Analysis of the efficacy of two molecular adjuvants,flagellin and IFN-γ,on the immune response against Streptococcus agalactiae in Nile tilapia (Oreochromis niloticus)

doi:10.21203/rs.3.rs-4964851/v1

Download PDF

Research Article

Analysis of the efficacy of two molecular adjuvants,flagellin and IFN-γ,on the immune response against Streptococcus agalactiae in Nile tilapia (Oreochromis niloticus)

https://doi.org/10.21203/rs.3.rs-4964851/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Aquaculture industry frequently encounters disease outbreaks, high mortalities as well as emergence of new pathogens due to its intensification. Streptococcus agalactiae (Lancefield’s group B Streptococcus) is an important pathogen extensively causing infectious diseases in tilapia resulting in huge economic loss and mortality rates. To date, vaccination has been approved to be successful in defending infectious diseases prevailing among farmed fish species. This study aimed to develop an S. agalactiae inactivated vaccine (SAIV) using molecular adjuvants- flagellin and tilapia interferon gamma (IFN-γ), and to assess the generated immune response and protective efficacy of the adjuvant incorporated vaccine against the S. agalactiae infection in Nile tilapia. The fish were vaccinated with SAIV together with either flagellin or IFN-γ and both together by intraperitoneal injection. The vaccinated fish were challenged with a virulent strain of S. agalactiae on day 36 and monitored three weeks for cumulative mortality. The results showed that the vaccine offered significant protection with relative percentage survival (RPS) of 59.37%, 71.87% and 81.25% observed for bacterin vaccine adjuvanted with flagellin, IFN-γ and both, respectively, with an RPS of 15.62% for the unadjuvanted bacterin control group after challenge with S. agalactiae. The vaccine induced specific IgM antibodies against S. agalactiae in the vaccinated groups and the antibody response was significantly increased following booster vaccination in the fishes administered with vaccine adjuvanted with flagellin, IFN-γ and both. Furthermore, after vaccination MHC-II and IgM gene expression was found significantly upregulated in head kidney and spleen, in line with elevated specific IgM titer. Innate immune parameters including catalase, lysozyme, superoxide dismutase, myeloperoxidase and bactericidal activities were significantly increased in fishes immunized when compared to the unvaccinated controls (P < 0.05). Histopathological examinations with tissue sections of head kidney, spleen, liver, kidney, gills and brain were performed from fish vaccinated and non-vaccinated showed mild infiltrations. In conclusion, flagellin and IFN-γ have shown potential for use as molecular adjuvants to enhance the efficacy of fish vaccines against S. agalactiae infections.

Inactivated Vaccine

Streptococcal disease

Molecular Adjuvant

Immune response

Vaccine Development

Nile tilapia (Oreochromis niloticus) is one of the most farmed fish species across the world and its production is expected to reach 7.3 million by 2030 (Kobayashi et al. 2015,WorldBank 2013). This fish species is considered as economically significant fish owing to many factors like its easiness in cultivation, hardiness, sustainability, economical price, and adaptability to various growth conditions (Buentello et al.2007). Intensification of tilapia farming has triggered disease out breaks by infectious pathogens causing mortality and huge economic loss (Aich et al.2022). S. agalactiae is a major bacterial pathogen causing mass mortalities in tilapia resulting in huge economic loss worldwide (Wangkahart et al.2022). Streptococcal disease caused by S. agalactiae is characterized by exophthalmia, loss of orientation, septicemia, meningoencephalitis, ulcers, lethargy and dead (Klesius et al. 2008).

Vaccination is an alternative method for preventing the infectious diseases in aquaculture, with most vaccines delivered by intraperitoneal (IP) injection (Munang’andu et al. 2016). It is important to realize that to ensure best profit margins by reducing mortality rates of fishes, vaccination along with good nutrition, sanitary practices and biosecurity maintenance are utmost important as far as aquaculture industry is concerned. Different types of vaccines have been developed against S. agalactiae infections in tilapia such as live attenuated vaccines, inactivated vaccines, DNA vaccines, and subunit vaccines (Langemann et al. 2010, Ma et al. 2019, Jorge et al.2017, Su et al. 2018). Recent practice of employing adjuvants to optimize vaccine efficacy as well as to enhance the host immune response is highly studied. Flagellin, the principal structural protein of flagellum in bacteria, is identified as a powerful pathogen-associated molecular patterns (PAMPs) (Zhao et al. 2015). Among the 4 unique globular domains- D0, D1, D2 and D3, D1 domain directly binds with Toll like receptor 5 (TLR5) expressed by antigen-presenting cells and T cells. Following the activation of TLR5, effective immunity is developed by generating chemokines, pro-inflammatory cytokines and co-stimulatory molecules (Hayashi et al. 2001 ). Previous studies have reported the role of flagellin as an immunostimulant to stimulate the expression of proinflammatory cytokines in vitro such as IL-1β, IL-6, TNF-α, IL-8 (Chettri et al.2011, Hynes et al. 2011). Another study has shown that a recombinant flagellin from Y. ruckeri rapidly induces the expression of pro-inflammatory cytokines in vivo as well as the Th17 cytokine IL-17A/F1 and Th2 cytokine IL-4/13, but not the Th1 cytokine IFN-γ (Wangkahart et al. 2016). It was also observed that some acute phase proteins (APPs) and anti-microbial peptides (AMPs) were upregulated quickly to subsequently impart a potential platform to defend the bacterial infection mediated by flagellin (Wangkahart et al. 2016). Moreover, flagellin in synergy with IFN-γ, upregulated the expression of specific IL-12 family members (Wangkahart et al. 2016). The observations suggest the use of flagellin as adjuvant in stimulating immune response for use in aquaculture. Previous studies have shown the role of IFN-γ in innate as well as adaptive immune responses carrying a pivotal role in elucidating Th1 immune response in all vertebrates. The upregulation of IFN-γ expression was observed in different stimuli like LPS, Poly I: C and bacterial infections. Fish IFNγ can upregulate the expression of adaptive cytokines, eg. IL-12, IL-15 and IL-21, important for vaccine-mediated defense (Liu et al. 2023). Thus, the role of tilapia IFN-γ in immune response against invading pathogens in tilapia is found to be interesting (Velázquez et al. 2017). We hypothesized that a balanced Th1/Th2 and Th17 immune response is important for promoting protective immunity and eliminating tissue injury (pathological inflammation). Inclusion of a flagellin as Th2 and Th17 signals and IFN-γ as a Th1 signal in a vaccine formulation may enhance vaccine efficacy. The current study aimed to investigate the effect of recombinant flagellin and tilapia IFN-γ proteins as molecular adjuvants in enhancing the immune response in tilapia when used along with the SAIV vaccine.

