Hypermethylation of Hif3a and Ifltd1 Is Associated with Atrial Remodeling in Pressure- overload Murine Model

doi:10.21203/rs.3.rs-4969689/v1

Download PDF

Article

Hypermethylation of Hif3a and Ifltd1 Is Associated with Atrial Remodeling in Pressure- overload Murine Model

https://doi.org/10.21203/rs.3.rs-4969689/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Atrial remodeling is one of major pathophysiological mechanisms of atrial fibrillation (AF). Atrial remodeling progresses based on aging, background diseases including hypertension and heart failure, and AF itself. However, its mechanism and reversibility have not been completely elucidated. In this study, we focused on the involvement of DNA methylation in atrial remodeling. Mice underwent transverse aortic constriction (TAC) procedure to generate pressure overload model. After 14 days, TAC-operated mice showed a significant increase in atrium/body weight ratio and deposition of collagen fiber in atria. Comprehensive analysis of RNA-Sequencing (RNA-Seq) and Methyl-CpG-Binding Domain Sequencing (MBD-Seq) in left atrial tissue identified Hif3a and Ifltd1 showing increased DNA methylation in their promoter regions and decreased RNA expression. We also performed transient pressure overload model by removing aortic constriction at 3 or 7 days after initial TAC procedure (R3 or R7 groups). The reduction of RNA expression was achieved at R3 for Hif3a, and in R7 for Ifltd1. The heterozygous Dnmt1 gene targeting mouse (Dnmt1 ^mut) showed disappearance of the reduction in RNA expression and increase in atrium/body weight ratio. DNA methylation was thought to contribute to at least part of the atrial remodeling in the pressure overload mouse model.

atrial fibrillation

atrial remodeling

reverse remodeling

methylation

Hif3a

Ifltd1

Atrial fibrillation (AF) is the most common sustained cardiac arrhythmia, and a major public health problem with increased mortality risk, a great number of comorbidities, including cerebrovascular stroke, heart failure, dementia, renal failure, and endothelial dysfunction ¹². Atrial remodeling is a major mechanism for the progression of AF. Atrial remodeling can be divided into electrical remodeling represented by changes in the expression and function of ion channels, and structural remodeling represented by atrial fibrosis and apoptosis of cardiomyocytes ³. Since atrial fibrosis increases conduction disturbance and its heterogeneity, it is considered as one of the most important factors in atrial remodeling ⁴. Atrial remodeling is promoted by AF itself and several background diseases including hypertension, heart failure, obesity, and sleep apnea ^{3 5 6 7}. In experimental model of atrial remodeling, acute atrial remodeling within 1 week of exposure to stressors was often reversible ^{8 9}. However, atrial remodeling progressed over the longer duration became irreversible ^{10 11}.

Atrial remodeling may decrease after elimination these promoting pathophysiological conditions, also called reverse remodeling ¹². It was reported that reverse remodeling might occur after the treatment of AF. In addition, reverse remodeling also occurs by upstream treatment targeting the underlying disease. However, it has not yet been clarified how far the atrial remodeling is reversed by elimination of underlying disease. Furthermore, it is still uncertain the pivotal molecules that contributed to the reversibility of atrial remodeling.

The involvement of epigenetic changes in various pathological conditions has been reported in recent years and has attracted much attention because it is accompanied by changes in gene expression without DNA changes ¹³. Among epigenetic changes, DNA methylation mainly involves methylation of cytosine from cytosine-guanine dinucleotide (CpG) to 5-methylcytosine (5mC), which is important for gene expression. Cytosine is methylated by DNA methyltransferases (DNMT1, DNMT3a, DNMT3b) and demethylated by ten-eleven translocation methyl cytosine dioxygenase (TET1-3) ^{14 15}. It it known that DNA methylation at promoter region of gene represses its expression through restriction of transcription factor binding and/or induction of chromatin condensation.

DNA methylation has been reported to regulate genetic expression in various organs including the heart ^{16,17 18}. Although studies suggesting a relationship between AF and methylation have been reported in recent years^16,18, the pathogenesis of AF is complex, and the genes involved in AF in relation to methylation have not yet been elucidated, nor have the molecules involved in methylation and atrial remodeling been identified.

We hypothesized that the DNA methylation might be involved in the development of atrial remodeling, which could explain the irreversibility of atrial remodeling at least in part. In this study, we focused on fibrosis in atrial remodeling, and aimed to clarify the molecules involved in its reversibility, using a pressure overload followed by mouse model.

Progression of atrial remodeling in pressure overload model

It has been reported that pressure overload promotes atrial fibrosis and increases the arrhythmic substrate ^{19 20 21}. However, it is still unknown whether the removal of pressure overload reverses the atrial remodeling. We created an experimental transient pressure overload murine model by re-surgery to release constricting tie after initial TAC procedure, and evaluated the fibrotic change in the atria.

