yang HX, He XD, Sha TEKHE, Ba YCH (2014). Dynamic-Prevention Analysis of Theileria annulata Infection in Cattle in Part of Area, Xinjiang. Asian Case Reports in Veterinary Medicine 3(4): 29-33.
Sun M, Guan GQ, Liu ZJ, Wang JM, Wang DQ, Wang SF, Ma C, Cheng SZ, Yin H, Luo JX (2020). Molecular Survey and Genetic Diversity of Babesia spp. and Theileria spp. in Cattle in Gansu Province, China. Acta Parasitol 65(2):422-429.
Brühlmann F, Perry C, Griessen C, Gunasekera K, Reymond J-L, Naguleswaran A, Rottenberg S, Woods K, Olias P (2024). TurboID mapping reveals the exportome of secreted intrinsically disordered proteins in the transforming parasite Theileria annulata. MBio 15(6): e0341223.
Xie XW (2021). The biological characteristics of dominant Hyalomma and the phylogenetic analysis of Theileria annulata carried by Hyalomma in parts of Xinjiang. Xinjiang Agricultural University 2021.
Dong Q (2018). Molecular epidemiologic investigation of Theileria orientalis and Anaplasma phagocytephilum in cattle in Jilin province. Yanbian University 2018.
Wang Y, Wang B, Zhang QX, Li Y, Yang ZW, Han SY, Yuan GH, Wang SL, He HX (2021). The Common Occurrence of Theileria ovis in Tibetan Sheep and the First Report of Theileria sinensis in Yaks from Southern Qinghai, China. Acta Parasitol 66(4):1177-1185.
Sun M, Ren QY, Nie Y, Zhong FP, Dong W (2023). Molecular Epidemiological Investigation on the Pathogens and Vector Ticks of Piroplasmosis in Cattle and Sheep in Hexi Region of Gansu Province. China Animal Health Inspection 40(10):14-20.
Hamšíková Z, Kazimírová M, Haruštiaková D, Mahríková L, Slovák M, Berthová L, Kocianová E, Schnittger L (2016). Babesia spp. in ticks and wildlife in different habitat types of Slovakia. Parasit vectors 9(1):12.292.
Liu JL, Li YQ, Liu AH, Guan GQ, Xie JR, Yin H, Luo JX (2015). Development of a multiplex PCR assay for detection and discrimination of Theileria annulata and Theileria sergenti in cattle. Parasitology research 114(7):13.2715-2721.
Tian WN, Xue SJ, Jia LJ, Zhang SF, Li GJ (2017). Epidemiological survey and identification of theileriosis in goats and sheep in Jilin Province. Chinese Journal of Veterinary Medicine 53(10):13-16.
Abedi V, Razmi G, Seifi H, Naghibi A (2014). Molecular and serological detection of Theileria equi and Babesia caballi infection in horses and ixodid ticks in Iran. Ticks and tick-borne diseases 5(3): 239-244.
Zhang F, Wang ZR, Jiang JJ, Bo XW, Zhang YY, Jia CY (2021). Investigation on Bovine Piroplasma Infections in Xiaohaizi Reclamation Area of Xinjiang. Progress in Veterinary Medicine 42 (12): 126-129.
Ge XM, Chen SQ, Li CS, Zheng HZ, Guo QY (2022). Investigation on Tick-Borne Anaplasma and Theileria annulata in Cattle in Selected Areas of Xinjiang. Chinese Journal of Veterinary Medicine 58 (05): 10-15.
Aihemaiti HNMGL, Xie XW, Taxtiemuer MRGL, Yang HX, Kahar STE, Guo QY (2017). Investigation on Theileria annulata infection in partial areas of Toksun, Xinjiang. Animal Husbandry&Veterinary Medicine 49 (6) :117-119.
Chihiro S, Koso F (2002). Non-Transforming Theileria Parasites of Ruminants. Theileria 93-106.
Kawazu S, Sugimoto C, Kamio T, Fujisaki K (1992). Antigenic differences between Japanese Theileria sergenti and other benign Theileria species of cattle from Australia (T. buffeli) and Britain (T. orientalis). Parasitol Res 78(2):130-5.
Kamau J, de Vos AJ, Playford M, Salim B, Kinyanjui P, Sugimoto C (2011). Emergence of new types of Theileria orientalis in Australian cattle and possible cause of theileriosis outbreaks. Parasit Vectors 21; 4:22.
Watts JG, Playford MC, Hickey KL (2016). Theileria orientalis: a review. N Z Vet J 64(1):3-9.
Yang YL, Zhang XC, Zhang GC, BAI GY, Li JH (2007). CLONING OF P32 GENE ENCODING THE MAJOR SURFACE PROTEIN FROM THEILERIA ORIENTALISI. Acta Parasitologica Et Medica Entomologica Sinica (04):204-207.
Li JX, Piao W, Jin YS; Jin GJ, Cui QL, Song ZH, Piao GM, Jin LH; Li YN, Fu P (2022). INVESTIGATION OF THEILERIA ORIENTALISI CARRIED BY FREE TICKS AND CATTLE IN BORDER AREA OF YANBIAN, JILIN PROVINCE. Acta Parasitologica Et Medica Entomologica Sinica 29 (02): 67-71+97.
Bai Q, Liu GY, Yin H, Zhao QZ, Liu DK, Ren JX, Li X (2002). Theileria Sinensis sp nov: A New Species of Bovine Theileria -Molecular Taxonomic Studies. Acta Veterinaria et Zootechnica Sinica (02): 185-190.
Qin GG, Li YQ, Liu JL, Liu ZJ, Yang JF, Zhang L, Liu GY, Guan GQ, Luo JX, Yin H (2016). Molecular detection and characterization of Theileria infection in cattle and yaks from Tibet Plateau Region, China. Parasitol Res 115(7):2647-52.
Zhong W, Du XM, Hao LL, Yuan DB, Guo L, Huo W, Lu ZP, Mo Q, Yang AG, Mao QF, Luo XL, Tudeng ZM (2019). Investigation on Molecular Epidemiology of Piroplasma Infection in Yaks and Tibetan sheep in Aba Tibetan Autonomous Prefecture of Sichuan Province. Chinese Journal of Veterinary Medicine 55 (01): 20-22+27.

No competing interests reported.

An epidemiological survey of bovine piroplasmosis in Kashgar, Xinjiang, China

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Blood sampling

DNA extraction

Primer synthesis and PCR amplification

Sequencing and analysis

Results

Discussion

Conclusions

Declarations

References

Additional Declarations

Status:

Version 1