2.1 Experimental fish and ethics statement

Nile tilapia, weighing approximately 10 g were obtained from a commercial fish farm. Fish were placed in 100 L fiber glass tanks with density 60 fish per tank. Fish were fed with a commercial diet with 32% protein and 4% lipid twice a day for 2 weeks prior to the vaccination trial. Water quality parameters (pH 5.85–6.86, dissolved oxygen 5.1–7.7 mg/L, nitrite 0.012 ± 0.009 mg/L and ammonia 0.04–0.10 mg/L) were checked routinely and water was changed twice per week.

The experiments were performed following the guidelines of the Committee for Purpose of Control and Supervision of Experiments on Animals (CPCSEA) Registration number: 363/GO/Re/S/01/CCSEA/82. This study has been approved by Institutional Animal Ethics Committee of Cochin University of Science and Technology, Kochi, Kerala, India.

2.2 Recombinant flagellin and IFNγ production and purification

Recombinant Y. ruckeri flagellin was first produced under denaturing conditions as described previously (Wangkahart et al. 2016). Minor contaminants were further removed by Anion exchange chromatography using HiTrap Q FF column (Cytiva). The buffer system used are Buffer A (50 Tris-HCl, pH7.4, 8 M Urea) and Buffer B (4 parts Buffer A + 1 part 5 M NaCl). The purified protein was refolded in 1X phosphate buffered saline (PBS, pH 7.4) containing 500 mM Arginine and 10% glycerol and changed to storage buffer (1x PBS, pH 7.4 containing 10% glycerol) using a Protein Concentrators PES (30K MWCO Thermo Scientific™ Pierce™). The protein was quantified on SDS-PAGE using BSA as reference and was 1.13 mg/mL.

Nile tilapia IFN-γ was based on NCBI entry (acc. No. NP_001274331) and have a predicted signal peptide (1–22) and a mature peptide (amino acid 23–206). The recombinant IFN-γ has a His tag (MAHHHHHHHHGSGS) at the N-terminal followed by the mature peptide sequence of tilapia IFN-γ. The recombinant protein is 198 amino acids with a molecular weight of 22.70 kDa and a theoretical pI of 10.14. The DNA sequence was codon-optimised according to E. coli codon usage using GENEius software (Eurifins Genomics), synthesized and cloned into a pET vector, and purified under denaturing condition as described previously (Costa et al. 2011, Wang et al. 2018). Minor contaminants were further removed as described above. The buffer system used is Buffer A (50mM HEPES, pH8.0, 8 M Urea) and Buffer B (4 parts Buffer A + 1 part 5 M NaCl). The single band purified protein was refolded in PBS, pH 7.4 containing 500 mM Arginine and 10% glycerol and changed to storage buffer (PBS, pH 7.4 containing 10% glycerol) using a Protein Concentrators PES (10K MWCO Thermo Scientific™ Pierce™). The protein was quantified on SDS-PAGE using BSA as reference and was 2.35 mg/ml.

2.3 Bacterial strain and vaccine preparation

The S. agalactiae inactivated whole-cell vaccine (SAIV) was prepared in Brain Heart Infusion (BHI) Broth with shaking at 180 rpm at 30°C for 12 hours (h). The bacterial culture was inactivated by adding formalin (0.5%) to the bacterial culture, and then incubated for 24 h at 28°C. The final bacterial density obtained before formalin inactivation was 10⁹ colony forming unit (CFU)/mL. The death of bacteria was determined by the absence of growth on BHI agar plates after 48 h of incubation at 30°C. The bacterial culture was centrifuged at 5000 rpm for 30 min to get the pelleted inactive bacteria. The pellets were washed three times with PBS and was resuspended in PBS till 0.67 OD at 600 nm. Initially, the bacterin was adjusted in PBS at 2x10⁹ CFU/mL and then made different vaccine formulations with 15% bacterin, 70% oil adjuvant plus 15% proteins (protein + PBS).

2.4 Fish immunization and challenge

Fish were randomly divided into 5 groups with triplicates (25 fish per group) as detailed in Table 1. Fish were injected intraperitoneally (i.p.) with each vaccine formulation. Group 1 (G1): fish injected i.p. with 100 µL PBS (control group); Group 2 (G2): fish injected i.p. with 100 µL SAIV vaccine containing Montanide™ ISA 763A VG, Seppic, France); Group 3 (G3); fish injected i.p. with 100 µL SAIV vaccine containing flagellin; Group 4 (G4): fish injected i.p. with 100 µL SAIV vaccine containing IFN-γ; and Group 5 (G5): fish injected i.p. with 100 µL SAIV vaccine containing flagellin and IFN-γ. The SAIV formulation with Montanide™ ISA 763A VG was performed as described previously (Wangkahart et al. 2023, wangkahart et al. 2021). Booster immunization was carried out 21 days post vaccination (dpv) using the same vaccine dose.

Table 1

Treatment groups and details of experimental vaccines in the trial.
Group no.	Treatment	Abbreviation
1 2 3 4 5	Injection with PBS (control group) Injection with SAIV + Montanide™ ISA 763A VG Injection with SAIV + flagellin Injection with SAIV + IFN-g Injection with SAIV + flagellin + IFN-g	G1 G2 G3 G4 G5

For S. agalactiae challenge, fish from each experimental group were injected i.p. 36 dpv with a virulent strain (100 µL of 107 CFU/mL) of S. agalactiae. The cumulative mortality was recorded for 21 days and relative percent survival (RPS) was calculated.