In the re-surgery group, we released the constricting tie at 3 days after TAC (R3 group), or at 7 days after TAC (R7 group). We also generated sham operation group, and TAC operation group without re-surgery. Mice were sacrificed 14 days after initial TAC procedure followed by the evaluation of the weight of atria and fibrosis (Fig. 1A).

The atrium/body weight ratio increased depending on the period of pressure overload, and it showed a significant increase in TAC group and R7 group compared to that in sham group (Fig. 1B). The ventricle/body weight ratio increased only in TAC group. The separate assessment of atrium/body weight ratio in right and left atria showed left atrium had larger influence of pressure overload (Fig. 1C). Masson-Trichrome staining of left atrial tissue exhibited the deposition of collagen fiber in the atrium by pressure overload, and the %fibrosis significantly larger in R7 and TAC groups than sham group. Of note, the degree of fibrosis was similar between R7 and TAC groups (Fig. 1D).

These findings indicated that the atrial fibrosis progressed in time dependent manner, resulting in the increase in atrial weight. The release of pressure overload at 7 days after initial TAC procedure showed little effect for reverse remodeling regarding atrial fibrosis. On the other hand, the release of pressure overload at 3days after initial TAC showed little change in atrial fibrosis, which indicated that atrial fibrosis obtained irreversibility after a certain period of pressure overload.

Comprehensive analysis of DNA methylation and RNA expression

To search the pivotal factors involved in the irreversibility of atrial fibrosis, DNA methylation and RNA expression were quantified using a next-generation sequencer in the atrium of TAC- or sham- operated mice (n = 2 for each group). DNA methylation was evaluated by Methyl-CpG-Binding Domain Sequencing (MBD-Seq), and the change of methylation in each gene was analyzed in combination with the expression of mRNA by RNA-Sequencing (RNA-Seq) (Fig. 2A). In MBD-Seq, a total of 2,297 Differentially methylated regions (DMRs) were identified; 2,154 region showed increased methylation and 143 regions showed decreased methylation. RNA-Seq identified 2,101 Differentially expressed genes (DEGs); 1,515 gene with increased expression and 586 genes with decreased expression. Since DNA methylation at the promotor region reduced the expression of the gene, we searched the genes with increased DNA methylation with reduced expression of mRNA, or the reduced DNA methylation with increased RNA expression. The cutoff value was set with log₂ of fold change (log₂FC) > 1 or < -1 in MBD-Seq, and log₂FC > 0.75 or < -0.75 in RNA-Seq (Fig. 2A). We found 24 genes with increased DNA methylation and reduced RNA expression, and 8 genes with decreased DNA methylation and upregulated RNA expression. A heatmap of DNA methylation and RNA expression in the 32 candidate genes expressed in Fig. 2B.

Among 32 candidate genes, we searched DMRs positioned at promotor region of gene and found 2 genes (Hif3a and Ifltd1) with increased DNA methylation and reduced RNA expression (Fig. 3A). The mRNA expression of Hif3a and Ifltd1 was evaluated by quantitative RT-PCR in sham, R3, R7, and TAC groups (Fig. 3B). The expression profile was slightly different between Hif3a and Ifltd1. The expression of Hif3a was significantly diminished in R3, R7, and TAC groups than in sham group, and Ifltd1 showed gradual reduction, and significant decrease was observed in R7 and TAC group, but not in R3 group.

Bisulfite sequence of the promoter region of Hif3a and Ifltd1

In order to confirm the change in DNA methylation and clarify the detailed distribution of methylated CpG in the DMR identified by MBD-Seq, we performed bisulfite sequence focusing on the DMR in promoter region of Hif3a and Ifltd1. The target region of Hif3a contained 15 CpGs, and that of Ifltd1 had 7 CpGs. The summarized DNA methylation ratio from all CpGs in the target region of Hif3a showed the significant increase in DNA methylation in R3, R7, and TAC groups than in sham group. Those of Ifltd1 showed the significant increase in methylation in R7 and TAC groups, but not in R3 group (Fig. 4). These results were consistent with the time course of reduction in mRNA expression, which indicated the possibility that expression of Hif3a was reduced by DNA methylation at a relatively early phase (day 3), and the DNA methylation change in Ifltd1 initiated from day 7.

Involvement of Dnmt1 in atrial remodeling

To further investigate the involvement of DNA methyltransferase in the change in DNA methylation and RNA expression, we applied TAC operation using Dnmt1 ^mut mouse. The mRNA expression of Hif3a and Ifltd1 was significantly reduced in WT after TAC procedure. However, Dnmt1 ^mut mice did not show the reduction of the mRNA expression (Fig. 5). The increase in atrium/body weight was also suppressed in Dnmt1^mut mice. The degree of increase in ventricle/body weight ratio was also attenuated, but still had statistically significant change between TAC and sham group in Dnmt1^mut mice.

