Novel Epitope-Based Diagnostic Probes Selected by Phage Display for the Serological Detection of HDV

doi:10.21203/rs.3.rs-4966269/v1

Download PDF

Article

Novel Epitope-Based Diagnostic Probes Selected by Phage Display for the Serological Detection of HDV

https://doi.org/10.21203/rs.3.rs-4966269/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

HDV is associated with the worst prognosis of viral hepatitis and there is a considerable lack of testing for HDV in patients. Phage display was used to select HDV mimetic peptides through biopanning, followed by DNA sequencing and phage-ELISA. Based on the sequences of the selected peptides, we constructed a recombinant protein (rHDV) for use in an Enzyme-Linked Immunosorbent Assay (ELISA). We validated the test with 87 samples (anti-HDV+) and 93 HBV controls collected from a public diagnosis laboratory in the Amazon. HDV RNA detection and sequencing were performed, and statistical analysis was conducted to determine the reactivity of the peptides and protein. rHDV exhibits a sensitivity of 74.71%, a high specificity of 97.85%, and an area under the curve (AUC) of 0.8906. According to analyses of patients with active infection, the detection parameters improved, with a sensitivity of 88.0%, specificity of 98.92%, and AUC of 0.96. In this context, the application of rHDV in an ELISA was effective at discriminating patients with hepatitis D and monoinfected patients with hepatitis B, highlighting the potential use of another efficient, fast, portable, and inexpensive platform for HDV detection.

Biological sciences/Biotechnology

Biological sciences/Immunology

Hepatitis delta virus

Phage display

Diagnostic

ELISA.

Hepatitis delta virus (HDV) is a small spherical virus has a negative single-stranded circular RNA genome that exclusively encodes HDAg proteins. This protein can be present in small (S-HDAg) and large (L-HDAg) forms. The virus envelope is composed of the hepatitis B virus (HBV) protein HBsAg, a single biological property¹. HDV is often classified as a satellite virus of hepatitis B virus (HBV) as HDV cannot efficiency complete its replication cycle in the absence of HBV². There are eight HDV subtypes, and these subtypes exhibit high diversity with intergenotype homology ranging from 80–85% and distinct geographic distributions. In this context, the HDV-1 genotype is the most prevalent genotype globally and may be the precursor of all other genotypes. Compared to the other genotypes, the HDV-3 genotype, which is found only in South America, exhibits the most significant divergence^3,4. However, the global prevalence of HDV remains uncertain. The estimate of people infected by hepatitis delta varies according to the study from 12–72 million people⁵.

Chronic hepatitis D infection is associated with the worst prognosis of viral hepatitis and a high risk of developing liver cirrhosis, hepatocellular carcinoma, and liver-related death^5,6. Thus, the diagnosis of HDV is recommended for all patients with chronic HBV infection⁷. Although mandatory, there is a considerable lack of testing for HDV in patients with chronic HBV infections, especially in developing countries in which HDV is endemic, due to a lack of resources⁸; as a result, hepatitis delta can be underestimated⁷, highlighting the critical importance of formulating alternative tools for screening HDV.

Phage display is a technology that involves using a combinatorial library of bacteriophages that express a high variety of peptides, which bind to specific targets through intermolecular interactions, providing peptides with high affinity and specificity^9,10. The selection process is called biopanning, which removes low-affinity molecules and selects molecules with high-affinity binding^11,12. High-affinity bacteriophages can be amplified and characterized by sequencing to identify peptide sequences¹¹. In this context, we used phage display technology to select and synthesize HDV mimetic molecules recognized by anti-HDV antibodies for application in an immunoenzymatic platform, with the aim of detecting hepatitis delta.

2.1 Phage-ELISA and sequence analysis

After 3 rounds of biopanning, 80 samples presented valid sequences (without sequence errors), with 46 unique sequences (Supplementary Table S1). The 46 phages were subjected to an immunoreactivity test by phage-ELISA (Fig. 1). Some clones exhibited substantial reactivity, as the reactivity ratio of the clones ranged from 2–3 in 25 when absorbances from pooled samples of anti-HDV + patients were compared to those from HBV control patients. Additionally, 6 clones demonstrated a reactivity ratio of ≥ 3.

