Further characterization of lipase B from Ustilago maydis expressed in Pichia pastoris: a member of the Candida antarctica lipase B-like superfamily

doi:10.21203/rs.3.rs-4970689/v1

Download PDF

Research Article

Further characterization of lipase B from Ustilago maydis expressed in Pichia pastoris: a member of the Candida antarctica lipase B-like superfamily

https://doi.org/10.21203/rs.3.rs-4970689/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Lipases from the basidiomycete fungus Ustilago maydis are promising but underexplored biocatalysts due to their high homology with Candida antarctica lipases. This study provides a comprehensive characterization of a recombinant CALB-like lipase from U. maydis expressed in Pichia pastoris (rUMLB), and compares its properties with those of the well-studied recombinant lipase B from C. antarctica (rCALB). Biochemical analyses included evaluations of optimal pH, temperature, triglyceride (TG) preference for short and medium acyl chains, phospholipase and amidase activities, enantiopreference, thermostability, stability in organic solvents, and responses to NaCl concentration.

rUMLB, a glycosylated enzyme with a molecular weight of 38.6 kDa, exhibited cold-active behavior at 0°C and preferred hydrolysis on short-chain fatty acid TGs, like rCALB. Both enzymes displayed strong (R)-enantiopreference and increased activity in non-polar solvents; however, rUMLB was more sensitive to polar solvents. Notably, rUMLB, and was activated at high salt concentrations as previously reported for rCALB. rUMLB uniquely demonstrated significant phospholipase activity towards natural phospholipids, a feature not observed in rCALB. These comparative insights highlight the functional diversity within the CALB-type lipase family, underscoring UMLB’s potential as a versatile biocatalyst and providing valuable information for biotechnological applications and the understanding of enzyme structure-function relationships of CALB superfamily.

Lipase

Ustilago maydis

Candida antarctica

Enantiopreference

Phospholipase activity

Organic solvent

Cold-active enzymes

Lipases (Triacylglycerol ester hydrolases, EC 3.1.1.3) are a diverse group of enzymes that catalyze the hydrolysis of ester bonds in lipids, facilitating various biochemical transformations. These enzymes play a crucial role in numerous industrial applications, including the production of biodiesel, flavor enhancement in food, and the synthesis of pharmaceuticals.

Among the various lipases, Candida antarctica lipase B (CALB) is one of the most extensively studied and utilized. CALB is known for its exceptional catalytic versatility, enabling it to perform a broad spectrum of reactions such as transesterification, interesterification, aminolysis, ammonolysis, and desymmetrization. It can act on a diverse array of substrates including chiral esters, amines, primary alcohols, and carboxylic acids [1–3].

Furthermore, CALB is recognized for its stability in organic solvents and its tolerance to high temperatures, which enhances its applicability in various industrial processes [4–6].

The reclassification of Candida antarctica as Pseudozyma aphidis [7] has led to the discovery of several lipases within the Ustilaginaceae family, which exhibit significant homology to CALB. Among these, lipases from species such as Ustilago hordei, Sporisorium reilianum, Pseudozyma hubeiensis, Pseudozyma brasiliensis, and Ustilago maydis show over 50% homology with CALB [7, 8]. Specifically, Ustilago maydis, a corn-infecting fungus, has over ten hypothetical lipases listed in its genome [9]. Notably, its CALB-type lipase (UMLB) shares 66% homology with CALB and has been identified through genome mining for its hydrolytic activity on phospholipids, esters, and Tween 20/80 substrates [10].

The catalytic triad of UMLB composed of Ser106, Asp188, and His225, with the catalytic Ser residing in the conserved TWSQG motif, a hallmark of CALB and other serine hydrolases [5, 10, 11]. While the crystal structure of UMLB remains unresolved, a 3D model based on CALB reveals notable similarities and differences, such as the substitution of Leu140 for Glu160 and Ile285 for Leu305, affecting the active site pocket’s polarity and size [10]. Additionally, the less conserved α5 helix region in UMLB, compared to CALB, influences the enzyme´s access to its catalytic site [5, 11, 12].

Despite their sequence homology, CALB and UMLB exhibited distinct substrate specificities. Notably, UMLB shows phospholipase A activity, which was not detected in CALB [10]. However, comprehensive comparisons of their catalytic properties, including triglyceride preferences, enantiopreference, NaCl halotolerance, and solvent and thermal stabilities, have not been fully elucidated.

This study aims to bridge this knowledge gap by characterizing a recombinant CALB-type lipase from U. maydis (rUMLB) expressed in Pichia pastoris and comparing it to the well-studied recombinant lipase B from C. antarctica (rCALB). Through detailed biochemical analyses, we seek to understand the functional diversity within the CALB-type lipase family and explore UMLB’s potential as a versatile biocatalyst for biotechnological applications.

2.1 Chemicals and enzymes.

Zeocin™ was obtained from Invitrogen (USA). Restriction enzymes, their buffers, DNA polymerase, and DNA ligase were obtained from New England Biolabs (USA). All other reagents and solvents were supplied by Sigma-Aldrich (Mexico).

2.2 Cloning and expression of UMLB in P. pastoris

The CALB-type lipase gene from U. maydis (UMLB, UniProt: A0A0D1CES2) was codon-optimized for P. pastoris and delivered on a pUC57 plasmid (GenScript®, USA). The UMLB gene sequence (1011 pb) was amplified by PCR using the following primers: forward primer, 5´-GGTGAATTCGCCATGAAGACCACATCAGTTATCTCAGCC − 3´; reverse primer 5´- CCGGGTACCCTAATTGATGGTTCCTGAGCAAGTCTTTTTAC − 3´. The EcoRI and KpnI restriction sites were incorporated into the forward and reverse primers, respectively. The PCR product was digested and ligated into the corresponding sites of the digested pGAPZαA vector to generate pGAPZαA-UMLB. The expression plasmid was linearized with BspHI and introduced into P. pastoris SMD1168H cells (Invitrogen) by electroporation (1500 V, 200 Ω, 25 µF). Transformed P. pastoris cells were cultured in baffled flasks containing 200 mL of YPD broth (10 g L^− 1 yeast extract, 20 g L^− 1 peptone, 10% (w v^− 1) glucose) at 30°C, 120 rpm. After 48 h, the culture was centrifuged, and the supernatant was concentrated with 10 kDa nitrocellulose membranes (Ultracel®, Millipore).

2.3 Purification and mass determination of recombinant lipases

Ammonium sulfate (NH₄)₂SO₄ was gradually added to concentrated rUMLB to achieve a final concentration of 4 M. The resulting precipitate was centrifuged at 22,000 x g, 4°C, for 15 min to obtain a pellet. This pellet was resuspended in 150 mL of buffer B (20 mmol L^− 1, Tris-HCl, pH 7.2, ammonium sulfate 1 mol L^− 1) and loaded onto an equilibrated column of butyl-Sepharose Fast Flow (GE healthcare). Purification was performed using Fast Protein Liquid Chromatography (FPLC, Äkta Purifier). The enzyme was eluted with a descending linear gradient from 100 to 0% of Buffer B using 20 mmol L^− 1 Tris-HCl, pH 7.2 (Buffer A).