In this study, we investigated the mechanism of atrial remodeling, focusing on the DNA methylation in pressure overload murine model. Our pressure overload model showed the increase in the atrium/body weight ratio and deposition of collagen fiber as shown in previous studies ^{19 20 21}. We then added another experimental model to apply pressure overload for limited period (3 or 7 days), followed by returning to normal condition by removing constricting tie (Release model at day 3 or day 7). Then we assessed all group at 14 days after initial TAC procedure. Similar to the previous reports, TAC model showed increased atrium/body weight ratio. Although Release model at day 3 did not show significant change, Release model at day 7 demonstrated significant increase in atrium/body weight ratio like TAC model. The histological evaluation in left atria showed consistent changes, in which the deposition of collagen fiber was little in Release model at day 3 but Release model at day 7 showed significant fibrotic change similar to TAC model. These results indicated that atrial remodeling advanced according to the duration of the period of pressure overload.

The involvement of DNA methylation has been investigated in relation to the etiology of disease. In relation to the aging, global hypomethylation and promoter-specific hypermethylation was reported ^{22 23}. It has been reported that DNA methylation is established by the de novo DNA methyltransferases (DNMTs) Dnmt3A and Dnmt3B and is subsequently maintained by Dnmt1 ¹⁵. Several studies reported that Dnmt1 was associated with cardiac fibrosis ^{24 25}. In this study, we applied TAC model using Dnmt1 gene targeting mouse, which showed significantly reduced atrial fibrosis. These results indicated the possibility that DNA methylation played a critical role in atrial fibrosis under pressure overload, and Dnmt1 was involved in this process.

We performed comprehensive analysis of mRNA expression and DNA methylation, and found Hif3a and Ifltd1 exhibited increased DNA methylation at promoter region and reduced RNA expression. Since TAC model using Dnmt1 ^mut mouse cancelled the reduction of expression in Hif3a and Ifltd1, the reduction of RNA expression of both genes was caused by the increased DNA methylation under pressure overload. Of note, we found that the time course of the reduction in mRNA expression differed between Hif3a and Ifltd1. The reduction in Hif3a was achieved at day 3, and did not change through day 14. However, the mRNA expression level gradually decreased in time dependent manner in Ifltd1. Bisulfite sequence in the promoter regions indicated that the ratio of DNA methylation significantly increased at day 3 in Hif3a, and at day 7 in Ifltd1. These findings might explain that the time courses of mRNA expression change were associated with the degree of DNA methylation. And the difference between Hif3a and Ifltd1 suggested some modifiers might be involved in DNA methylation process in pressure overload model in individual genes. This point should be clarified in the future study.

Hif3a is one of the members of the Hypoxia-inducible factors (HIFs) and is known for a dominant negative inhibitor of Hif1 and Hif2 ^{26 27 28–31}. Several reports described that Hif3a was associated with lung remodeling during development^{32 33 34}. The loss of Hif3a in murine pulmonary endothelial cells resulted in impaired angiogenesis, supporting the direct transcriptional involvement of Hif3 in hypoxic signaling³³. Aquino-Galvez et al. also reported that HIF-3α was decreased in fibroblasts from patients with idiopathic pulmonary fibrosis, possibly related to its hypermethylation ³⁵. In adipocytes, Hif3a induced a transcriptional program that enhanced the synthesis of extracellular matrix components^{36 37 38 39}. In terms of atrial remodeling, recent paper showed that increased Hif1a in epicardial adipose tissue induced an inflammation signal in atrium ⁴⁰. Since Hif3a is a negative regulator of Hif1a, the decreased expression of Hif3a may enhance the Hif1a signal, resulting in atrial inflammation and fibrosis, and contribute the atrial remodeling. We suspect that suppression of Hif3a increases the function of Hif1a and Hif2a atrial tissue, contributing to atrial fibrosis. However, another report described that Hif1a induced the secretion of oncostatin M resulting in the suppression of fibrosis. ⁴¹. It is necessary to consider which cells in the atria are particularly associated with atrial remodeling in pressure overload model. Ifltd1 is positioned to act upstream of cell proliferation. Genome-wide association study reported that single nucleotide polymorphism (rs6487504) located in Ifltd1 region was associated with resistant hypertension⁴². Our results predicted that Ifltd1 might contribute to atrial fibrosis, but its functional role was not clarified. We need to investigate the functional assessment of Ifltd1.

Reverse remodeling is firstly known as a phenomenon that the elimination of AF showed normalization of left atrial function. It was characterized as the reduction in chamber size of left atrium and improved atrial contraction ¹², and also improved atrial conduction velocity after catheter ablation for AF ⁴³. Reverse remodeling was also focused on the lifestyle modification after catheter ablation in patients with AF ⁴⁴. However, the degree of reverse remodeling varied and its mechanism has not been clarified. Since pressure overload induced atrial remodeling, the removal of pressure overload might induce reverse remodeling to some extent. However, little is known about atrial reverse remodeling in pressure overload model. This study shed light on the part of the mechanisms and contributing molecules in the atrial remodeling and reverse remodeling. Our study suggested that Release model at day 3 had larger degree of reverse remodeling compared to Release model at day 7, and the DNA methylation process in Hif3a and Ifltd1might be related to that mechanism. However, this study observed a short-term result at day 14, and had no information about reversibility of mRNA expression and DNA methylation in longer phase. We need further study focusing on the irreversibility of atrial remodeling and the involvement of DNA methylation.