2.5 Blood and tissue sample collection

After 15 and 36 dpv, fish were fasted for 24 h. Before collecting the sample, the fish were euthanized with a lethal dose of clove oil (250 ppm) and 500 µL blood was collected from the caudal vein. Blood was allowed to clot for 4 h at 4°C. Serum was collected after centrifuging the sample at 3000 rpm for 3 minutes (min) and stored at -20°C. For immune gene expression analysis, the tissues (spleen and head kidney) were collected at fixed time points (days 15 and 36) following immunization. Tissues were collected and stored in sterile tubes having 500 µL RNAlater (Bio-Rad) at − 20 ◦C until use.

2.6 Enzyme linked Immunosorbent assay (ELISA)

96–well ELISA plates (Immulon 4HBX, Thermo Scientific) were pre-treated with 50 µL of 0.05% w/v poly– L–lysine in carbonate–bicarbonate buffer (0.05 M carbonate-bicarbonate pH 9.6 (Sigma-Aldrich,UK). The plates were incubated at room temperature (RT) for 60 min. Plates were washed with PBS 3 times. One-hundred microliters bacteria at 108 CFU/mL, were added to each well and plates were incubated overnight at 4°C. The bacteria were previously prepared by growing them on TSB at 24°C for 48 h with continuous shaking at 150 rpm and pelleted. The pellet was washed 3 times with 1X PBS, resuspended and adjusted to OD₆₀₀ 1.0. The plates were washed 3 times with 1xPBS and blocked with 2% w/v Bovine serum albumin (BSA) in PBS (300 µL) at RT for 2h. Plates were washed with PBS three times followed by 3 times with PBS containing 0.05% Tween − 20 (PBST). Diluted fish serum (100 µL per well; from 1:128 ) in PBS were added to the plates and incubated overnight at 4°C. After the overnight incubation, plates were washed 5 times with PBST. Anti–tilapia IgM MAbs (Aquatic Diagnostics Ltd, UK) diluted 1:50 with 0.01% Bovine Serum Albumin (BSA) in PBS was then added to each well (100 µL), and incubated for 90 mins at 37°C. The plates were then washed 3 times with PBS and 3 times with PBST as previously described. Rabbit anti–mouse–horseradish peroxidase (HRP) conjugate (Sigma-Aldrich, UK) diluted 1:4000 with 0.01% BSA in PBS was added to the plates and incubated for 90 mins at 37°C. Chromogen in substrate buffer (prepared by adding 150 µL of chromogen 42 (3, 3’, 5, 5’ Tetra methyl-benzidine, TMB) to 15 mL of substrate buffer activated by 5 µL H₂O₂ in 6 mL of 50% acetic acid) was then added (100 µL/well) for assay development. The plates were incubated for 10 min at RT and the reaction stopped by adding 50 µL of 2M H₂SO₄. The absorbance was measured at OD₄₅₀ using a 96-well plate spectrophotometer Varioskan LUX Multimode Microplate Reader (Thermo Scientific laboratory, USA). The sensitivity threshold of the assay was determined as 3X the absorbance value of wells containing PBS (background absorbance). Samples above this value were considered positive for specific antibodies.

2.7 RNA extraction and quantitative real- time PCR (qPCR)

Spleen and head kidney tissues from 3 fish per group were collected at 15 and 36 dpv. The total RNA was extracted by Trizol method (TRIzol™, Sigma Aldrich, France) and converted to cDNA using Bio-Rad iScript™ cDNA synthesis kit (Bio-Rad) according to the manufacturer protocol. The immune related genes, including CD4, IgM, MHC-I, MHC-II, TCRβ, IL-1β, IL-6 and IL-8 were investigated by RT-qPCR method. The primers used in this study were shown in Table 3. The final volume of the RT-qPCR reaction mixture (20 µL) composed of 1 µL cDNA template, 0.5 µL of 10 µM forward primer, 0.5 µL of 10 µM reverse primer, 2 µL enzyme mixture, 4 µLRNAse-free water, and 10 µL 2X master mix. The RT-qPCR analysis was carried out using CFX 96 Touch Real Time PCR detection system (Bio-Rad, USA) and Sso Advanced Universal SYBR green supermix (Bio-Rad, USA). PCR cycling conditions were initial denaturation for 3 min at 95°C followed by 40 cycles of denaturation for 20s at 95°C, annealing for 20s at 64°C, extension for 30s at 72°C and a final extension for 5 min at 72°C. The relative gene expression of each gene was normalized to the reference gene β-actin and presented as fold change.

2.8 Histology

In order to analyse, Head kidney, spleen, liver, kidney, gills and brain were sampled and fixed with the fixative solution (10% Formalin (37–40% stock solution), 4 g/L NaH₂PO₄ and 6.5g/L Na₂HPO₄). Samples tissues were embedded in paraffin, sectioned at 5 µm, and subjected to staining with hematoxylin and eosin (H&E). Light microscopy was used to examine the tissue sections.

2.9 Immunological assays

The superoxide dismutase (SOD) activity in serum was assayed according to the protocol previously described by Paoletti et al. (Paoletti et al. 1990). The catalase (CAT) activity was assessed according to Sinha et al (Sinha et al. 1972) whereas myeloperoxidase (MPO) and lysozyme activity was measured according to the protocol reported in Wangkahart et al. (Wangkahart et al. (2023) ). The bactericidal assay was performed in sterile micro-tubes following Takahashi et al. (2013) with modifications (Takahashi et al. 2013). Briefly, 10 µL of 1 × 10⁸ CFU of S. agalactiae serotype III suspension and 10 µL of fish serum were incubated for 3 h at 37°C in a sterile microcentrifuge tube. The resulting suspension, along with a positive group made up of TSA plates containing bacteria and PBS suspension in place of the fish serum was cultivated on tryptic soy agar (TSA) and incubated overnight at 37°C. After being incubated overnight, the CFU was manually counted. The bactericidal activity was evaluated as: serum bactericidal rate (%) = (1 − the number of viable bacteria after immune serum treatment/the number of viable bacteria after PBS treatment) × 100% (Cao et al. 2018).