Total protein concentration was determined using the Bradford assay, with bovine serum albumin (BSA) as the standard. The purity of rUMLB was assessed by SDS-PAGE using a 12% polyacrylamide gel. The molecular weight of rUMLB and rCALB was estimated using matrix-assisted laser desorption/ionization-time-of-flight (MALDI-TOF) mass spectrometry (Microflex Biotyper, Bruker). Five microliters of each enzyme sample (approximtely 0.2 mg mL^− 1) were mixed with 5 µL of a saturated solution of sinapinic acid (dissolved in 30% acetonitrile with 0.07% trifluoroacetic acid, w v^− 1). One microliter of the enzyme solution was then applied to a ground steel MALDI-TOF MS target plate (MSP 96 target polished Steel BC), which was pre-coated with 1 µL of a saturated sinapinic acid solution (dissolved in absolute ethanol) and allowed to dry at room temperature. Mass spectra were acquired in the linear positive mode, with ions accelerated at an extraction voltage of 25 kV. Spectra were obtained by performing at least 300 successive laser shots.

For comparison, purified rCALB expressed in P. pastoris X-33 was produced according to the method described by Martín del Campo et al. [13] and used as reference lipase.

2.4 Microplate assay of enzymatic activity

Enzymatic activity was monitored during both the production and purification stages using a pH indicator-based lipase assay (PHIBLA) [14]. The assay commenced with the preparation of a substrate-emulsion. This process involved the sequential addition, drop by drop, of one volume of substrate-indicator solution, which contained tributyrin (TG(C4:0)) (50 mmol L^− 1) and p-nitrophenol (5 mmol L^− 1) dissolved in tert-butanol, to nine volumes of a buffer solution. The buffer solution consisted of 2.5 mmol L^− 1 4-Morpholinepropanesulfonic acid buffer solution (MOPS) at pH 7.2, 150 mmol L^− 1 NaCl, 6 mmol L^− 1 CaCl₂, 0.5 mmol L^− 1 sodium taurodeoxycholate (NaTDC), and 3 mg mL^− 1 β-cyclodextrin (β-CD). The mixture was then vigorously vortexed to ensure thorough emulsification.

Subsequently, 20 µL of either rUMLB or rCALB, appropriately diluted, was added to individual wells of a 96-well microplate. Following this, 100 µL of substrate emulsion was added to each well. One unit of enzymatic activity (U) is defined as the release of 1 µmol of fatty acid per minute under the specified assay conditions. All the experiments were conducted in triplicate to ensure accuracy and reproducibility.

2.5 Triglyceride preference on pH-stat

The hydrolytic activity of rUMLB and rCALB on short- and medium-chain triglycerides (C2:0, C3:0, C4:0, and C8:0) was assayed potentiometrically by automatically titrating the free fatty acids released from mechanically stirred triglyceride emulsions using a pH-stat device (799 GPT Titrino, Metrohm). The pH was maintained constant using a 0.1 mol L^− 1 NaOH titiration solution. The assay was conducted in a thermostated vessel at the optimal temperature of each enzyme.

The substrate emulsion consisted of 0.5 mL of triglycerides (TG) and 29.5 mL of buffer solution, wich was prepared with 0.3 mmol L^− 1 Tris-HCl buffer at pH 8, 150 mmol L^− 1 NaCl, and 5 mmol L^− 1 CaCl₂). The TG were added directly to the buffer solution and emulsified by mechanical stirring at 850 rpm. The reaction was initiated by adding 9.0 to 14.0 µg for rUMLB or 3.0 to 6.0 µg for rCALB, each properly diluted with water. A blank assay without enzyme was included to account for spontaneous hydrolysis. One unit of enzymatic activity (U) is defined as the release of 1 µmol of fatty acid per minute under the assay conditions. All the experiments were conducted in triplicate to ensure accuracy and reproducibility.

2.6 Optimal pH and temperature activity, and thermostability

The optimum pH and temperature of rUMLB and rCALB were determined using a pH-stat assay with TG(C4:0) as the substrate, as outlined in the enzymatic activity assay section. pH effects were assessed over a range from 4.0 to 10.0, while temperature effects were evaluated between 0 and 60°C.

Thermostability was examined by incubating 1 µg of each enzyme in 100 µL of 2.5 mmol L^− 1 MOPS buffer over a temperature range of 30 to 80°C for up to 4 h. Residual activity was measured at pH 7.2 using TG(C4:0) as substrate, performed at each enzyme’s optimal temperature.

Circular dichroism (CD) spectra were recorded to analyze thermal stability, using a Jasco 815 dichrograph. Spectra were collected from 25 to 95°C, with 5-min intervals of analysis every 10°C. Far- UV CD spectra were measured between 195 and 300 nm, at a scanning rate of 50 nm min^− 1, with an integration time (DIT) of 1 s and a bandwidth of 1 nm. Measurements were conducted in 2-mm thick quartz cells containing 0.1 mg mL^− 1 of each enzyme. Data smoothing was performed using Spectra Manager software, applying the means-movement procedure with a convolution width of 5. The CD spectra were analyzed to determine mean residue ellipticity ([θ]_mrw,λ) at 222 nm.

2.7 Effect of NaCl concentration on the activity of rUMLB towards TG

The effect of NaCl concentration on the activity of rUMLB was investigated using a pH-stat method at 40°C and pH 8.0. The enzyme activity was assessed with TG(4:0 and 8:0) across a range of NaCl concentrations.

NaCl solutions were prepared by diluting a 5.2 mol L^− 1 stock solution in a buffer containing 0.3 mmol L^− 1 Tris-HCl (pH 8) and 5 mmol L^− 1 CaCl₂ to achieve the desired NaCl molarity. Enzyme reactions were initiated by adding 2.0 to 14.0 µg of rUMLB, properly diluted with water. A blank assay, which excluded the enzyme, was used to account for any spontaneous hydrolysis.

The results were expressed as relative activity, with the activity measured under optimal conditions (150 mmol L^− 1 NaCl, 0.3 mmol L^− 1 Tris-HCl buffer at pH 8, and 5 mmol L^− 1 CaCl₂) set as the baseline. One unit enzymatic activity (U) is defined as the release of 1 µmol of fatty acid per minute under the assay conditions. All experiments were performed in triplicate to ensure accuracy and reproducibility.

2.8 Amidase activity determination

Capsaicinoids, specifically N-vanillylbutyramide (VAMC4) and N-vanillylhexanamide (VAMC6), were synthesized and purified following the procedure outlined by Diaz-Vidal et al. [15]. The hydrolysis of capsaicin, VAMC4, and VAMC6 was conducted in 2 mL glass vials containing a total reaction volume of 1 mL. Each reaction mixture comprised one part of capsaicinoid solution (115 mmol L^− 1 capsaicin, VAMC4, or VAMC6 in methanol) and nine parts of buffer solution. The buffer solution consisted of 2.5 mmol L^− 1 MOPS (pH 7.2), 5 mmol L^− 1 CaCl₂, 150 mmol L^− 1 NaCl, 0.5 mmol L^− 1 NaTDC, and 3 mg mL^− 1 β-cyclodextrin.