This study has several limitations. First, this study applied pressure overload for 14 days in maximum and observed short-term change in mRNA expression and DNA methylation. Since we did not follow longer period, we had little insight about long-term atrial remodeling and reverse remodeling. This is the next issue to be addressed after this research. Second, we focused on DNA methylation and the contribution of Dnmt1. It was reported that the concurrence of DNA methylation and demethylation was important for transcription regulation ¹⁴. And it is possible that Dnmt3 is also involved in the atrial remodeling process. We need further investigation to clarify the whole regulation system of DNA methylation and atrial remodeling. Third, since we performed RNA expression and DNA methylation analysis using gross atrial tissue, we had no information which cell type contributed to the atrial fibrosis. Considering the reverse remodeling therapy, we need to elucidate all these limitations in further studies.

This study demonstrated that DNA methylation contributed to the atrial remodeling evoked by pressure overload. Hif3a and Ifltd1 may play pivotal role for this process, and they are potential candidates for novel therapeutic target to achieve reverse remodeling.

Mouse

All animal experiments were carried out with the approval of the Institutional Animal Care and Use Committee of Tokyo Medical and Dental University (Approval # A2022-175C3). All methods were carried out in accordance with relevant guidelines and regulations and the study was carried out in compliance with the ARRIVE guidelines. Wild-type (WT) male mice (C57BL/6) were purchased from CLEA Japan (Tokyo, Japan). Heterozygous Dnmt1 gene targeted mouse (Dnmt1tm2Enl) was a gift from Dr. Okano (Dnmt1^mut) ⁴⁵ (9). The activity of Dnmt1 in this mouse was strongly diminished. All animals were used at the age of 8–12 weeks.

Transverse aortic constriction model

Transverse aortic constriction (TAC) procedure was performed as described previously ^{46 47}. Briefly, mice (8–12 weeks old, 21–24 g of body weight) were initially anesthetized by 2–3% of isoflurane. The animals were then placed in a supine position, an endotracheal tube was inserted, and the animals were ventilated using a volume-cycled rodent ventilator with a tidal volume of 0.4 ml room air with 0.8–1.5% of isoflurane and a respiratory rate of 120 breathes/minute. The chest cavity was exposed by cutting open the cranial portion of the sternum. Aortic arch between the brachiocephalic artery and the left common carotid arteries was exposed, and constricted with a 7 − 0 nylon suture tied firmly using a 27-gauge blunted needle as a size indicator. Sham-operated mice underwent the identical surgical procedure, including exposure of the aorta, but without placement of the suture.

We also generated the TAC and release model by re-surgery. Subgroup of mice underwent repeated operation to remove the suture for the constriction of aorta at 3 or 7 days after TAC (R3 or R7 groups, respectively). Mice were sacrificed 14 days after the initial operation. Animals were anesthetized by 5% of isoflurane, and euthanized with carbon dioxide. Hearts were excised for the following analyses.

Histological assessment

Excised atria were washed by normal saline, immersed in 10% buffered formalin for 2 days, and embedded in paraffin. The paraffin sections were sliced, stained by Masson’s trichrome (MT), and photographed using microscope (BZ-710, Keyence, Osaka, Japan). The fibrotic area was quantified by ImageJ software ((National Institutes of Health [NIH], MD, USA). Proportion of fibrotic area was calculated as a ratio of the MT-positive area to the total cross-sectional area.

Isolation of genomic DNA and RNA

Genomic DNA was extracted from left atrial tissues using DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany) according to the manufacturer's protocol. DNA concentration was determined with a spectrophotometer (ND-1000, Thermo Fisher Scientific, MA, USA).

Total RNA was extracted from left atrial tissues using RNeasy Mini Kit (QIAGEN) according to the manufacturer's protocol. RNA concentration was determined with a spectrophotometer (ND-1000).

MBD Sequence and RNA Sequence

For methyl binding domain enrichment and sequencing (MBD-seq), genomic DNA for CpG methylation profiling was isolated using the DNeasy Blood&Tissue Kit (QIAGEN). DNA was fragmented into about 400 bp using a Covaris ultra-sonicator (Covaris, MA, USA). Fragmented DNA was subjected to methylated DNA enrichment using CpG MethylQuest DNA Isolation Kit (Merck Millipore, Darmstadt, Germany) according to the manufacturer’s protocols. The library for Illumina sequencing was constructed using NEBNext Ultra II DNA Library Prep Kit for Illumina (Cat.No E7645, New England Biolabs, MA, USA). The quality of the libraries was assessed with an Agilent 2100 Bioanalyzer High Sensitivity DNA Assay (Agilent Technologies, CA, USA). The pooled libraries of the samples were sequenced using NextSeq 500 system (Illumina, CA, USA) in 76-base-pair (bp) single-end reads. Sequencing adaptors, low quality reads, and bases were trimmed with Trimmomatic-0.32 tool ⁴⁸. The sequence reads were aligned to the mouse reference genome (mm10) using bowtie2-2.3.2 ⁴⁹. PCR duplicates were removed using the Picard tools ver. 1.119 (http://picard.sourceforge.net). The aligned reads were subjected to downstream analysis using R package MEDIPS ver. 1.30 ⁵⁰. We calculated the short read coverage (extend value = 300) at genome-wide 100-bp bins using MEDIPS. Differentially methylated regions (DMRs) were detected based on the RPKM values for genome-wide 100-bp sliding windows. A FDR adjusted p-value of < 0.01 was considered significant in the analysis.