2.10 Statistical analysis

The efficacy of vaccines was estimated by calculating the relative percentage survival (RPS). RPS highlights the relationship between mortality in the vaccinated group and the unvaccinated group, and calculated according to Amend (1981) (Amend 1981) using the following equation:

$$\:\text{R}\text{P}\text{S}=\left[1-\left(\frac{\%\:mortality\:of\:vaccinated\:group}{\%\:mortality\:of\:control\:group}\right)\right]\:\text{x}\:100$$

A Mantel-Cox log-rank test was performed on the survival curves. Statistical analysis was performed using a one-way analysis of variance (ANOVA) and Turkey`s Multiple Range Test using IBM SPSS version 11.5 (SPSS Inc., Chicago, IL, USA) was used to perform the mean comparisons between the treatment groups and considered statistically significant at P < 0.05.

3.1 Production of recombinant flagellin and IFN-γ

Recombinant protein expression and purification under denaturing condition was described previously (Costa et al. 2011, Wang et al. 2018). Minor contaminants were further removed by ion exchange chromatography. The resulting proteins were refolded and buffer changed to a storage buffer (PBS containing 10% glycerol) and kept at -80°C freezer ready to use (Table S1). Recombinant flagellin and IFN-γ were observed on SDS PAGE with molecular sizes of 45.2 kDa and 22.7 kDa respectively (Fig. S1).

3.2 Kinetics of specific IgM antibody response

The serum samples were collected at 15 and 36 dpv and S. agalactiae-specific IgM antibody response were measured by ELISA. There is no difference on IgM titer between groups at 15 dpv, and between unvaccinated group 1 (G1) and adjuvanted vaccine G2 at 36 dpv (Fig. 1). However, specific IgM antibodies were increased in adjuvanted vaccine G3, G4 and G5 on 36 dpv. In addition, adjuvanted vaccine in G5 showed the highest IgM level amongst the adjuvanted vaccine groups and higher than adjuvanted vaccine of G3, suggesting both flagellin and IFN-γ have contributed to the increased antibody response. The expression of IgM antibodies indicates the enhanced activity of molecular adjuvants in increasing the immunity in tilapia.

3.3 Vaccine efficacy against S. agalactiae challenge

The survival rates of G1, G2, G3, G4, and G5, vaccinated group at this time were 60.00%, 28.89%, 20.00%, and 13.33%, respectively. This gave RPS value of 15.62%, 59.37%, 71.87% and 81.25% was observed for G2, G3, G4, and G5, respectively, after challenge with S. agalactiae (Fig. 2). The highest protection was observed in fish immunized with S. agalactiae adjuvanted with both flagellin and IFN-γ (Group 5).

3.4. Histological Examination

Histopathological examinations of the head kidney, spleen, liver, kidney, gills and brain were performed on fish vaccinated and control groups, the results are presented in Fig. 3 and Table 2. In short, no histological changes were apparently visible in kidney, head kidney, gills, liver and brain tissues of fish administered with SAIV adjuvanted with both flagellin and IFN-γ (Group 5). Decreased melanomacrophage cells with least inflammation was observed in spleen. Unvaccinated control group (G1) was observed with necrosis in most of the tissues. Altogether, no remarkable histological changes were observed in fish administered with SAIV with flagellin (G3) or IFN-γ (G4).

Table 2

Histopathological observations of head kidney, spleen, liver, kidney, gills and brain of fish groups G1, G2, G3, G4, G5
	G1	G2	G3	G4	G5
Head kidney	necrotic centers with hyaline degeneration	macrophages with hemorrhage	Necrotic tubular epithelial Fibrin with bacterial accumulation	No histological changes with mild infiltration.	No histological changes with mild infiltration.
Spleen	Severe multifocal necrotic splenitis with splenic necrosis	Vascular sinuses congestion	Increased inflammation observed	Increased Melano macrophage cells	Decreased Melano macrophage cells with decreased inflammation.
Liver	Necrosis and vacuolar degeneration	Liver congestion	Hepatocytes swelling and pancreatic vascular congestion with accumulation	No histological changes seen.	No histological changes seen.
Kidney	Granulomas containing necrotic centers, macrophages and fibroblast with leucocytes infiltration	necrosis in tubular epithelial cells	Fibrin precipitation with bacterial accumulation	swelling of renal tubular cells with fibroblast	No histological changes with mild infiltration.
Gills	lamellar sinusoids with congestion and multifocal hemorrhages	enlarging and congesting central venous sinus	in gill lamellar epithelial cells with mild hyperplasia	Hyperplasia in the gill lamella	No histological changes in gill and lamella.
Brain	Thickening and congestion of the meninges with inflammatory cells infiltration (arrow) with micro venous thrombosis	Hyperplasia of microglial cells show strong positive signa	Capillary swelling shows weakly positive signal	Few inflammatory cells infiltration in meninges	No histological changes

Table 3

Primers used in this study for qRT-PCR
Genes	Oligo sequence (5’-3’)	Product size (base pair)	Reference
IgM	F: GGATGACGAGGAAGCAGACT R: CATCATCCCTTTGCCACTGG	122	KJ676389
CD4	F: GCTCCAGTGTGACGTGAAA R: TACAGGTTTGAGTTGAGCTG	106	XM_025911776
MHC-I	F: TTCTCACCAACAATGACGGG R: AGGGATGATCAGGGAGAAGG	132	XM026157132
MHC-II	F: GAGGAACAAGCTCGCCATCG R: AGTCGTGCTCTGACCTCGAG	106	JN967618
TCR β	F: GGACCTTCAGAACATGAGTGCAGA R: TCTTCACGCGCAGCTTCATCTGTT	113	HM162889
IL-6	F: ACAGAGGAGGCGGAGATG R: GCAGTGCTTCGGGATAGA	161	XM_019350387
IL-8	F: GCACTGCCGCTGCATTAAG R: GCAGTGGGAGTTGGGAAGAA	135	NM001279704
IL-1β	F: AAGATGAATTGTGGAGCTGTGTT R: AAAAGCATCGACAGTATGTGAAAT	175	FF280564
β-actin	F: ACAGGATGCAGAAGGAGATCACAG R: GTACTCCTGCTTGCTGATCCACAT	155	XM003443127

3.5. Immune response parameter analysis

The antioxidant defense parameters of the vaccine groups are described in Fig. 4. The lysozyme (LZM) and catalase (CAT) activity (Fig. 4A and 4B) in serum were significantly increased in vaccinated groups at the two sampling points. We found that G5 showed the significantly higher in both the time points. The enzyme increased at 36 dpv indicated the efficacy of the booster vaccine increasing the innate defense mechanism in fish. The highest bactericidal activity was also seen in G5 in both the time points examined compared to the G1 group (Fig. 4C). Similarly, the G5 showed the significant upregulation in the SOD and MPO activities at 15 and 36 dpv (Fig. 4D and 4E).