The reactions were initiated by adding 5 U of rUMLB and rCALB (measured on TG(4:0)) and were maintained at room temperature with constant stirring at 500 rpm for 7 h. Samples were withdrawn hourly and extracted twice with chloroform to isolate the capsaicinoids. The quantification of residual capsaicin, VAMC4, and VAMC6 was performed using high-throughput thin layer chromatography (HPTLC). Samples and a standard curve of capsaicin and each pure capsaicinoid were applied to a \(\:10x20\) cm TLC plate using a Linomat 5 Sampler Applicator (CAMAG, Switzerland). The plates were developed in a twin trough glass chamber with a 50/50, (v v^− 1) mixture of petroleum ether and ethyl acetate. After development, the plates were sprayed with 50% (v v^− 1) sulfuric acid and charred in a TLC Heater III (CAMAG, Switzerland) at 165°C for 2–5 min. Quantification of the remaining capsaicin and capsaicinoids was carried out by densitometry scanning at 500 nm using a TLC Scanner 3 (CAMAG, Switzerland). The resulting peaks were analyzed with winCATS Software (CAMAG, Switzerland). One unit of amidase activity (U) was reported as the hydrolysis of 1 µmol of capsaicinoids per hour. All the experiments were performed in triplicate to ensure reliability and reproducibility of the results.

2.9 Determination of phospholipase activity in microplate

Phospholipase activity of rUMLB and rCALB was determined spectrophotometrically using p-nitrophenol as an indicator, as reported by Sutto-Ortiz et al. [16]. The assay utilized egg L-α-phosphatydilcholine (Egg PC) as substrate. The substrate emulsion was prepared by combining one volume of Egg PC (140 mg L^− 1 in 2-propanol), one volume of cresol red (4 mmol L^− 1 in 2-propanol) as pH indicator, and 18 volumes of a buffer solution composed of 2.5 mmol L^− 1 Tris buffer (pH 8.2), 150 mmol L^− 1 NaCl, 10 mmol L^− 1 CaCl₂, 10 mmol L^− 1 NaTDC, and 3 mg mL^− 1 β-CD.

Each well of a 96-well microtiter plate was filled with 20 µL of enzyme sample, appropriately diluted, and 100 µL of the substrate emulsion. The microplate was quickly placed in a microplate reader chamber set to 37°C. The reaction was monitored at 580 nm for 15 min, with data collected every 30 s. To maintain consistent mixing, orbital shaking was applied for 5 s before each reading. All the experiments were performed in triplicate. One unit enzymatic activity (U) is defined as the release of 1 µmol of fatty acid per minute under the assay conditions.

2.10 Enantiopreference assay

The enantiopreference of rUMLB and rCALB was determined without competition, following the method reported by Mateos et al. [17]. The substrates used were (R, S)-glycidyl butyrate, (R, S)-ethyl hydroxy butyrate, and (R, S)-methyl hydroxy valerate enantiomers.

For the assay, a substrate solution was prepared by mixing 900 µL of buffer solution with 100 µL of a 50 mmol L^− 1 enantiomer solution. The buffer solution contained 2.5 mmol L^− 1 MOPS, 150 mmol L^− 1 NaCl, 0.5 mmol L^− 1 NaTDC, 6 mmol L^− 1 CaCl_2, and 3 mg mL^− 1 β-CD at pH 7.2. The enantiomer solution, containing 5 mmol L^− 1 p-nitrophenol, was dissolved in various co-solvents: dimethyl sulfoxide (DMSO), dimethylformamide (DMF), acetonitrile (CH₃CN), tert-butyl alcohol (TBA), tetrahydrofuran (THF), and tert-amyl alcohol (TAA).

In each well of a microplate, 100 µL of the substrate solution was mixed with 20 µL appropriately diluted rUMLB or rCALB. The microplate was immediately positioned in a preconditioned chamber at 37°C in a microplate reader (EON, BioTek. Hydrolysis rates were monitored by measuring absorbance at 410. To ensure consistent mixing, orbital shaking was applied for 5 s before each reading, and data were collected every 30 s over a 15-minute period. A blank assay without enzyme was conducted for each substrate to account for any non-enzymatic reactions. One unit enzymatic activity (U) is defined as the release of 1 µmol of fatty acid per minute under the assay conditions. All the experiments were performed in triplicate to ensure accuracy and reproducibility. Reaction rates for each enantiomer were calculated as reported by Mateos et al. [17].

2.11 Effect of organic solvents on the stability and conformation of rUMLB and rCALB

To assess the effect of organic solvents on the stability and conformation of rUMLB and rCALB, enzyme solutions containing 10 µg mL^− 1 of each enzyme in 30% (v v^− 1) organic solvent (dimethyl sulfoxide, (DMSO), methanol (MeOH), acetonitrile (CH₃CN) acetone (ACE), tetrahydrofuran (THF), 1-butanol (1BA), tert-butyl alcohol (TBA), toluene (PhCH₃), hexane (HXE), and isooctane (IOCT)) were prepared in 2.5 mmol L^− 1 MOPS buffer (pH 7.2). These solutions were incubated for 2 h at 30°C with agitation at 1,000 rpm in a Thermomixer R (Eppendorf, 1.5 mL). After incubation, the organic phase was separated by centrifugation at maximum speed for 15 min. For the stability assay, 1 µg of enzyme was tested for residual activity using the PHIBLA method as previously described.

For the conformation assay, the fluorescence of 75 µg of rUMLB and rCALB in 2.5 mmol L^− 1 MOPS buffer (pH 7.2) was measured using a microplate reader (Tecan, Infinite M200 PRO). Fluorescence was recorded with excitation at 280 nm and emission ranging from 300 to 400 nm. Relative fluorescence units (RFU) were obtained after subtracting the blank readings from samples consisting of 2.5 mmol L^− 1 MOPS buffer (pH 7.2) with 30% (v/v) solvent. For solvents such as DMSO, THF, ACE, MeOH, and CH₃CN, the RFU values were adjusted by multiplying by a correction factor of 0.7 to account for solvent solubility effects.

3.1 Production and purification of rUMLB and rCALB

The lipases UMLB from U. maydis and CALB from C. antarctica were successfully expressed in P. pastoris in their mature form with their native signal peptides intact. Expression levels were evaluated after 48 h of fermentation to minimize proteolysis. Under these conditions, the production levels were approximately 29 mg of target protein L^− 1 for rUMLB and 390 mg of target protein L^− 1 for rCALB (Supplementary Table S1). The UMLB enzyme possesses an open reading frame (ORF) of 1011 bp, which encodes a putative mature protein of 317 amino acids and has a theoretical mass of 33 kDa. Similarly, CALB has a theoretical mass of 33 kDa (Supplementary Table S2).