2.2 Alignments of phage clones with the reference HDV protein sequence

Linear alignment of the phage clone sequences of the L-HDAg protein indicated that HD32, HD35, HD25, HD37, HD3, HD30, HD10, HD1, HD4, HD44, HD40, HD2, HD19, HD39, HD6, HD15 and HD31 aligned with the 63–85 portion of the L-HDAg protein (Fig. 2). The peptides HDAg1, HDAg2 and HDAg3 were synthesized based on the alignment. The L-HDAg protein sequence was used to evaluate the B-cell epitopes, and we observed that 63–85 kDa was antigenic (Supplementary Fig. S1).

2.3 In silico analyses- L-HDAg modeling and alignment

The trRosetta model for the L-HDAg structure included all the sequence, and it was possible to verify that the whole structure was completely compact and folded into helices. Structural alignment between the AI and homologous L-HDAg models revealed that the region of the L-HDAg sequence between the amino acids GLY 12 and LYS 61 modeled in Phyre2 is very similar to the trRosetta structure, which may indicate a more conserved portion of these structures. The 3D structure of L-HDAg aligned with the peptides HDAg1 and HDAg2 showed that the epitopes selected mimicked the immunogenic region of L-HDAg (Fig. 3).

2.4 Immunoreactivity of the synthetic peptides and recombinant proteins in serum

The reactivity of the three synthetic peptides (HDAg1, HDAg2, and HDAg3) was compared via ELISA, and we observed that the HDAg3 peptide exhibited better reactivity. Therefore, the HDAg3 peptide was selected for use in subsequent experiments. Two different serum concentrations (1:100, 1:250) and two HDAg3 concentrations (200 ng and 1 µg) were evaluated in 10 positive anti-HDV + serum samples and 10 HBV control samples for test standardization (Supplementary Fig. S2). As a result, the synthetic peptide HDAg3 differentiated pooled samples of serum from anti-HDV-positive patients and hepatitis B patients.

In this context, we selected HDAg3 for additional analysis through using individual sera from 87 positive anti-HDV + samples and 93 positive control blood samples; the results showed 81.72% specificity, 57.47% sensitivity, and an AUC of 0.717 (Fig. 4.A and 4.B). Subsequently, we assessed reactivity using an ELISA test based on the recombinant protein HDV. The results demonstrated an increase in detection parameters, with a sensitivity of 74.71%, specificity of 97.85%, and AUC of 0.8906 when utilizing the same serum samples (Fig. 4.C and 4.D). This result highlights the benefit of using the recombinant protein HDV.

Active infection can be evaluated by performing molecular assays to detect HDV RNA¹³. To evaluate our recombinant protein rHDV in samples from patients with active infection, we used 50 samples from patients who received positive HDV RT‑qPCR results compared to those from 93 HBV controls. This new approach achieved an AUC of 0.9665, which yielded 88.0% sensibility and 98.92% specificity (Fig. 4.E and 4.F). Additionally, we analyzed the genotypes of these samples, resulting in the classification of 32 patients as genotype 3 (HDV-3) (Supplementary Table S2).

A novel immunodiagnostic platform for hepatitis D detection was developed based on novel HDV antigenic epitopes selected by phage display; this platform that recognizes anti-HDV antibodies and has the potential to significantly impact the detection rate of hepatitis D, enabling early diagnosis, timely initiation of treatment, and improvements in quality of life. The efficiency of this novel recombinant protein, rHDV, was tested in an active infection scenario with 50 serum samples from patients with active hepatitis delta and 93 samples from patients with hepatitis B; as a result, the protein achieved an impressive AUC of 0.9665, with a sensitivity of 88% and an outstanding specificity of 98.92%. When 87 serum samples from patients with hepatitis delta (anti-HDV positive) and 93 samples from patients with hepatitis B were tested, the recombinant protein rHDV applied in an ELISA-based immunodiagnostic platform achieved an AUC of 0.8906 with a sensitivity of 74.71% and specificity of 97.85%.