3.6. Immune-related gene expression analysis by RT-qPCR

The RT-qPCR was performed to analyze the effect of flagellin and IFN-γ on the SAIV vaccine to enhance the cell-mediated immunity in terms of gene expression analysis in the spleen and head kidney, are shown in Fig. 5. There was no significant increased expression of the pro-inflammatory cytokine genes IL-1β, IL-6 and IL-8 in spleen and head kidney at 15 and 36 dpv, with the exception of IL-6 in head kidney where it was up-regulated in G4. No induction of expression was also observed for CD4 and TCRb. However, IgM expression was significantly increased at 36 dpv in the spleen of all vaccinated groups (G2-G5) and in the head kidney of G4 and G5 containing IFN-γ in the vaccine formulation. Increased IgM expression was also observed at 15 dpv in the head kidney of G4 and G5. A small increase of MHC-I expression was observed at 36 dpv in the spleen of G2 and G5. Remarkably, MHC-II expression was highly increased in the spleen at 36 dpv of all molecular adjuvanted groups (G3, G4 and G5) and on 15 dpv of G3. Its expression was also increased in head kidney at 36 dpv of G4 and G5.

Potential role of adjuvants is moving on with success stories in controlling bacterial diseases in fishes. Montanide^™ ISA 763A VG and Montanide^™ ISA 763B VG- developed by SEPPIC, commercial adjuvants used for i.p. injection in fish, are proved to be excellent in animal vaccines. The efficiency of these adjuvants in protection and in improving immune response (Wangkahart et al. 2023) including aluminum hydroxide, flagellin, chitosan oligosaccharide, CpG oligonucleotides, liposome, poly I:C, MARCOL 52, Freund’s complete and incomplete adjuvants, are a range of effective adjuvants tried in vaccine studies (Jiao et al. 2010, Zheng et al. 2012, Dalmo et al. 2016).

Nile tilapia aquaculture is affected by Streptococcosis caused by S. agalactiae (Dangwetngam et al.2016, Barato et al. 2015). In this study, we have analysed the effects of flagellin and IFN-γ mixed with SAIV vaccine in providing protection and enhanced immune response in Nile tilapia. Recent studies have shown up with the role of flagellin as promising vaccine adjuvant and immunostimulant for fish aquaculture. It has been observed that flagellin from Y. ruckeri, potently activate the expression of inflammatory cytokines, antimicrobial peptides and acute phase proteins in vitro and in vivo (Wangkahart et al. 2019). In vivo studies showed that there is a remarkable induction in the expression of IL-12 family members and cytokines in Th2 and Th17 pathways but have little effects in Th1 pathway following flagellin stimulation (Wangkahart et al. 2019 ).

This study emphasizes the role of flagellin and IFN-γ to boost the immune response and protective efficacy in Nile tilapia infected with S. agalactiae. The immune parameters are analysed post vaccination. We administered vaccine through injection mode and fishes were injected with a booster at 21 dpv. Fish serum samples were collected at two time points (15 dpv and 36 dpv), before booster and after booster respectively. It was observed that the SOD and CAT activity in serum was remarkably enhanced in the fish administered with SAIV adjuvanted with flagellin and IFN-γ. The same effect was observed in the activities of LZM and MPO. The enhancement in the innate immune parameters was observed after booster vaccination at 36 dpv. LZM activity is essential in non-specific immune response in the fish and enhancement in immune response and is crucial to fight the invading bacteria (Ashfaq et al.2019). We also tested serum bactericidal activity post vaccination and found that higher levels of its activity in fish treated with SAIV adjuvanted with flagellin and IFN-γ. This finding further supports the related outcome from the previous studies where adjuvanted vaccines enhancing non-specific immune response in the fishes with their potential bactericidal activity accompanied by elevated LZM activity, complement factors and other associated molecules (Ellis 1999, Hoare et al. 2019).

Specific antibody production is a measure of preventing bacterial infection and we examined the specific IgM antibody levels since it is the main antibody in the teleost fish (Ye et al. 2013). ELISA is a widely used sensitive method for the detecting and quantifying specific humoral antibody response to fish pathogens (Ristow et al. 1993). Vaccinated fishes are examined for humoral immune response by detecting and quantifying specific IgM antibodies in the sera post vaccination on 15 dpv and 36 dpv. We observed that specific IgM antibody level were enhanced in fish sera vaccinated with SAIV adjuvanted with flagellin, IFN-γ and its combination (G3, G4 and G5 respectively) when compared to negative control (G1) and positive control (G2) groups. Enhanced IgM antibody levels were significantly elevated in the fish sera at 36 dpv. The findings clearly indicate the potential role of molecular adjuvants in stimulating the humoral immunity in fish which again promisingly support the previous data where adjuvants enhance the immune response in tilapia infected with S. agalactiae (Wangkahart et al. 2023, Wangkahart et al. 2021). It was observed that specific IgM antibodies level were increased in SAIV vaccine adjuvanted with Montanide 763A VG and 763B VG. The IgM antibody level in these groups were also increased at an early stage (Wangkahart et al. 2023 ).