Both rUMLB and rCALB were purified using hydrophobic chromatography (Supplementary Table S1). SDS-PAGE analysis of the purified enzymes revealed single bands corresponding to molecular weights of 37 kDa and 35 kDa for rUMLB and rCALB, respectively (Supplementary Fig. S1). These findings were corroborated by MALDI-TOF mass spectrometry, which measured molecular weights of 38.62 kDa for rUMLB and 35.86 kDa for rCALB (Supplementary Fig. S2). The observed increases in molecular weight, approximately 16.3% for rUMLB and 8.6% for rCALB relative to their theoretical values, suggest that both enzymes are glycosylated (Supplementary Fig. S2).

Further analysis of N-glycosylation sites, conducted using the NetNGlyc 1.0 Server, identified two N-glycosylation sites in the mature sequence of rUMLB (N44 and N75, number notation starting from the mature sequence). Notably, the second site (N75) corresponds to N74 in the mature sequence of rCALB.

3.2 Preference for triglycerides

The substrate preference of rUMLB and rCALB for short- and medium- chain triglycerides was evaluated using the pH-stat method (Fig. 1). Both enzymes demonstrated distinct preferences for short-chain triglycerides (C2 to C4). rUMLB exhibited the highest specific activity on triacetin (TG(3:0)), reaching 699 ± 9 U mg^-1, indicating a strong preference for this substrate. In contrast, rCALB showed the highest specific activity (930 ± 9 U mg^-1) on TG(4:0). Additionally, both enzymes exhibited significant lower activity on the medium-chain triglyceride trioctanoin (TG(8:0)), with specific activities of 4.7 ± 0.1 U mg^-1 for rUMLB and 7.6 ± 3 U mg^-1 for rCALB.

3.3 Effect of pH and temperature on activity and thermostability of rUMLB and rCALB

The relative activities of rUMLB and rCALB in the hydrolysis of TG(4:0) were measured over a pH range of 4 to 10 and a temperature range of 0 to 60 ºC using the pH-stat method (Fig. 2A and B). rUMLB exhibited optimal activity at pH 8.0, reaching 401 ± 7.6 U mg^− 1, while rCALB achieved its highest activity at pH 7.0, with 838 ± 6.4 U mg^− 1 (Fig. 2A). Both enzymes displayed similar relative activity profiles between 0 and 40 ºC; however, rUMLB experienced a significant drop-in activity (about 22%) above 50 ºC, resulting in complete loss of activity at 60 ºC. In contrast, rCALB’s relative activity decreased only slightly (about 35%) from 50 to 60 ºC (Fig. 2B). This temperature profile was also reflected in the comparative Arrhenius plot (Fig. 2C), where both enzymes required similar activation energy between 0 and 40 ºC.

The thermal stability of rUMLB and rCALB was evaluated by incubating the enzymes at various temperatures for 1 to 4 h. rUMLB retained over 80% of its activity at 30 and 40 ºC for up to 4 h; however, its residual activity fell below 50% after 2 h at temperatures above 50 ºC (Supplementary Fig. S3A). Conversely, rCALB maintained over 50% of its activity for up to 3 h at temperatures ranging from 30 to 50 ºC, and more than 30% of activity was retained for up to 2 h at temperatures between 60 and 80 ºC (Supplementary Fig. S3B). These differences in thermal stability were also reflected in the half-life (T_1/2) values at 50°C, being 1.7 and 2.7 h for rUMLB and rCALB, respectively (Supplementary Fig. S3C). Far-UV CD spectra analysis revealed a significant change in the secondary structure for both enzymes at temperatures above 50 ºC (Supplementary Fig. S3D).

3.4 Effect of NaCl on the hydrolytic activity of rUMLB on TGs

The lipolytic activity of rUMLB was evaluated to determine its hydrolytic efficiency on TG(4:0) and TG(8:0) at 40°C and pH 8.0, across NaCl concentrations ranging from 0 to 5.0 mol L^− 1 (Fig. 3). This was accomplished using the pH-stat method, as previously described by Martin del Campo et al. [13].

For TG(4:0) hydrolysis, rUMLB’s activity exhibited a minor decrease to 90% at 1 mol L^− 1 NaCl but increased slightly at higher NaCl concentrations. The enzyme maintained near-optimal activity, ranging from 94% at 2 mol L^− 1 to approximately 106% at 5 mol L^− 1 NaCl.

In contrast, when TG(8:0) was used as substrate, rUMLB activity significantly increased with NaCl concentration, achieving an eightfold increase in relative activity at 4 mol L^− 1 NaCl compared to the standard assay condition (0.15 mol L^− 1 NaCl). Although there was a

slight decline in activity beyond 4 mol L^− 1 NaCl, rUMLB’s relative activity remained approximately seven times higher at 5 mol L^− 1 NaCl compared to the standard assay condition.

These findings align with observations made by Martín del Campo et al. [13] for rCALB. Similar to rUMLB, rCALB exhibited a greater increase in specific activity for TG(8:0) compared to TG(4:0) in response to higher NaCl concentrations, showing 1.5-fold higher activity for TG(4:0) and 8.7-fold higher for TG(8:0) compared to the standard assay. In comparison Martín del Campo et al. [13] reported that rCALB’s activity is consistently higher across all NaCl concentrations, with a notable increase at 5.2 mol L^− 1 NaCl, contrasting with the slight inhibition observed for rUMLB under 1 to 2 mol L^− 1 NaCl for TG(4:0).

3.4 Amidase activity

The initial reaction rates of rUMLB and rCALB for the hydrolysis of capsaicin and two capsaicin analogs with different acyl chain lengths are depicted in Fig. 4. The analogs include VAMC4 with a 4-carbon chain VAMC6 with a 6-carbon chain. Both rUMLB and rCALB displayed a similar substrate preference profile, showing a greater preference for VAMC4 over the other substrates. However, rUMLB exhibited lower amidase activity compared to rCALB, with initial hydrolysis rates of 0.97 µmol mg^− 1 h^− 1 for VAMC4, 0.75 µmol mg^− 1 h^− 1 for VAMC6 and 0.3 µmol mg^− 1 h^− 1 for capsaicin. In contrast, rCALB demonstrate higher catalytic efficiency, with initial hydrolysis rates of 2.3 mg^− 1 h^− 1 for VAMC4, 1.2 mg^− 1 h^− 1 for VAMC6, and 0.97 µmol mg^− 1 h^− 1 for capsaicin.

3.5 Phospholipase activity

The hydrolytic specific activities of rUMLB and rCALB were evaluated spectrophotometrically using long chain phospholipids (Egg PC) and compared with their activity on TG(4:0), both assessed using a microplate assay (Table 1). rUMLB demonstrated phospholipase A activity on Egg PC, exhibiting twice the specific activity compared to TG(4:0). In contrast, rCALB showed significant lower specific activity on Egg PC, being 4.5 times less effective compared to tributyrin.

Table 1

Specific activities (U mg^− 1) of recombinant lipases on tributyrin (TG(4:0)) and phosphatidylcholine (Egg PC), determined with a microplate assay.
Lipases	TG (4:0)	Egg PC
rUMLB	49.9 ± 1.2	80.1 ± 7.9
rCALB	53.6 ± 2.9	11.9 ± 0.4
Values are the average of three independent assays ± SD

3.6 Enantiopreference of UMLB and CALB

The enantiospeference of rUMLB and rCALB for different enantiomeric substrates, solubilized in several solvents, was determined by measuring the hydrolytic activity on (R)- and (S)-enantiomers and calculating the (R)/(S) ratio (Fig. 5). Both enzymes consistently exhibited a preference for the (R)-enantiomer across all tested conditions.