For RNA sequencing, sequencing libraries were prepared using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (Cat.No E7760, New England Biolabs, MA, USA) with NEBNext Poly(A) mRNA Magnetic Isolation Module according to the manufacturer’s protocols. The quality of the libraries was assessed with an Agilent 2100 Bioanalyzer High Sensitivity DNA Assay (Agilent Technologies). The pooled libraries of the samples were sequenced using NextSeq 500 (Illumina) in 76-base-pair (bp) single-end reads. Sequencing adaptors, low quality reads, and bases were trimmed with Trimmomatic-0.32 tool ⁴⁸. The sequence reads were aligned to the mouse reference genome (mm10) using Tophat 2.1.1 (bowtie2-3.2.0) ⁴⁹, which can adequately align reads onto the location including splice sites in the genome sequence. The aligned reads were subjected to downstream analyses using StrandNGS 3.2 software (Agilent Technologies). The read counts allocated for each gene and transcript (RefSeq Genes 2013.04.01) were quantified using a Trimmed Mean of M-value (TMM) method ⁵¹. Differentially expressed genes (DEGs) were defined as the expression level was more than double or less than 1/2. The array and sequence data can be accessed through the Sequence Read Archive (SRA) under the NCBI accession number PRJNA1039251 (MBD-Seq) and PRJNA1039252 (RNA-Seq).

RT-PCR

After the extraction of total RNA, reverse transcription was performed from 200 ng total RNA using High Capacity cDNA Reverse Transcription Kit (Life Technologies, CA, USA). Quantitative PCR was performed with PowerSYBR Green Master Mix (Life Technologies) and StepOne Plus thermal cycler (Life Technologies). The primers were listed in Table 1. The expression level was calculated with 2dd method, normalized with glyceraldehyde-3-phosphate dehydrogenase (Gapdh).

Table 1

Sequences of Primers Used in This Study
	Gene	Primer sequence F	Primer sequence R	Product size (bp)
qPCR	Hif3a	GAGTGATCCACGACTGAACTG	CCAACCCTTTGTCCTCTGAG	116
qPCR	Ifltd1	GAACCAATACAGAAAACGCCC	ACGGATGTGGAGAAGTGTTG	124
Bisulfite sequencing	Hif3a	ATTGTTAAGGAAGTTTGGGGTA	ACAATATCCTCAACTTAAACCACA	387
Bisulfite sequencing	Ifltd1	GGTATTGTGAGAAAAAGGAGTTT	TCTAATAACACCTAAAACCCCTC	269

Bisulfite sequence

Bisulfite sequencing was performed on genomic DNA from left atrial tissues obtained at TAC, Sham, Release day3 and Release day7 (n = 3, respectively). Genomic DNA was isolated by using the DNeasy kit (QIAGEN). DNA samples underwent bisulfite conversion using the EZ DNA Methylation-Lightning Kit (Zymo Research, CA, USA). PCR amplification of bisulfite DNA was performed with specific primers designed with the Methyl Primer Express software v1.0 (Applied Biosystems, MA USA). PCR on bisulfite converted DNA were performed on 15 CpG sites in Hif3a mouse gene and on 7 CpG sites in Ifltd1 mouse gene. Bisulfite PCR primers are listed in Table 1. Bisulfite-converted DNA samples were then used as a template for PCR reactions using AmpliTaq Gold 360 (Applied Biosystems). The PCR product was purified using the QIAquick Gel Extraction Kit (QIAGEN) and cloned into the pGEM®-T Easy Vector (Promega, WI, USA) for downstream sequencing. Following transformation in competent Escherichia coli (Competent Quick DH5a, TOYOBO, Japan), over 6 positive clones per LA sample were picked, performed with illustra TempliPhi DNA Amplification Kit (Cytiva, Tokyo, Japan) and processed for Sanger sequencing (Applied Biosystems 3130xl Genetic Analyzer). Bisulfite sequencing primers are listed in Table 1. Bisulfite sequencing results were then analyzed using QUMA software ⁵².