HDV infection is a neglected disease with a high prevalence in low- and middle-income countries (LMICs)¹⁴. In Brazil, hepatitis D is more prevalent in the Amazon region, impacting mainly isolated riverside and indigenous populations¹⁵. Due to the limited availability of diagnostic tests for hepatitis D in LMICs, disease incidence is underestimated and timely diagnosis is impaired, leading to delays in the onset of treatment^8,16. The present study employed phage display technology to establish a screening platform based on HDV mimetic molecules that interact with anti-HDV antibodies for application in HDV immunodiagnostic platforms. Phage reactivity was screened in the phage-ELISA to select the best-performing clones for differentiating hepatitis delta patients (anti-HDV positive) from hepatitis B patients (Fig. 1). Then, phage-ELISA was used to develop a novel diagnostic platform for visceral leishmaniasis (VL) in human serum¹⁷. In the present study, we performed phage-ELISA with pooled samples and validated this novel HDAg3 synthetic peptide and recombinant protein based on selected phage sequences.

The sequences of the peptide phages were aligned with L-HDAg using the Clustal Omega alignment tool (Fig. 2). The L-HDAg protein was previously used as a target for diagnosis in other studies. In this context, an HDV lateral flow test for detecting anti-HDV antibodies used recombinant L-HDAg with 25 kDa His-tagged protein in serum and plasma¹⁸. Another serology assay to detect IgG against HDV with the ARCHITECT immunoassay instrument (Abbott Diagnostics, Abbott Park, IL) was tested in 15 samples from RNA HDV-positive samples using a peptide from the overlapping region of L-HDAg (aa 64–85), which detected 14 of 15 samples¹⁹.

L-HDAg is an immunogenic protein that induces oxidative stress and activates NF-κB and STAT-3, leading to the dysregulation of inflammation, apoptosis, and invasion of the immune system²⁰. The selected sequence of L-HDAg used in the present study was an epitope region (the region of antigens that binds to antibodies) (Supplementary Fig. S1)²¹ identified by Bepipred-Linear Epitope prediction 2.0. The 3D structure of L-HDAg was not available in the RCSB Protein Data Bank. The present study also pioneered the modeling of the L-HDAg protein using the TrRosetta and Phyre 2 programs. As depicted in Fig. 4, the synthetic peptides overlapped in the epitope region of L-HDAg according to linear epitope prediction 2.0 analysis. This amino acid region (63–85) of the L-HDAg protein was previously validated as an immunogenic region^19,22,23, which confirms the potential of rHDV as a molecule for use in platforms to diagnose hepatitis deltas.

The reactivity of the peptides HDAg1, HDAg2, and HDAg3 was evaluated via ELISA, and HDAg3 was effectively detected hepatitis delta disease (anti-HDV+) in serum samples from hepatitis B patients. In this large-scale study, the HDAg3-based platform was validated using samples from 87 hepatitis Delta patients (anti-HDV+) and 93 hepatitis B patients, for which a specificity of 81.72%, sensitivity of 57.47%, AUC of 0.7170 were achieved. The HDAg3 sequence was used to construct the recombinant protein rHDV with additional modifications. Subsequently, an ELISA was conducted to compare samples from hepatitis Delta patients (anti-HDV+) with those from hepatitis B patients, and a sensitivity of 74.71%, high specificity of 97.85%, and AUC of 0.8906 were attained (Fig. 4). Based on these results, the recombinant protein shows potential for application in clinical screening tests to control the spread of the disease.

Anti-HDV antibodies are also indicative of patient exposure to the virus in immunocompetent people⁵, and the hallmark of active HDV infection is RNA detection via molecular biology. When we evaluated only samples that were HDV RNA positive, the rHDV protein-based ELISA achieved a sensitivity of 88.0%, specificity of 98.92%, and AUC of 0.9665 with 50 serum samples of active hepatitis delta and 93 samples from hepatitis B patients (Fig. 4). Our test demonstrated efficacy in screening patients with active HDV infection.

According to the genotypic analysis of our samples, all samples presented genotype 3 (Supplementary Table S2); this genotype is predominantly found in South America, notably in the western Amazon basin, and is associated with the most severe liver disease²⁴. For applications in an immunoenzymatic platform to detect hepatitis delta, this test should be further evaluated with another genotype.