When glycidyl butyrate was used as a substrate, rUMLB demonstrated a preference for the (R)-enantiomer with an (R)/(S) ratio approximately 70% greater than that of rCALB when DMSO was used as a co-solvent. Conversely, with THF as a co-solvent, rCALB exhibited a 40% higher (R)/(S) ratio compared to rUMLB. Overall, except for the specific cases involving DMSO and THF, both rUMLB and rCALB displayed similar enantiopreference profiles.

For the hydrolysis of ethyl butyrate, rUMLB’s enantiopreference remained largely consistent across all tested co-solvents. In contrast, rCALB demonstrated increased (R)/(S) ratios with decreasing LogP values of the co-solvent. Specifically, rCALB achieved an (R)/(S) ratio of 48.3, which is 90% higher than that observed for rUMLB. A similar trend was observed with methyl valerate enantiomers, where rUMLB exhibited (R)/(S) ratios between 20 and 30, while rCALB showed enhanced enantiopreference with more polar solvents, such as DMSO, achieving an (R)/(S) ratio of 79.3.

3.7 Effect of organic solvents on the stability and structural conformation of rUMLB and rCALB

The stability of rUMLB and rCALB in the presence of various organic solvents was investigated, given their shared properties. As depicted in Fig. 6, solvents with LogP values below 2.5 adversely affected the stability of rUMLB’s more than rCALB. Despite this, rUMLB retained its enzymatic activity after incubation with most organic solvents, except for acetonitrile and tetrahydrofuran. Notably, both enzymes showed enhanced catalytic activity when incubated with solvents possessing high partition coefficients (LogP), such as toluene, hexane and isooctane. This effect was particularly pronounced for rCALB, which demonstrated a fourfold increase in activity following incubation with toluene.

Fluorescence spectroscopy analysis further elucidated the impact of solvents on enzyme structure. For rUMLB, increased fluorescence intensity was observed when incubated with 1-butanol, n-hexane, isooctane, and toluene, showing more than a twofold increase compared to the control sample (Supplementary Fig. 4A). The maximum spectral shifts for rUMLB were between 314–322 nm. Conversely, solvents such as tetrahydrofuran, dimethyl sulfoxide, acetonitrile, tert-butyl alcohol, methanol, and acetone resulted in lower relative florescent units (RFU) compared to the control sample, with a notable shift in peak emission from ~ 315 nm to ~ 332 nm with methanol. For rCALB, similar increases in fluorescence intensity were observed when incubated with hexane, 1-butanol, dimethyl sulfoxide, and butyl alcohol, each showing approximately twice the intensity of the control sample, with maximum spectrum shifts between 312–322 nm (Supplementary Fig. 4B). However, RFU intensities for rCALB incubated with DMSO, methanol, tert-butyl alcohol, tetrahydrofuran, acetonitrile, and acetone were also lower than those of the control sample.

The gene encoding a CALB-type lipase from U. maydis, UMLB, was successfully cloned and constitutively expressed under the GAP promoter in P. pastoris. After 48 h, the expression of rUMLB reached approximately 29 mg L^− 1. A previous study reported recombinant expression of UMLB (named Uml2 by the authors) in P. pastoris under the AOX1 promoter, yielding a target protein with an apparent molecular mass of 50 kDa after 96 h of culture growth. This protein was highly glycosylated, with its molecular mass was reduced to 43 kDa after treatment with PNGase F [10]. In the present study, the molecular mass of rUMLB, determined by SDS-PAGE and MALDI-TOF analysis, was 38.6 kDa, which is 16% higher than the theoretical mass of mature protein, suggesting a higher degree of glycosylation compared to rCALB expressed in the same system (Supplementary Table S2). This increase in molecular weight can be attributed to the two potential N-linked glycosylation sites present in the UMLB sequence (N44 and N75), while CALB has only one site (N74), as identified by protein sequence analysis using the NetNGlyc 1.0 Server.

The difference in glycosylation levels between the less-glycosylated rUMLB in this study and the highly glycosylated Uml2 reported by Buerth et al. [10] may be related to the promoters used in P. pastoris. In the present work, rUMLB was expressed under the GAP promoter for the first time, which allowed for early-stage expression of recombinant lipase (along with cell growth) without a hyperglycosylation event [18].

rUMLB exhibited maximum activity at pH 8 and 40 ºC when TG(4:0) was used as the substrate, showing a similar temperature profile from 0–40 ºC as rCALB. Notably, rUMLB maintained 40% of its activity at 0 ºC, a feature typical of cold active-enzymes from extremophile microorganisms [19]. UMLB is an extracellular lipase derived from the pathogenic maize basidiomycete fungus U. maydis, which thrives and survives at mild temperatures (28–32 ºC) [20–22]. Therefore, rUMLB is not expected to be active at low temperatures because U. maydis is not an extremophile like C. antarctica. The observed psychrophilic behavior may be attributed to the structural similarities between UMLB and CALB. Since they share a 71% amino acid sequence identity (Supplementary Fig. 5), the residues responsible for cold-active behavior might be conserved. The molecular mechanism underlying the cold-activity of CALB is attributed to the hydrophobicity and flexibility of its active site [23]. At low temperatures, hydrophobic groups tend to hydrate and become exposed on the protein surface [23, 24]. CALB features a small hydrophobic lid composed of an α-5 helix, which readily adopts an active conformation at temperatures below 20 ºC [23].

Purified rUMLB was characterized for substrate specificity using short and medium chain-length triglycerides, hydrolysis of vanillyl amides, phospholipids, as well as its enantiopreference, and the solvent effect on catalytic activity. rUMLB showed a preference for very short-chain triglycerides, with maximal specific activity on TG(3:0), and exhibited low activity towards insoluble TG(8:0), similar to rCALB, which had maximal specific activity on TG(4:0). Generally, CALB is not classified as a true lipase due to its limited hydrolysis at lipid-water interfaces with insoluble substrates.

Although lipases are highly effective biocatalysts for the enantioselective synthesis of amines [25], true lipases show no activity on amide hydrolysis [25, 26]. In contrast, esterases seem to be a better suited for amide hydrolysis [26]. CALB is a notable biocatalyst for hydrolyzing amide bonds, including racemic amides and capsaicin analogs [27–29]. The results obtained from this study demonstrated comparable amidase activities between rUMLB and rCALB with capsaicin and capsaicin analogs. Future studies could explore the range of amide substrates that rUMLB can accept, with potential applications in various fields.