Statistics

All data were expressed as mean ± SD or SE. The F-tests were used to compare the means of the groups, unpaired and paired Student's t test was performed for comparison between two groups, where appropriate. One-way analysis of variance was performed for multigroup comparison. If significant, the Bonferroni post hoc test was used to detect the level of significant differences. In bisulfate sequence experiment the Chi-square test was performed and after that Bonferroni’s correction was used to detect the level of significance. A p < 0.05 was considered statistically significant. Statistical analyses were performed using R software packages, version 3.2.2 (R Development Core Team, Vienna, Austria) and Python 3.7.3 software.

Data availability

All data generated during and/or analyzed during this study are available from the corresponding authors on reasonable request.

The array and sequence data can be accessed through the Sequence Read Archive (SRA) under the NCBI accession number PRJNA1039251 (MBD-Seq); https://dataview.ncbi.nlm.nih.gov/object/PRJNA1039251?reviewer=a620re842gnsqr8ofjtbmdc38c , and PRJNA1039252 (RNA-Seq); https://dataview.ncbi.nlm.nih.gov/object/PRJNA1039252?reviewer=k7e7jlcemic2jecqknhn1o4rk6.

Acknowledgments

The authors thank Dr. Jun Takeuchi, Dr. Kensuke Ihara, Dr. Masahiro Yamazoe and Dr. Sun Yeihan for their helpful discussions with us. The authors also appreciate Ms. Reiko Kimura for her technical assistance and Ms. Akemi Oshikiri for assistance. This study was supported by the Joint Usage/Research Program of Medical Research Institute, Tokyo Medical and Dental University, the Grant-in-Aid for Scientific Research (No. 16K09494 to T.S., No. 19K08536 to T.S.), and the grant from SENSHIN Medical Research Foundation (to T.S.). K.A. is supported by a Grant-in-Aid of The Ishidsu Shun Memorial Scholarship, Japan.

Author Contributions

KA, TS, and TF conceived and designed the research. KA performed the animal experiments with support from TS. KA and YS contributed to histological assessment. KA performed statistical analyses and drafted the manuscript. All authors reviewed the manuscript draft and revised it critically on intellectual content. All authors approved the final version of the manuscript to be published.

Conflict of Interest

The authors declare no competing interests.