Here, using an immunoenzymatic platform, we showed that the HDV mimetic molecule, which interacts with anti-HDV antibodies via phage display technology, is a promising alternative for HDV detection. Our innovative diagnostic approach based on recombinant rHDV protein has the potential to significantly improve the detection rate of hepatitis Delta virus infection, allowing for early diagnosis, timely initiation of treatment, and improvements in the overall quality of life of patients. Notably, this breakthrough can reduce the economic costs associated with hepatitis delta diagnostics in healthcare services globally. Moreover, this approach is particularly significant for the Amazon region and in low- and middle-income countries, in which the prevalence of hepatitis delta disease has been underestimated due to limited diagnostic availability. This study highlights the potential use of another efficient, fast, portable, and inexpensive platform for HDV detection.

5.1 Samples and ethical aspects

Two hundred blood serum samples were obtained from a public diagnosis laboratory in the Brazilian Amazon. Samples were grouped according to their serologic status: Group 1 – HBsAg, anti-HBc total, anti-HBs, and anti-HCV negative; Group 2 – HBsAg, anti-HCV, anti-HBc total negative and positive anti-HBs positive; Group 3 (HBV Control) – HBsAg positive and anti-HDV negative; and Group 4 (anti-HDV+) – HBsAg and anti-HDV positive. Ethical approval was obtained (CAAE: #44208621.2.0000.5152). For details, check supplementary data materials and methods.

5.2 Phage display

5.2.1 Coupling of IgGs in protein G magnetic beads

For the phage display selection cycles, magnetic protein G-coupled Dynabeads™ (Life Technologies Corporation®, Carlsbad, CA, USA) for IgG antibody coupling were used following manufacturer's guidelines, with some modifications.

5.2.2 Biopanning

The biopanning process involved selecting and amplifying HDV mimetic peptides. For selection, 10 µL of viral suspension (2x10¹¹ phages) from a Ph.D.-C7C library of phage-fused peptides (New England Biolabs, Beverly, MA, USA) was diluted in 190 µL of 0.1% PBS-T to select ligands for IgG from HDV-positive patients. The phage library contains 7 random amino acids that are expressed in the pIII region of the bacteriophage and are flanked by a pair of cysteine residues, which form a disulfide bond during phage assembly. Selection was performed with 20 µL of protein G microspheres bound to immunoglobulins from the 4 different groups. For this purpose, three negative selections were performed. The phage library was successively incubated (for 30 minutes at room temperature) with pooled samples from Group 1, and the unbound phage particles were subsequently transferred to pooled samples from Group 2 and Group 3, followed by positive selection with pooled samples from the anti-HDV + Group 4 group. Then, the beads were washed 10 times with 0.1% PBS-T, after which the supernatant was discarded. Acid elution was performed by adding 500 µL of 0.2 M glycine (pH 2.2) and incubating the solution for 10 minutes. The supernatant was removed and neutralized with 75 µl of Tris-HCl (pH 9.1). After the selection phase, the elutes were amplified using the E. coli ER2738 strain (New England Biolabs, Beverly, MA, USA), which was purified with 20% polyethylene glycol (PEG)/2.5 M NaCl and suspended in PBS. Three rounds of biopanning were performed. After each round, titration was performed to determine the input and output of the viral particles during the selection cycle. For all titrations, 1.0 µL of phage was diluted in 9.0 µL of LB culture medium. Nonamplified eluates were diluted by 10^− 1 to 10^− 4, and amplified phages were diluted by 10^− 8 to 10^− 11. The diluted solutions were incubated with 200 µL of the E. coli ER2738 strain in mid-log phase (OD600 ~ 0.5) for 5 minutes and plated in Luria–Bertani (LB) medium supplemented with 840 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) and 49 mM 5-bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal) in combination with 3.0 mL of Top Agar. After incubating for 18 hours at 37°C, the phage-infected E. coli ER2738 colonies appeared blue¹⁰ (Fig. 5).