The unexpected activity of certain lipases on diverse substrates, reaction conditions, and/or catalytic transformations, often referred to as lipase promiscuity, is of great interest for enhancing existing catalytic models and developing novel industrial applications [30]. rUMLB displayed outstanding phospholipase activity on natural phospholipids. The specific activity of rUMLB for the hydrolysis of egg phosphatidylcholine (egg PC) was 6.7-times greater than that of rCALB after 15 min of reaction. This aligns with previous reports where rUMLB hydrolyzed phospholipids with saturated fatty acids ranging from C6:0 to C18:0, as well as phospholipids with unsaturated fatty acids [10]. The broad substrate acceptance of rUMLB, as observed with other lipases, may be attributed to the relatively open domain area that exposes its active site or a large active site capable of accommodating bulky substrates with polar heads, such as phospholipids [31].

Enantioselectivity results from both competitive and non-competitive assays have shown a marked preference for the (R) enantiomer for CALB [17], a preference also observed for rUMLB in this study. This characteristic is conserved among CALB and other CALB-type enzymes, such as Sporisorium reilianum SRZ2, Pseudozyma brasiliensis HGH001, and Pseudozyma hubeiensis SY62 [8, 17, 32]. The enantioselectivity exhibited by CALB is attributed to the structure of its active site pocket, which is divided into two regions: an acyl side and an alcohol side. The catalytic Ser is located in the middle of these two sides, with a His residue next to it on the alcohol side. For catalytic reaction to occur, a proton must be donated or accepted from the alcohol oxygen of the substrate to the catalytic His residue. Thus, the (R) enantiomer is governed by this interaction, whereas the alcohol moiety of the (S) enantiomer is placed at a distance where a hydrogen bonding is not easily transferred [11]. Amino acid sequence alignment of UMLB and CALB (Supplementary Fig. S5) reveals a conserved pattern around the region of the active site residues, which may explain the similar enantiomeric preference of both enzymes. The (R)/(S) ratios for rUMLB and rCALB were influenced by solvent’s LogP and substrate’s polarity. Solvents can modulate enantioselectivity by affecting the flexibility of less reactive substrate enantiomer [33]. In this study, the effect of solvents was limited to %10, which was not sufficient to cause a complete shift in enantiopreference. Consequently, the solvent effect on the enantiopreference was minimized, with both substrate and enzyme interactions primarily influenced by the vastly abundant available water molecules.

From an industrial perspective, conducting biocatalytic reactions in organic media is often preferred due to several advantages, including enhanced solubility of non-polar compounds, a shift in the thermodynamic equilibrium towards synthesis rather than hydrolysis, and improved overall stability [34]. CALB is widely utilized in organic media reactions because of its high stability and activity [5, 35, 36]. Generally, solvents with a negative logP, or water-miscible organic solvents, tend to deactivate lipases more significantly than solvents with a positive logP, or water-immiscible solvents [37]. The results of this study confirm this trend for CALB, as its residual activity increased with the polarity of the solvent. In contrast, the residual activity of rUMLB was negatively affected by all the organic solvents tested, with an increase only in non-polar solvents such as toluene, hexane, and isooctane.

The residual activity results were consistent with the fluorescent spectra observed in the fluorometric assay. Toluene, hexane, and isooctane profiles for both rUMLB and rCALB showed RFU intensities higher than the control samples. After excitation with wavelengths above 295 nm, fluorescence in proteins is primarily attributed to Trp residues [38]. Partially or fully buried Trp residues exhibit a blue-shifted emission near to 309 nm, while exposed Trp residues have a maximum at 355 nm [39]. Given that both rUMLB and rCALB contain five Trp residues, the results suggest that toluene, hexane, and isooctane significantly altered the local environment of these residues, reducing their exposure on the protein surface. In contrast, the shifted peak observed for rUMLB incubated with 1-butanol to ~ 332 nm indicated that the Trp residues were more exposed to the surface, correlating with the low residual activity observed for this solvent. For both enzymes’ spectra, the intensity for acetone was recorded as zero. Acetone affects the hydration state of enzyme molecules, promoting precipitation and hindering the detection of Trp residues in the supernatant during the fluorescence assay.

According to some models, while the core structure of CALB largely remains unchanged in the presence of organic solvents, surface modifications may occur, such as a reduction in hydrophilic and an increase in hydrophobic surfaces [40]. These changes might persist after incubation, possibly due to permanent structural alterations or the formation of a solvent-induced molecular network associated with the enzyme. If such phenomena occur, an increased hydrophobic surface of the enzyme in aqueous media could enhance substrate-enzyme interactions and potentially improve lipase activity. Similar effects can be observed when enzymes are exposed to high salt concentrations, which also can impact protein fold stability [41]. rUMLB shows approximately an 8-fold increase in activity on TG(C8:0) at high NaCl concentrations and retains its activity even in the absence of NaCl, a phenomenon also observed with rCALB [13], albeit with different profile. This suggests that rUMLB, like rCALB, can be classified as a halotolerant enzyme. As previously discussed, the high sequence homology between UMLB and CALB can provide some similar characteristics, such the activation at high NaCl concentrations and tolerance to organic solvent. Halophiles produce stable and unconventional enzymes that tightly bind water and maintain solvation under conditions of extremely high salinity and low water activity [42]. This characteristic may also apply to enzymes used in biocatalysis in organic solvents. Thus, CALB, derived from a microorganism isolated from a Salt Lake [43], maintains halotolerance and stability in organic solvents. Similarly, rUMLB, as demonstrated in this study, shows comparable properties, likely due to their high sequence homology. However, additional experiments are necessary to validate the proposed hypotheses and to fully understand these findings.

The results obtained in this study suggest that, similar to rCALB, rUMLB may represent an intermediate between a lipase and an esterase. rUMLB exhibited a pronounced preference for (R)-enantiomers, consistent with rCALB and other members of the CALB-type family. Both rUMLB and rCALB displayed cold-active properties, remaining active at 0°C and showing a preference for hydrolyzing short-chain triglycerides. However, rUMLB retained activity in a neutral-alkaline pH range, whereas rCALB was active in an acid-neutral pH range. rUMLB displayed exceptional phospholipase activity on Egg PC, exceeding the specific activity observed for rCALB. Additionally, rUMLB exhibited comparable amidase activity for capsaicin and short acyl chain capsaicinoids. While CALB’s activity increased in the presence of non-polar solvents, UMLB’s activity was adversely affected by interaction with polar solvents, which interacted with the protein’s surface residues. The observed similarities and differences between rUMLB and rCALB enhance our understanding of the properties and the structure-function relationships within CALB-type lipases family.

ETHICAL APPROVAL

This article does not contain any studies with human participants or animals performed by any of the authors.

CONSENT TO PARTICIPATE

Not applicable

CONSENT TO PUBLISH

Not applicable

AUTHORS CONTRIBUTIONS

Conceptualization: M.A.R.M., J.C.M.D. and J.A.R.; Methodology: M.A.R.M., T.D.V., R.B.M.P., M.A.C.R., M.M.C. and J.A.R.; Formal analysis and investigation: M.A.R.M., T.D.V., R.B.M.P. and M.M.C.; Writing - original draft preparation: M.A.R.M., T.D.V., M.A.C.R.; Writing - review and editing: M.A.R.M., M.A.C.R. and J.A.R.; Funding acquisition: J.A.R.; Resources: J.C.M.D. and J.A.R.; Supervision: M.A.C.R., J.C.M.D. and J.A.R. All authors read and approved the final manuscript.