Benjamin, E. J. et al. Independent risk factors for atrial fibrillation in a population-based cohort. The Framingham Heart Study. JAMA 271, 840-844 (1994).
Ryder, K. M. & Benjamin, E. J. Epidemiology and significance of atrial fibrillation. Am J Cardiol 84, 131R-138R, doi:10.1016/s0002-9149(99)00713-4 (1999).
Allessie, M., Ausma, J. & Schotten, U. Electrical, contractile and structural remodeling during atrial fibrillation. Cardiovasc Res 54, 230-246, doi:10.1016/s0008-6363(02)00258-4 (2002).
Nattel, S., Burstein, B. & Dobrev, D. Atrial remodeling and atrial fibrillation: mechanisms and implications. Circ Arrhythm Electrophysiol 1, 62-73, doi:10.1161/CIRCEP.107.754564 (2008).
Andrade, J., Khairy, P., Dobrev, D. & Nattel, S. The clinical profile and pathophysiology of atrial fibrillation: relationships among clinical features, epidemiology, and mechanisms. Circ Res 114, 1453-1468, doi:10.1161/CIRCRESAHA.114.303211 (2014).
Schotten, U., Verheule, S., Kirchhof, P. & Goette, A. Pathophysiological mechanisms of atrial fibrillation: a translational appraisal. Physiol Rev 91, 265-325, doi:10.1152/physrev.00031.2009 (2011).
Watanabe, H. et al. Metabolic syndrome and risk of development of atrial fibrillation: the Niigata preventive medicine study. Circulation 117, 1255-1260, doi:10.1161/circulationaha.107.744466 (2008).
Goette, A., Honeycutt, C. & Langberg, J. J. Electrical remodeling in atrial fibrillation. Time course and mechanisms. Circulation 94, 2968-2974, doi:10.1161/01.cir.94.11.2968 (1996).
Ausma, J. et al. Time course of atrial fibrillation-induced cellular structural remodeling in atria of the goat. J Mol Cell Cardiol 33, 2083-2094, doi:10.1006/jmcc.2001.1472 (2001).
Li, D., Fareh, S., Leung, T. K. & Nattel, S. Promotion of atrial fibrillation by heart failure in dogs: atrial remodeling of a different sort. Circulation 100, 87-95, doi:10.1161/01.cir.100.1.87 (1999).
Sanders, P. et al. Reversal of atrial mechanical dysfunction after cardioversion of atrial fibrillation: implications for the mechanisms of tachycardia-mediated atrial cardiomyopathy. Circulation 108, 1976-1984, doi:10.1161/01.cir.0000091408.45747.04 (2003).
Thomas, L. & Abhayaratna, W. P. Left Atrial Reverse Remodeling: Mechanisms, Evaluation, and Clinical Significance. JACC Cardiovasc Imaging 10, 65-77, doi:10.1016/j.jcmg.2016.11.003 (2017).
Moore, L. D., Le, T. & Fan, G. DNA methylation and its basic function. Neuropsychopharmacology 38, 23-38, doi:10.1038/npp.2012.112 (2013).
Shi, J. et al. The concurrence of DNA methylation and demethylation is associated with transcription regulation. Nat Commun 12, 5285, doi:10.1038/s41467-021-25521-7 (2021).
Okano, M., Bell, D. W., Haber, D. A. & Li, E. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99, 247-257, doi:10.1016/s0092-8674(00)81656-6 (1999).
Zhao, G. et al. Genome-wide DNA methylation analysis in permanent atrial fibrillation. Mol Med Rep 16, 5505-5514, doi:10.3892/mmr.2017.7221 (2017).
Pan, X., Chen, Z., Huang, R., Yao, Y. & Ma, G. Transforming growth factor beta1 induces the expression of collagen type I by DNA methylation in cardiac fibroblasts. PLoS One 8, e60335, doi:10.1371/journal.pone.0060335 (2013).
Donate Puertas, R. et al. Epigenetics in atrial fibrillation: A reappraisal. Heart Rhythm 18, 824-832, doi:10.1016/j.hrthm.2021.01.007 (2021).
Bradshaw, A. D. et al. Pressure overload-induced alterations in fibrillar collagen content and myocardial diastolic function: role of secreted protein acidic and rich in cysteine (SPARC) in post-synthetic procollagen processing. Circulation 119, 269-280, doi:10.1161/CIRCULATIONAHA.108.773424 (2009).
Takeda, N. et al. Cardiac fibroblasts are essential for the adaptive response of the murine heart to pressure overload. J Clin Invest 120, 254-265, doi:10.1172/JCI40295 (2010).
Hanif, W. et al. Left atrial remodeling, hypertrophy, and fibrosis in mouse models of heart failure. Cardiovasc Pathol 30, 27-37, doi:10.1016/j.carpath.2017.06.003 (2017).
Jung, M. & Pfeifer, G. P. Aging and DNA methylation. BMC Biol 13, 7, doi:10.1186/s12915-015-0118-4 (2015).
Rakyan, V. K. et al. Human aging-associated DNA hypermethylation occurs preferentially at bivalent chromatin domains. Genome Res 20, 434-439, doi:10.1101/gr.103101.109 (2010).
Tao, H. et al. DNMT1 deregulation of SOCS3 axis drives cardiac fibroblast activation in diabetic cardiac fibrosis. J Cell Physiol 236, 3481-3494, doi:10.1002/jcp.30078 (2021).
Xu, S. S., Ding, J. F., Shi, P., Shi, K. H. & Tao, H. DNMT1-Induced miR-152-3p Suppression Facilitates Cardiac Fibroblast Activation in Cardiac Fibrosis. Cardiovasc Toxicol 21, 984-999, doi:10.1007/s12012-021-09690-x (2021).
Duan, C. Hypoxia-inducible factor 3 biology: complexities and emerging themes. Am J Physiol Cell Physiol 310, C260-269, doi:10.1152/ajpcell.00315.2015 (2016).
Makino, Y. et al. Inhibitory PAS domain protein is a negative regulator of hypoxia-inducible gene expression. Nature 414, 550-554, doi:Doi 10.1038/35107085 (2001).
Makino, Y., Kanopka, A., Wilson, W. J., Tanaka, H. & Poellinger, L. Inhibitory PAS domain protein (IPAS) is a hypoxia-inducible splicing variant of the hypoxia-inducible factor-3alpha locus. J Biol Chem 277, 32405-32408, doi:10.1074/jbc.C200328200 (2002).