5.2.3 DNA extraction and sequencing of phages

The phages were isolated by 3° titration and grown overnight in deepwell plates supplemented with 1.2 mL of early-log-phase ER2738 culture (OD600 ~ 0.03). DNA extraction was performed as previously described [15,18]. DNA sequencing was performed with the DNA of the selected phages using a BigDye® Terminator v3.1 Cycle Sequencing Kit on an ABI 3730xl Genetic Analyzer (Applied Biosystems, Foster City, California) at BPI Biotecnologia® (Botucatu, São Paulo, Brazil). The peptide sequences were deduced according to the nucleotide sequences and analyzed using ExPASy (https://web.expasy.org/translate/).

5.2.4 Phage-ELISA

Microtiter plates (NUNC Maxisorp) were coated with anti-M13 monoclonal antibody (GE Healthcare) diluted bicarbonate buffer. Plates were subsequently washed and blocked and then incubated with phage supernatant. Subsequently, plates were incubated with a pool of serum from hepatitis B control patients and anti-HDV + followed by incubation with HRP-conjugated anti-human IgG and revelation with ortho-phenylenediamine (OPD) buffer. Reactivity was measured using a plate reader at 492 nm. The most promising phages were subjected to another round of phage ELISA with serum from individual patients (10 positives and 10 negatives from hepatitis D). We also assessed two blocking agents (BSA or skim milk) and serum dilutions (1:100, 1:250, and 1:500) and two different phage concentrations, 10¹⁰ and 10¹¹ pfu/well.

5.3 Peptide design and synthesis

The sequenced phage clones were aligned²⁵ to the L-HDAg sequence, which is a protein of HDV obtained from GenBank (AVO03797.1), using Clustal Omega for the design of synthetic peptides. Additionally, the antigenicity of B cells from the L-HDAg sequence was analyzed using linear epitope prediction 2.0^21,26 to identify the epitope regions (http://tools.iedb.org/bcell/help/). The epitope regions that aligned with the best reactivity clones were chosen for the peptide sequence design. When the clone sequences were aligned with the L-HDAg protein, several clones were aligned in the same region; therefore, we used the native sequence of the protein to design the 3 synthetic peptides via GenScript, USA, Inc. (Piscataway, NJ, USA). The peptides used included HDAg1 (ACKDGEGAPCGGGSAETVES), HDAg2 (ACMEVDSGPCGGGSAETVES), and HDAg3 (KDGEGAPPAKRARTDQMEVDSGP). HDAg1 and HDAg2 were constructed with 20 residues, contained a disulfide bridge (between residues 2–10), were acylated at the N-terminal, and were amidated at the C-terminal. HDAg3 was constructed with 23 residues, was acylated at the N-terminal, was amidated at the C-terminal and did not contain a disulfide bridge.

5.4 3D modeling

The large hepatitis delta antigen (L-HDAg) sequence (AVO03797.1) was submitted to the artificial intelligence (AI) tool trRosetta server (http://yanglab.nankai.edu.cn/trRosetta/) for 3D modeling²⁷. In addition, we submitted the same sequence to the protein homology modeling server Phyre2 (http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index), which was used as a template for the 1A92 crystal structure from the oligomerization domain of L-HDAg²⁸. In addition, both structures generated by AI and homology tools were structurally aligned to identify conserved domains using the software PyMOL 2.5 (Schrödinger, LLC.). After that, the two peptide sequences (HDAg1 and HDAg2) were submitted to three-dimensional homology against the 3D model (trRosetta) of L-HDAg using The Pepitope Server (http://pepitope.tau.ac.il/).

5.5 Recombinant protein design, expression and purification

rHDV was synthesized using pET-22b (+) cloning vector by GenOne Biotech (Rio de Janeiro, Brazil). pET-22b (+) was constructed from the L-HDAg virus protein sequence. The plasmid was subsequently transformed into E. coli BL21 (DE3) pLysS cells for preparation of cell lysate containing recombinant proteins, which were purified via HPLC (Shimadzu, Kyoto, Japan) and quantified via SDS‒PAGE using the ImageJ program, with BSA (1 mg/mL) serving as a reference.