The role flagellin and IFN-γ in enhancing the efficacy of SAIV vaccine in conferring protection was measured. Many studies have proved a consistent correlation between the high expression of specific antibodies and protective efficacy of vaccine (Wangkahart et al. 2021). The RPS value of 59.37%, 71.87% and 81.25% was observed for SAIV vaccine adjuvanted with flagellin, IFN-γ and its combination, respectively, while the RPS of the positive control group was 15.62%. The RPS of fish injected with vaccine adjuvanted with both flagellin and IFN-γ showed enhanced protection. The protective efficacy of flagellin was already studied (Wangkahart et al. 2019) and the present finding is found to be in accordance with the earlier observation. An enhanced RPS was observed in fish injected with SAIV adjuvanted with Montanide 763A VG (77.42%) and Montanide 763B VG (74.19%) when compared to the unadjuvanted vaccine control group (61.29%) (Wangkahart et al. 2023). In another study, survival rate of fish administered with S. agalactiae ghost vaccine (SAGV) adjuvanted with Montanide 763B VG (80.0%), SAGV with Montanide GEL02 (84.4%) was found to be improved when compared to control group which was only 33.3% (Wangkahart et al. 2021). Our findings are supporting the previous studies with the analogous observations.

The histopathological examinations of head kidney, spleen, liver, kidney, gills and brain were performed in vaccinated and non-vaccinated fish. No histological changes were observed significantly in the head kidney, kidney, gills, liver and brain tissues of the fish vaccinated with SAIV adjuvanted with both flagellin and IFN-γ and challenged with S. agalactiae whereas decreased melanomacrophage cells was observed in the spleen tissues.

Immune related gene expression analysis remains well linked with the fish vaccination studies giving insights to the disease resistance offered by the respective vaccine administered. In this study, the expression levels of eight adaptive immune-related genes in spleen and head kidney of fish following immunization, such as CD4, IgM, MHC-I, MHC-II, TCRb, and innate immune response, such as IL-1β, IL-6 and IL-8 were analyzed to see whether the molecular adjuvants flagellin and IFN-γ affected their expression in vaccinated fish. There were no upregulation of the expression of major proinflammatory cytokines at 15 dpv and 36 dpv., suggesting that the fish at these time points retained to resting state without heightened inflammation or due to trafficking of inflammatory cells from tissues to the vaccination site. Interestingly, the expression of both MHC-II and IgM was coordinately increased at 36 dpv in the spleen of adjuvanted vaccines fish and in the head kidney in IFN-γ containing vaccine groups. The heightened transcript expression of IgM is in agreement of the increased specific IgM antibody titer in molecular adjuvanted vaccine groups found in this study. MHC-II molecules are constitutively expressed on the surface of professional antigen-presenting cells (APCs), including dendritic cells, B cells and macrophages, and can be upregulated by IFN-γ leading to antigen presentation to CD4⁺ T cells and immune activation (Wijdeven et al. 2018). It is noteworthy that MHC-II expression in head kidney was only heighten in IFN-γ containing vaccine groups and these groups also showed higher antibody titer and protection against live bacterial infection, implying different mechanisms initiated by flagellin and IFN-γ. Our study suggests that MHC-II upregulated by IFN-γ present processed peptide to CD4⁺ T cells leading to activation and differentiation into T helper cell subsets and specific antibody response and protection.

This study suggests that both flagellin or IFN-γ alone or in combination can improve the efficacy of SAIV vaccine against S. agalactiae infection in Nile tilapia. The combination of flagellin and IFN-γ had better effects by providing different signals to activate the vaccine immune response where IFN-γ upregulated the expression of MHC-II that present processed peptide to CD4⁺ T cells leading to activation and differentiation into T helper cell subsets and specific antibody response and protection. The findings emphasize safe potential approach for vaccination strategies employing novel vaccines incorporating molecular adjuvants, providing protection to fish and inducing protective immunity against infectious bacterial diseases.

Conflicts of Interest

The authors declare no conflict of interest.

Author Contribution

Sreeja Lakshmi: Conceptualization, Methodology, Formal analysis, Writing-original draft, Writing-review and editing, funding acquisition. Nandhakumar: Methodology, Formal analysis. Ritam Guha: Methodology, Formal analysis. Alex Wang: Methodology, Formal analysis. EakapolWangkaghart: Conceptualization, Methodology, Data curation, Writing- review and editing, supervision, funding acquisition. Tiehui Wang: Conceptualization, Methodology, Data curation, Writing- review and editing, supervision, funding acquisition. Preetham Elumalai: Conceptualization, Methodology, Data curation, Writing- review and editing, supervision, project administration, funding acquisition.All authors have read and agreed to the current version of the manuscript.

Acknowledgement

The authors express profound gratitude for the financial assistance provided by the BactiVac Catalyst Programme (BVNCP7-26) for the study.This work was supported by the Bacterial Vaccines (BactiVac) Network funded by the GCRF Networks in Vaccines Research and Development, which was co-funded by the MRC and BBSRC.

Data availability

The data that has been used is confidential.