Heikkila, M., Pasanen, A., Kivirikko, K. I. & Myllyharju, J. Roles of the human hypoxia-inducible factor (HIF)-3alpha variants in the hypoxia response. Cell Mol Life Sci 68, 3885-3901, doi:10.1007/s00018-011-0679-5 (2011).
Maynard, M. A. et al. Human HIF-3alpha4 is a dominant-negative regulator of HIF-1 and is down-regulated in renal cell carcinoma. FASEB J 19, 1396-1406, doi:10.1096/fj.05-3788com (2005).
Ravenna, L., Salvatori, L. & Russo, M. A. HIF3alpha: the little we know. FEBS J 283, 993-1003, doi:10.1111/febs.13572 (2016).
Yamashita, T. et al. Abnormal heart development and lung remodeling in mice lacking the hypoxia-inducible factor-related basic helix-loop-helix PAS protein NEPAS. Mol Cell Biol 28, 1285-1297, doi:10.1128/MCB.01332-07 (2008).
Kobayashi, S. et al. Hypoxia-inducible factor-3alpha promotes angiogenic activity of pulmonary endothelial cells by repressing the expression of the VE-cadherin gene. Genes Cells 20, 224-241, doi:10.1111/gtc.12215 (2015).
Amin, F. Z., Yamashita, T. & Ohneda, O. Deterioration of alveolar development in mice with both HIF-3alpha knockout and HIF-2alpha knockdown. BMC Res Notes 11, 449, doi:10.1186/s13104-018-3563-7 (2018).
Aquino-Galvez, A. et al. Dysregulated expression of hypoxia-inducible factors augments myofibroblasts differentiation in idiopathic pulmonary fibrosis. Respir Res 20, 130, doi:10.1186/s12931-019-1100-4 (2019).
Gonzalez, F. J., Xie, C. & Jiang, C. The role of hypoxia-inducible factors in metabolic diseases. Nat Rev Endocrinol 15, 21-32, doi:10.1038/s41574-018-0096-z (2018).
Kloting, N. & Bluher, M. Adipocyte dysfunction, inflammation and metabolic syndrome. Rev Endocr Metab Disord 15, 277-287, doi:10.1007/s11154-014-9301-0 (2014).
Ruiz-Ojeda, F. J., Mendez-Gutierrez, A., Aguilera, C. M. & Plaza-Diaz, J. Extracellular Matrix Remodeling of Adipose Tissue in Obesity and Metabolic Diseases. Int J Mol Sci 20, doi:10.3390/ijms20194888 (2019).
Pfeiffer, S. et al. Hypoxia-inducible factor 3A gene expression and methylation in adipose tissue is related to adipose tissue dysfunction. Sci Rep 6, 27969, doi:10.1038/srep27969 (2016).
Abe, I. et al. Association of fibrotic remodeling and cytokines/chemokines content in epicardial adipose tissue with atrial myocardial fibrosis in patients with atrial fibrillation. Heart Rhythm 15, 1717-1727, doi:10.1016/j.hrthm.2018.06.025 (2018).
Abe, H. et al. Macrophage hypoxia signaling regulates cardiac fibrosis via Oncostatin M. Nat Commun 10, 2824, doi:10.1038/s41467-019-10859-w (2019).
El Rouby, N. et al. Genome-wide association analysis of common genetic variants of resistant hypertension. Pharmacogenomics J 19, 295-304, doi:10.1038/s41397-018-0049-x (2019).
Hori, Y. et al. Atrial reverse remodeling represented by the atrial conduction time in persistent atrial fibrillation patients after catheter ablation: its impact on predicting late atrial fibrillation recurrence. J Cardiol 75, 521-528, doi:10.1016/j.jjcc.2019.09.018 (2020).
Pathak, R. K. et al. Aggressive risk factor reduction study for atrial fibrillation and implications for the outcome of ablation: the ARREST-AF cohort study. J Am Coll Cardiol 64, 2222-2231, doi:10.1016/j.jacc.2014.09.028 (2014).
Lei, H. et al. De novo DNA cytosine methyltransferase activities in mouse embryonic stem cells. Development 122, 3195-3205 (1996).
Natsume, Y. et al. Combined Analysis of Human and Experimental Murine Samples Identified Novel Circulating MicroRNAs as Biomarkers for Atrial Fibrillation. Circ J 82, 965-973, doi:10.1253/circj.CJ-17-1194 (2018).
Oishi, S. et al. Stretch of atrial myocytes stimulates recruitment of macrophages via ATP released through gap-junction channels. J Pharmacol Sci 120, 296-304, doi:10.1254/jphs.12202fp (2012).
Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics (Oxford, England) 30, 2114-2120, doi:10.1093/bioinformatics/btu170 (2014).
Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nature methods 9, 357-359, doi:10.1038/nmeth.1923 (2012).
Lienhard, M., Grimm, C., Morkel, M., Herwig, R. & Chavez, L. MEDIPS: genome-wide differential coverage analysis of sequencing data derived from DNA enrichment experiments. Bioinformatics (Oxford, England) 30, 284-286, doi:10.1093/bioinformatics/btt650 (2014).
Robinson, M. D. & Oshlack, A. A scaling normalization method for differential expression analysis of RNA-seq data. Genome biology 11, R25, doi:10.1186/gb-2010-11-3-r25 (2010).
Kumaki, Y., Oda, M. & Okano, M. QUMA: quantification tool for methylation analysis. Nucleic Acids Res 36, W170-175, doi:10.1093/nar/gkn294 (2008).

No competing interests reported.

Download PDF

Editorial decision: Revision requested
22 Oct, 2024
Reviews received at journal
22 Oct, 2024
Reviews received at journal
09 Oct, 2024
Reviewers agreed at journal
01 Oct, 2024
Reviewers agreed at journal
30 Sep, 2024
Reviewers invited by journal
28 Sep, 2024
Editor assigned by journal
28 Sep, 2024
Editor invited by journal
29 Aug, 2024
Submission checks completed at journal
28 Aug, 2024
First submitted to journal
24 Aug, 2024

You are reading this latest preprint version

Hypermethylation of Hif3a and Ifltd1 Is Associated with Atrial Remodeling in Pressure- overload Murine Model

Status:

Version 1

Abstract

Figures

1. Introduction

2. Results

3. Discussion

4. Conclusion

5. Methods

Declarations

Data availability

References

Additional Declarations

Status:

Version 1