5.6 ELISA with synthetic peptides and recombinant protein

The first ELISA with the synthetic peptides (HDAg1, HDAg2, HDAg3) was performed to determine the optimal conditions for diluting the serum and diluting the peptides. For this purpose, an ELISA plate (Greiner, Frickenhausen, Germany) was coated in duplicate with HDAg1, HDAg2, or HDAg3 and diluted with carbonate buffer overnight at 4°C. Cells were then washed in 0.05% PBS-T) and blocked with 5% skim milk in 0.05% PBS-T. The plate was incubated with individual sera, followed by washing and incubation with HRP-conjugated anti-IgG human (GE Healthcare). Revelation was obtained with OPD SigmaFast™ (Sigma‒Aldrich), and the absorbance was obtained at 492 nm. Another ELISA protocol was used to compare the reactivity of HDAg3 and rHDV in anti-HDV + patients and HBV controls.

5.7 RNA HDV detection and sequencing

Total nucleic acids were extracted from 100 µL of serum using Loccus Extracta 32 equipment (Loccus, Brazil) following the manufacturer´s instructions. HDV was detected via RT-QPCR as described previously¹³. The cycle thresholds (Cts) were analyzed, and samples for which the viral target was ≤ 30 were selected for the sequencing protocol. The sequencing protocol was used, and the first step involved cDNA assays with the SuperScript III Two Step (Invitrogen). To characterize the genotypes of HDV, PCR was performed using 853IU (5′ CGGATGCCCAGGTCGGACC 3′) and 1302OD (5′ GGATTCACCGACAAGGAGAG 3′), which were previously described²⁹ and are known to amplify a 450-bp fragment of the HDV genome. Then, nested PCR was performed using HDV-E (5′ GAGATGCCATGCCGACCCGAAGAG 3′) and HDV-A (5′ GAAGGAAGGCCCTCGAGAACAAGA 3′), which were previously described³⁰. The PCR products were analyzed via gel electrophoresis. Purification was performed using ExoSAP (Cellco, New York, NY, USA). The sequencing run was performed by the Rede de Plataformas Tecnológicas FIOCRUZ RPT09F-FIOCRUZ/RO using the automated Sanger sequencer Seqstudio (Applied Biosystems, Waltham, MA, USA). The sequences were subjected to BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to genotype confirmation.

5.8 Statistical analysis

The reactivity-to-platelet ratio was calculated between the absorbances of the positive-HDV and the control. To determine the differences in peptide and recombinant protein reactivity among the groups, the data were considered nonnormally distributed, and we performed an unpaired t test with a Mann‒Whitney test. In addition, the sensitivity, specificity, cutoff, and AUC were calculated based on receiver operating characteristic (ROC) curve analysis. All analyses were performed using GraphPad Prism 7 software (GraphPad Software, Inc., San Diego, CA). Values of p < 0.05 were considered significant, and the results are expressed as the mean ± S.D.

Acknowledgments: Professor Luiz Ricardo Goulart, who led the beginning of the work, we are so grateful and honored to you for guiding the first step of this research. Greiciele Carvalho Leite, Janaína Mazaro, Janete Taynã Nascimento Rodrigues, Camilo Matheus Monteiro Braga de Oliveira, Francilene de Oliveira Braz, Carmen Silva dos Santos Silva, supported the research at the Central Laboratory of Public Health of Acre, Secretary of Health of Acre, Rio Branco, Acre, Brazil.

Authors’ contributions:

Costa, MA: conceptualization, investigation, formal analysis, writing - original draft, writing - review & editing, De Souza, RC: investigation, formal analysis, writing - original draft, writing - review & editing; Roca, TP: investigation, formal analysis, writing - original draft; Araújo, A: investigation, formal analysis, writing - review & editing; Souza, LFA: investigation, formal analysis; Souza, RB: resources, investigation, formal analysis; Sabatini, R: resources, formal analysis; Andrade,BS: investigation, formal analysis; Soares, IP: investigation, formal analysis; Caixeta, DC: investigation, writing - review & editing; Guevara-Vega, M: investigation; Lima, IMS: investigation, formal analysis, writing - original draft; Passos-Silva, AM: investigation, writing - review & editing; Martins, MM: investigation; Rayashi, AD: formal analysis, writing - original draft; Matta, DA: resources, writing - original draft, writing - review & editing; Vieira, D: resources, writing - original draft, writing - review & editing; Goulart, LR: conceptualization, funding acquisition; Sabino-Silva, R: formal analysis, writing - original draft, writing - review & editing, supervision; Santos, FAA: conceptualization, investigation, formal analysis, writing - original draft, writing - review & editing, supervision, project administration.