FUNDING

This work was supported by SEP-CONACYT grant (242544-2014).

CONFLICT OF INTEREST

The authors declare that they have no conflict of interest.

COMPETING INTERESTS

The authors have no competing interests to declare that are relevant to the content of this article.

DATA AVAILABILITY STATEMENT

Data will be made available on reasonable request

ACKNOWLEDGMENTS

M.A.R.M. is thankful to CONACYT for her doctoral scholarship. We grateful to use the MALDI-TOF equipment for rUMLB and rCALB mass determination, generously provided by Dr. Manuel Kirchmayr of CIATEJ, and we also appreciate the support from the F003-CONACYT grant 316214-2021, for the maintenance this equipment.

Larios, A., García, H. S., Oliart, R. M. and Valerio-Alfaro, G. (2004). Synthesis of flavor and fragrance esters using Candida antarctica lipase. Applied microbiology and biotechnology. 65. 373-376. http://doi:10.1007/s00253-004-1602-x
Ferreira, H. V., Rocha, L. C., Severino, R. P. and Porto, A. L. (2012). Syntheses of enantiopure aliphatic secondary alcohols and acetates by bioresolution with lipase B from Candida antarctica. Molecules. 17. 8955-8967. http://doi:10.3390/molecules17088955
Chandra, P., Enespa, Singh, R. and Arora, P. K. (2020). Microbial lipases and their industrial applications: a comprehensive review. Microbial cell factories. 19. 1-42. http://doi:10.1186/S12934-020-01428-8
Skjøt, M., De Maria, L., Chatterjee, R., Svendsen, A., Patkar, S. A., Østergaard, P. R. and Brask, J. (2009). Understanding the plasticity of the α/β hydrolase fold: lid swapping on the Candida antarctica lipase B results in chimeras with interesting biocatalytic properties. ChemBioChem. 10. 520-527. http://doi:10.1002/cbic.200800668
Anderson, E. M., Larsson, K. M. and Kirk, O. (1998). One biocatalyst–many applications: the use of Candida antarctica B-lipase in organic synthesis. Biocatalysis and Biotransformation. 16. 181-204. http://doi:10.3109/10242429809003198
Gotor‐Fernández, V., Busto, E. and Gotor, V. (2006). Candida antarctica lipase B: an ideal biocatalyst for the preparation of nitrogenated organic compounds. Advanced synthesis & catalysis. 348. 797-812. http://doi:10.1002/adsc.200606057
Feldbrügge, M., Kellner, R. and Schipper, K. (2013). The biotechnological use and potential of plant pathogenic smut fungi. Applied microbiology and biotechnology. 97. 3253-3265. http://doi:10.1007/s00253-013-4777-1
Park, S. (2015). Exploration and functional expression of homologous lipases of Candida antarctica lipase B. Korean Journal of Microbiology. 51. 187-193. http://doi:10.7845/kjm.2015.5037
Mueller, O., Kahmann, R., Aguilar, G., Trejo-Aguilar, B., Wu, A. and de Vries, R. P. (2008). The secretome of the maize pathogen Ustilago maydis. Fungal Genetics and Biology. 45. S63-S70. http://doi:10.1016/j.fgb.2008.03.012
Buerth, C., Kovacic, F., Stock, J., Terfrüchte, M., et al. (2014). Uml2 is a novel CalB-type lipase of Ustilago maydis with phospholipase A activity. Applied microbiology and biotechnology. 98. 4963-4973. http://doi:10.1007/s00253-013-5493-6
Uppenberg, J., Oehrner, N., Norin, M., Hult, K., et al. (1995). Crystallographic and molecular-modeling studies of lipase B from Candida antarctica reveal a stereospecificity pocket for secondary alcohols. Biochemistry. 34. 16838-16851. http://doi:10.1021/bi00051a035
Zisis, T., Freddolino, P. L., Turunen, P., van Teeseling, M. C., Rowan, A. E. and Blank, K. G. (2015). Interfacial activation of Candida antarctica lipase B: Combined evidence from experiment and simulation. Biochemistry. 54. 5969-5979. http://doi:10.1021/acs.biochem.5b00586
Martin del Campo, M., Gómez-Secundino, Osvaldo, Camacho-Ruíz, R. M., Díaz, J. C. M., Müller-Santos, M. and Rodríguez, J. A. (2023). Effects of kosmotropic, chaotropic, and neutral salts on Candida antarctica B lipase: An analysis of the secondary structure and its hydrolytic activity on triglycerides. Biochimica et Biophysica Acta (BBA)-Molecular and Cell Biology of Lipids. 1868. 159380. https://doi.org/10.1016/j.bbalip.2023.159380
Camacho-Ruiz, M. D. l. A., Mateos-Díaz, J. C., Carrière, F. and Rodriguez, J. A. (2015). A broad pH range indicator-based spectrophotometric assay for true lipases using tributyrin and tricaprylin. Journal of lipid research. 56. 1057-1067. http://doi:10.1017/CBO9781107415324.004
Diaz‐Vidal, T., Armenta‐Perez, V. P., Rosales‐Rivera, L. C., Mateos‐Díaz, J. C. and Rodríguez, J. A. (2019). Cross‐linked enzyme aggregates of recombinant Candida antarctica lipase B for the efficient synthesis of olvanil, a nonpungent capsaicin analogue. Biotechnology progress. 35. e2807. http://doi:10.1002/btpr.2807
Sutto-Ortiz, P., de los Angeles Camacho-Ruiz, M., Kirchmayr, M. R., El Alaoui, M., et al. (2017). Screening of phospholipase A activity and its production by new actinomycete strains cultivated by solid-state fermentation. PeerJ. 5. e3524. http://doi:10.7717/peerj.3524
Mateos, J., Ruiz, K., Rodriguez, J., Cordova, J. and Baratti, J. (2007). Mapping substrate selectivity of lipases from thermophilic fungi. Journal of Molecular Catalysis B: Enzymatic. 49. 104-112. http://doi:10.1016/j.molcatb.2007.08.003
Wu, J., Lin, J., Chieng, L., Lee, C. and Hsu, T. (2003). Combined use of GAP and AOX1 promoter to enhance the expression of human granulocyte-macrophage colony-stimulating factor in Pichia pastoris. Enzyme and Microbial Technology. 33. 453-459. http://doi:10.1016/S0141-0229(03)00147-9
Santiago, M., Ramírez-Sarmiento, C. A., Zamora, R. A. and Parra, L. P. (2016). Discovery, molecular mechanisms, and industrial applications of cold-active enzymes. Frontiers in Microbiology. 7. 1408. http://doi:10.3389/FMICB.2016.01408/BIBTEX
Holliday, R. (1974). Ustilago maydis. Bacteria, bacteriophages, and fungi. 575-595. https://doi.org/10.1007/978-1-4899-1710-2_31
Unrau, P. and Holliday, R. (1970). A search for temperature-sensitive mutants of Ustilago maydis blocked in DNA synthesis. Genetics Research. 15. 157-169. http://doi:10.1017/S001667230000149X
Wang, J., Holden, D. W. and Leong, S. A. (1988). Gene transfer system for the phytopathogenic fungus Ustilago maydis. Proceedings of the National Academy of Sciences. 85. 865-869.
Ganjalikhany, M. R., Ranjbar, B., Taghavi, A. H. and Tohidi Moghadam, T. (2012). Functional motions of Candida antarctica lipase B: a survey through open-close conformations. PloS one. 7. e40327. http://doi:10.1371/journal.pone.0040327
Dias, C. L., Ala-Nissila, T., Wong-Ekkabut, J., Vattulainen, I., Grant, M. and Karttunen, M. (2010). The hydrophobic effect and its role in cold denaturation. Cryobiology. 60. 91-99. http://doi:10.1016/J.CRYOBIOL.2009.07.005
Nakagawa, Y., Hasegawa, A., Hiratake, J. and Sakata, K. (2007). Engineering of Pseudomonas aeruginosa lipase by directed evolution for enhanced amidase activity: mechanistic implication for amide hydrolysis by serine hydrolases. Protein Engineering, Design & Selection. 20. 339-346. http://doi:10.1093/protein/gzm025
Henke, E. and Bornscheuer, U. T. (2003). Fluorophoric assay for the high-throughput determination of amidase activity. Analytical chemistry. 75. 255-260. http://doi:10.1021/ac0258610
Torres-Gavilán, A., Castillo, E. and López-Munguía, A. (2006). The amidase activity of Candida antarctica lipase B is dependent on specific structural features of the substrates. Journal of Molecular Catalysis B: Enzymatic. 41. 136-140. http://doi:10.1016/j.molcatb.2006.06.001
Wagegg, T., Enzelberger, M. M., Bornscheuer, U. T. and Schmid, R. D. (1998). The use of methoxy acetoxy esters significantly enhances reaction rates in the lipase-catalyzed preparation of enantiopure 1-(4-chloro phenyl) ethyl amines. Journal of biotechnology. 61. 75-78.
Smidt, H., Fischer, A., Fischer, P. and Schmid, R. D. (1996). Preparation of optically pure chiral amines by lipase-catalyzed enantioselective hydrolysis of N-acyl-amines. Biotechnology techniques. 10. 335-338. http://doi:10.1007/BF00173249
Hult, K. and Berglund, P. (2007). Enzyme promiscuity: mechanism and applications. Trends in biotechnology. 25. 231-238. http://doi:10.1016/j.tibtech.2007.03.002
Amara, S., Lafont, D., , Fiorentino, B., Boullanger, P., Carrière, F. and De Caro, A. (2009). Continuous measurement of galactolipid hydrolysis by pancreatic lipolytic enzymes using the pH-stat technique and a medium chain monogalactosyl diglyceride as substrate. Biochimica et Biophysica Acta (BBA)-Molecular and Cell Biology of Lipids. 1791. 983-990. http://doi:10.1016/j.bbalip.2009.05.002
Kim, Y. H. and Park, S. (2017). Surveying enantioselectivity of two Candida antarctica‐lipase‐B homologs towards chiral sec‐alcohols. Bulletin of the Korean Chemical Society. 38. 1358-1361. http://doi:10.1002/bkcs.11289
Rariy, R. V. and Klibanov, A. M. (2000). On the relationship between enzymatic enantioselectivity in organic solvents and enzyme flexibility. Biocatalysis and Biotransformation. 18. 401-407. http://doi:10.3109/10242420009015259
Kumar, A., Dhar, K., Kanwar, S. S. and Arora, P. K. (2016). Lipase catalysis in organic solvents: advantages and applications. Biological procedures online. 18. 1-11. http://doi:10.1186/s12575-016-0033-2
Secundo, F., Carrea, G., Soregaroli, C., Varinelli, D. and Morrone, R. (2001). Activity of different Candida antarctica lipase B formulations in organic solvents. Biotechnology and bioengineering. 73. 157-163.
Hari Krishna, S. and Karanth, N. (2002). Lipases and lipase-catalyzed esterification reactions in nonaqueous media. Catalysis Reviews. 44. 499-591. http://doi:10.1081/CR-120015481
Kamal, M. Z., Yedavalli, P., Deshmukh, M. V. and Rao, N. M. (2013). Lipase in aqueous‐polar organic solvents: Activity, structure, and stability. Protein Science. 22. 904-915. http://doi:10.1002/pro.2271
Grinvald, A. and Steinberg, I. (1976). The fluorescence decay of tryptophan residues in native and denatured proteins. Biochimica et Biophysica Acta (BBA)-Protein Structure. 427. 663-678. http://doi:10.1016/0005-2795(76)90210-5
Royer, C. A. (2006). Probing protein folding and conformational transitions with fluorescence. Chemical reviews. 106. 1769-1784. http://doi:10.1021/cr0404390
Trodler, P. and Pleiss, J. (2008). Modeling structure and flexibility of Candida antarctica lipase B in organic solvents. BMC structural biology. 8. 1-10. https://doi.org/10.1186/1472-6807-8-9
Date, M. S. and Dominy, B. N. (2013). Modeling the influence of salt on the hydrophobic effect and protein fold stability. Communications in Computational Physics. 13. 90-106. https://doi.org/10.4208/cicp.290711.121011s
DasSarma, S. and DasSarma, P. (2015). Halophiles and their enzymes: negativity put to good use. Current opinion in microbiology. 25. 120-126. https://doi.org/10.1016/j.mib.2015.05.009
Goto, S., Sugiyama, J. and Iizuka, H. (1969). A taxonomic study of Antarctic yeasts. Mycologia. 61. 748-774. https://doi.org/10.1080/00275514.1969.12018794