Aich N, Paul A, Choudhury TG, Saha H (2022) Tilapia lake virus (TiLV) disease: Current status of understanding. Aquac Fish 7:7–17. https://doi.org/10.1016/j.aaf.2021.04.007
Ashfaq H, Soliman H, Saleh M, El-Matbouli M (2019) CD4: A vital player in the teleost fish immune system. Vet Res 50: 1–11 https://doi.org/10.1186/s13567-018-0620-0
Amend DF (1981) Potency testing of fish vaccines. Devel Biol Standardization 49: 447–454.
Barato P, Martins ER, Melo-Cristino J, Iregui CA, Ramirez M (2015) Persistence of a single clone of Streptococcus agalactiae causing disease in tilapia (Oreochromis sp.) cultured in Colombia over 8 years. J Fish Dis 38: 1083–1087. https://doi.org/10.1111/jfd.12337
Biller-Takahashi JD, Takahashi LS, Pilarski F, Sebastião FA, Urbinati EC (2013) Serum bactericidal activity as indicator of innate immunity in pacu Piaractusmesopotamicus (Holmberg, 1887). ArquivoBrasileiro de MedicinaVeterinária e Zootecnia 65:1745–1751. https://doi.org/10.1590/S0102-09352013000600023
Buentello JA, Reyes-Becerril M, de Jesús Romero-Geraldo M, de Jesús Ascencio-Valle F (2007) Effects of Dietary Arginine on Hematological Parameters and Innate Immune Function of Channel Catfish. J Aquat Anim Health 19:195–203. https://doi.org/10.1577/H07-004.1
Chettri JK, Raida MK, Holten-Andersen L, Kania PW, Buchmann K (2011) PAMP induced expression of immune relevant genes in head kidney leukocytes of rainbow trout (Oncorhynchus mykiss). Dev Comp Immunol 35: 476–482. https://doi.org/10.1016/j.dci.2010.12.001
Costa MM, Maehr T, Diaz-Rosales P, Secombes CJ, Wang T (2011) Bioactivity studies of rainbow trout (Oncorhynchus mykiss) interleukin-6: effects on macrophage growth and antimicrobial peptide gene expression. Mol Immunol, 48:1903–1916. https://doi.org/10.1016/j.molimm.2011.05.027
Dalmo R, Bøgwald J, Tafalla C (2016) Adjuvants and Delivery Methods: Current and Novel. In: A Adams (ed) Fish Vaccines Springer, pp 75–103. https://doi.org/10.1007/978-3-0348-0980-1_4
Dangwetngam M, Suanyuk N, Kong F, Phromkunthon W (2016) Serotype distribution and antimicrobial susceptibilities of Streptococcus agalactiae isolated from infected cultured tilapia (Oreochromis niloticus) in Thailand: Nine-year perspective. Int J Med Microbiol 65:247–254. https://doi.org/10.1099/jmm.0.000213
Ellis AE (1999) Immunity to bacteria in fish. Fish & Shellfish Immunol 9: 291–308. https://doi.org/10.1006/fsim.1998.0192
Germain RN (2002) T-cell development and the CD4–CD8 lineage decision. Nat Rev Immunol 2: 309–322. https://doi.org/10.1038/nri798
Hambrey J (2017) The 2030 agenda and the sustainable development goals: the challenge for aquaculture development and management. FAO fisheries and aquaculture circular, C1141.
Hayashi F, Smith KD, Ozinsky A, Hawn TR, Yi EC, Goodlett DR, Eng JK, Akira S, Underhill DM, Aderem A (2001) The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature 410:1099–1103. https://doi.org/10.1038/35074106
Hoare R, Jung SJ, Ngo TPH, Bartie KL, Thompson KD, Adams A (2019) Efficacy of a polyvalent injectable vaccine against Flavobacterium psychrophilum administered to rainbow trout (Oncorhynchus mykiss L.). J Fish Dis 42: 229–236. https://doi.org/10.1111/jfd.12919
Hynes NA, Furnes C, Fredriksen BN, Winther T, Bøgwald J, Larsen A N, Dalmo RA (2011) Immune response of Atlantic salmon to recombinant flagellin. Vaccine 29:7678–7687. https://doi.org/10.1016/j.vaccine.2011.07.138
Jiao X, Cheng S, Hu Y, Sun L (2010) Comparative study of the effects of aluminum adjuvants and Freund’s incomplete adjuvant on the immune response to an Edwardsiella tarda major antigen. Vaccine 28: 1832–1837. https://doi.org/10.1016/j.vaccine.2009.11.083
Jorge S, Dellagostin OA (2017) The development of veterinary vaccines: a review of traditional methods and modern biotechnology approaches. Biotechnol Res Innovat 1: 6–13. https://doi.org/10.1016/j.biori.2017.10.001
Klesius PH, Shoemaker CA, Evans JJ (2008) Streptococcus: a worldwide fish health problem. In Proceedings of the 8th International Symposium on Tilapia in Aquaculture, Ag. Press Unit Abbassa, Egypt, pp. 83–107.
Kobayashi M, Msangi S, Batka M, Vannuccini S, Dey MM, Anderson JL (2015) Fish to 2030: The Role and Opportunity for Aquaculture. Aquac Econ Manag 19: 282–300. https://doi.org/10.1080/13657305.2015.994240
Liu F,Dixon B, Ortega-Villaizan MM, Tafalla C, Xu H, Secombes CJ,Wang T (2023) Novel insights into the cytokine network of rainbow trout Oncorhynchus mykiss using cell lines and primary leukocyte populations. Fish & Shellfish Immunol 137:108755. 10.1016/j.fsi.2023.108755
Langemann T, Koller VJ, Muhammad A, Kudela P, Mayr UB, Lubitz W (2010) The bacterial ghost platform system: Production and applications. Bioeng Bugs 1: 326–336. https://doi.org/10.4161/bbug.1.5.12540
Lie K, Somamoto T, Moore TL, Dijkstra JC, Hordvik I (2005) Characterisation of salmon and trout CD8α and CD8β. Mol Immunol 42: 1225–1234. https://doi.org/10.1016/j.molimm.2004.11.017
Munang’andu HM, Paul J, Evensen Ø (2016) An Overview of Vaccination Strategies and Antigen Delivery Systems for Streptococcus agalactiae Vaccines in Nile Tilapia (Oreochromis niloticus). Vaccines 4:48. https://doi.org/10.3390/vaccines4040048
Paoletti F, Mocali A, Aldinucci D (1990) Superoxide-driven NAD (P) H oxidation induced by EDTA-manganese complex and mercaptoethanol. Chemico-biological interactions 76:3–18. https://doi.org/10.1016/0009-2797(90)90030-Q
Ristow SS, De Avila J, Lapatra S E, Lauda K (1993) Detection and characterization of rainbow trout antibody against infectious hematopoietic necrosis virus. Dis Aquat Org 15: 109–109.
Romstad AB, Reitan LJ, Midtlyng P, Gravningen K, Evensen Ø (2013) Antibody responses correlate with antigen dose and in vivo protection for oil-adjuvanted, experimental furunculosis (Aeromonas salmonicida subsp. salmonicida) vaccines in Atlantic salmon (Salmo salar L.) and can be used for batch potency testing of vaccines. Vaccine 31: 791–796.
Sinha AK (1972) Colorimetric assay of catalase. Anal Biochem 47: 389–394. https://doi.org/10.1016/0003-2697(72)90132-7
Su H, Su J (2018) Cyprinid viral diseases and vaccine development. Fish Shell Fish Immunol 83:84–95. https://doi.org/10.1016/j.fsi.2018.09.003
Velázquez J, Acosta J, Herrera N, Morales A, González O, Herrera F, Estrada MP, Carpio Y (2017) Novel IFNγ homologue identified in Nile tilapia (Oreochromis niloticus) links with immune response in gills under different stimuli. Fish Shell Fish Immunol 71:275–285. https://doi.org/10.1016/j.fsi.2017.10.014
Wang C, Hu YH, Chi H, Sun L (2013) The major fimbrial subunit protein of Edwardsiella tarda: vaccine potential, adjuvant effect, and involvement in host infection, Fish & Shellfish Immunol. 35:858–865. https://doi.org/10.1016/j. fsi.2013.06.021.
Wang T, Hu Y, Wangkahart E, Liu F, Wang A, Zahran E, Maisey KR, Liu M, Xu Q, Imarai M, Secombes CJ (2018) Interleukin (IL)-2 Is a Key Regulator of T Helper 1 and T Helper 2 Cytokine Expression in Fish: Functional Characterization of Two Divergent IL2 Paralogs in Salmonids. Front Immunol 9:1683. https://doi.org/10.3389/fimmu.2018.01683
Wangkaghart E, Deville S, Wang B, Srisapoome P, Wang T, Secombes CJ (2021) Immune response and protective efficacy of two new adjuvants, Montanide^™ ISA 763B VG and Montanide^™ GEL02, administered with a Streptococcus agalactiae ghost vaccine in Nile tilapia (Oreochromis niloticus). Fish Shell Fish Immunol 116:19–29. https://doi.org/10.1016/j.fsi.2021.06.014
Wangkahart E, Bruneel B, Chantiratikul A, de Jong M, Pakdeenarong N, Subramani PA (2022) Optimum dietary sources and levels of selenium improve growth, antioxidant status, and disease resistance: re-evaluation in a farmed fish species, Nile tilapia (Oreochromis niloticus). Fish Shell Fish Immunol 121:172–182. https://doi.org/10.1016/j.fsi.2021.12.003
Wangkahart E, Scott C, Secombes CJ, Wang T (2016) Re-examination of the rainbow trout (Oncorhynchus mykiss) immune response to flagellin: Yersinia ruckeri flagellin is a potent activator of acute phase proteins, anti-microbial peptides and pro-inflammatory cytokines in vitro. Dev Comp Immunol 57: 75–87. https://doi.org/10.1016/j.dci.2015.12.017
Wangkahart E, Secombes CJ, Wang T (2019) Studies on the Use of Flagellin as an Immunostimulant and Vaccine Adjuvant in Fish Aquaculture. Front Immunol 9:3054. https://doi.org/10.3389/fimmu.2018.03054
Wangkahart E, Thongsrisuk A, Vialle R, Pholchamat S, Sunthamala P, Phudkliang J, Srisapoome P, Wang T, Secombes CJ (2023) Comparative study of the effects of Montanide™ ISA 763A VG and ISA 763B VG adjuvants on the immune response against Streptococcus agalactiae in Nile tilapia (Oreochromis niloticus). Fish Shell Fish Immunol 134:108563. https://doi.org/10.1016/j.fsi.2023.108563
Wijdeven RH, van Luijn M M, Wierenga-Wolf AF, Akkermans JJ, van den Elsen PJ, Hintzen RQ, Neefjes J (2018) Chemical and genetic control of IFNγ‐induced MHCII expression. EMBO Rep, 19:e45553. https://doi.org/10.15252/embr.201745553
WorldBank Fish to 2030 (2013). Prospects for fisheries and aquaculture. Agriculture and Environmental Servics Discussion Paper. 03 http://hdl.handle.net/10986/17579.
Ye J, Kaattari IM, Ma C, Kaattari S (2013) The teleost humoral immune response. Fish Shellfish Immunol, 35:1719–1728. https://doi.org/10.1016/j.fsi.2013.10.015
Zhao Y, Shao F (2015) The NAIP–NLRC4 inflammasome in innate immune detection of bacterial flagellin and type III secretion apparatus. Immunol Rev, 265: 85–102. https://doi.org/10.1111/imr.12293
Zheng Z, Yingeng W, Qingyin W, Nannan D, Meijie L, Jiangbo Q, Bin L, Lan W (2012) Study on the immune enhancement of different immunoadjuvants used in the pentavalent vaccine for turbots. Fish Shellfish Immunol 32: 391–395. https://doi.org/10.1016/j.fsi.2011.11.014