Conflict of interest: The authors declare that they have no conflicts of interest.

Data availability: The HDV sequences are available in the GenBank repository, with accession numbers described in Supplementary Table S2. All datasets generated and/or analyzed during the current study are available from the corresponding author upon request.

Funding: This work was supported by the National Institute of Science and Technology in Theranostics and Nanobiotechnology – INCT-Teranano, Brazil (CNPq/CAPES/FAPEMIG, CNPq: 403193/2022-2; FAPEMIG: APQ-03613-17).

Ethical approval statement: The Ethics Committee of the Federal University of Uberlândia approved this project (CAAE: #44208621.2.0000.5152).

Caviglia, G. P., Ciancio, A. & Rizzetto, M. A Review of HDV Infection. Viruses 14, (2022).
Botelho-Souza, L. F., Vasconcelos, M. P. A., dos Santos, A. de O., Salcedo, J. M. V. & Vieira, D. S. Hepatitis delta: virological and clinical aspects. Virol J 14, 177 (2017).
Le Gal, F. et al. Genetic diversity and worldwide distribution of the deltavirus genus: A study of 2,152 clinical strains. Hepatology 66, 1826–1841 (2017).
Stockdale, A. J. et al. The global prevalence of hepatitis D virus infection: Systematic review and meta-analysis. J Hepatol 73, 523–532 (2020).
Asselah, T. & Rizzetto, M. Hepatitis D Virus Infection. N Engl J Med 389, 58–70 (2023).
Kamal, H. & Aleman, S. Natural history of untreated HDV patients: always a progressive disease? 32.
Papatheodoridi, M. & Papatheodoridis, G. V. Is hepatitis delta underestimated? Liver Int 41 Suppl 1, 38–44 (2021).
Ceesay, A. et al. Viral Diagnosis of Hepatitis B and Delta: What We Know and What Is Still Required? Specific Focus on Low- and Middle-Income Countries. Microorganisms 10, 2096 (2022).
Ledsgaard, L. et al. Advances in antibody phage display technology. Drug Discovery Today 27, 2151–2169 (2022).
Barbas, C. F., Burton, D. R. & Silverman, G. J. Phage Display: A Laboratory Manual. (Cold Spring Harbor Laboratory Press, New York, 2001).
Pande, J., Szewczyk, M. M. & Grover, A. K. Phage display: Concept, innovations, applications and future. Biotechnology Advances 28, 849–858 (2010).
Smith, G. P. Phage Display: Simple Evolution in a Petri Dish (Nobel Lecture). Angewandte Chemie International Edition 58, 14428–14437 (2019).
Da Silva Queiroz, J. A. et al. Development of quantitative multiplex RT-qPCR one step assay for detection of hepatitis delta virus. Sci Rep 13, 12073 (2023).
Tharwani, A. & Hamid, S. Elimination of HDV: Epidemiologic implications and public health perspectives. Liver International 43, 101–107 (2023).
Cabezas, C. & Braga, W. Hepatitis B Virus and Delta Infection: Special Considerations in the Indigenous and Isolated Riverside Populations in the Amazon Region. Clin Liver Dis (Hoboken) 16, 117–122 (2020).
Chen, L.-Y., Pang, X.-Y., Goyal, H., Yang, R.-X. & Xu, H.-G. Hepatitis D: challenges in the estimation of true prevalence and laboratory diagnosis. Gut Pathog 13, 66 (2021).
Salles, B. C. S. et al. Leishmania infantum mimotopes and a phage–ELISA assay as tools for a sensitive and specific serodiagnosis of human visceral leishmaniasis. Diagnostic Microbiology and Infectious Disease 87, 219–225 (2017).
Lempp, F. A. et al. A Rapid Point-of-Care Test for the Serodiagnosis of Hepatitis Delta Virus Infection. Viruses 13, (2021).
Coller, K. E. et al. Development and performance of prototype serologic and molecular tests for hepatitis delta infection. Sci Rep 8, 2095 (2018).
Oberhardt, V., Hofmann, M., Thimme, R. & Neumann-Haefelin, C. Adaptive Immune Responses, Immune Escape and Immune-Mediated Pathogenesis during HDV Infection. Viruses 14, (2022).
BepiPred-2.0: improving sequence-based B-cell epitope prediction using conformational epitopes | Nucleic Acids Research | Oxford Academic. https://academic.oup.com/nar/article/45/W1/W24/3787843.
Villiers, M.-B. et al. Protein-Peptide Arrays for Detection of Specific Anti-Hepatitis D Virus (HDV) Genotype 1, 6, and 8 Antibodies among HDV-Infected Patients by Surface Plasmon Resonance Imaging. J Clin Microbiol 53, 1164–1171 (2015).
Wang, J. G., Jansen, R. W., Brown, E. A. & Lemon, S. M. Immunogenic domains of hepatitis delta virus antigen: peptide mapping of epitopes recognized by human and woodchuck antibodies. J Virol 64, 1108–1116 (1990).
Gomes-Gouvêa, M. S. et al. Hepatitis B virus and hepatitis delta virus genotypes in outbreaks of fulminant hepatitis (Labrea black fever) in the western Brazilian Amazon region. J Gen Virol 90, 2638–2643 (2009).
Sievers, F. et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Molecular Systems Biology 7, 539 (2011).
T, D. et al. Structural immunoinformatics approach for rational design of a multi-epitope vaccine against triple negative breast cancer. International Journal of Biological Macromolecules 243, 125209 (2023).
Du, Z. et al. The trRosetta server for fast and accurate protein structure prediction. Nat Protoc 16, 5634–5651 (2021).
Zuccola, H. J., Rozzelle, J. E., Lemon, S. M., Erickson, B. W. & Hogle, J. M. Structural basis of the oligomerization of hepatitis delta antigen. Structure 6, 821–830 (1998).
Zhang, Y. Y., Tsega, E. & Hansson, B. G. Phylogenetic analysis of hepatitis D viruses indicating a new genotype I subgroup among African isolates. J Clin Microbiol 34, 3023–3030 (1996).
Casey, J. L., Brown, T. L., Colan, E. J., Wignall, F. S. & Gerin, J. L. A genotype of hepatitis D virus that occurs in northern South America. Proc. Natl. Acad. Sci. U.S.A. 90, 9016–9020 (1993).