No competing interests reported.

Download PDF

Reviews received at journal
21 Nov, 2024
Reviewers agreed at journal
21 Oct, 2024
Reviewers agreed at journal
15 Oct, 2024
Reviewers invited by journal
03 Oct, 2024
Editor assigned by journal
02 Oct, 2024
Submission checks completed at journal
06 Sep, 2024
First submitted to journal
23 Aug, 2024

You are reading this latest preprint version

Analysis of the efficacy of two molecular adjuvants,flagellin and IFN-γ,on the immune response against Streptococcus agalactiae in Nile tilapia (Oreochromis niloticus)

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials and Methods

2.1 Experimental fish and ethics statement

2.2 Recombinant flagellin and IFNγ production and purification

2.3 Bacterial strain and vaccine preparation

2.4 Fish immunization and challenge

2.5 Blood and tissue sample collection

2.6 Enzyme linked Immunosorbent assay (ELISA)

2.7 RNA extraction and quantitative real- time PCR (qPCR)

2.8 Histology

2.9 Immunological assays

2.10 Statistical analysis

3. Results

3.1 Production of recombinant flagellin and IFN-γ

3.2 Kinetics of specific IgM antibody response

3.3 Vaccine efficacy against S. agalactiae challenge

3.4. Histological Examination

3.5. Immune response parameter analysis

3.6. Immune-related gene expression analysis by RT-qPCR

4. Discussion

Conclusion

Declarations

Conflicts of Interest

Author Contribution

Acknowledgement

Data availability

References

Additional Declarations

Supplementary Files

Status:

Version 1