No competing interests reported.

Download PDF

Editorial decision: Revision requested
28 Oct, 2024
Reviews received at journal
26 Oct, 2024
Reviewers agreed at journal
14 Oct, 2024
Reviews received at journal
16 Sep, 2024
Reviewers agreed at journal
09 Sep, 2024
Reviewers agreed at journal
08 Sep, 2024
Reviewers invited by journal
05 Sep, 2024
Editor assigned by journal
05 Sep, 2024
Editor invited by journal
05 Sep, 2024
Submission checks completed at journal
04 Sep, 2024
First submitted to journal
23 Aug, 2024

You are reading this latest preprint version

Novel Epitope-Based Diagnostic Probes Selected by Phage Display for the Serological Detection of HDV

Status:

Version 1

Abstract

Figures

1. Introduction

2. Results

2.1 Phage-ELISA and sequence analysis

2.2 Alignments of phage clones with the reference HDV protein sequence

2.3 In silico analyses- L-HDAg modeling and alignment

2.4 Immunoreactivity of the synthetic peptides and recombinant proteins in serum

3. Discussion

4. Conclusion

5. Materials and Methods

5.1 Samples and ethical aspects

5.2 Phage display

5.2.1 Coupling of IgGs in protein G magnetic beads

5.2.2 Biopanning

5.2.3 DNA extraction and sequencing of phages

5.2.4 Phage-ELISA

5.3 Peptide design and synthesis

5.4 3D modeling

5.5 Recombinant protein design, expression and purification

5.6 ELISA with synthetic peptides and recombinant protein

5.7 RNA HDV detection and sequencing

5.8 Statistical analysis

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1