SupplementaryinformationRoblesMachucatoABB.docx

Download PDF

Reviewers agreed at journal
02 Sep, 2024
Reviewers invited by journal
28 Aug, 2024
Editor invited by journal
27 Aug, 2024
First submitted to journal
26 Aug, 2024

You are reading this latest preprint version

Further characterization of lipase B from Ustilago maydis expressed in Pichia pastoris: a member of the Candida antarctica lipase B-like superfamily

Status:

Version 1

Abstract

Figures

1. INTRODUCTION

2. MATERIAL AND METHODS

2.1 Chemicals and enzymes.

2.2 Cloning and expression of UMLB in P. pastoris

2.3 Purification and mass determination of recombinant lipases

2.4 Microplate assay of enzymatic activity

2.5 Triglyceride preference on pH-stat

2.6 Optimal pH and temperature activity, and thermostability

2.7 Effect of NaCl concentration on the activity of rUMLB towards TG

2.8 Amidase activity determination

2.9 Determination of phospholipase activity in microplate

2.10 Enantiopreference assay

2.11 Effect of organic solvents on the stability and conformation of rUMLB and rCALB

3. RESULTS

3.1 Production and purification of rUMLB and rCALB

3.2 Preference for triglycerides

3.3 Effect of pH and temperature on activity and thermostability of rUMLB and rCALB

3.4 Effect of NaCl on the hydrolytic activity of rUMLB on TGs

3.4 Amidase activity

3.5 Phospholipase activity

3.6 Enantiopreference of UMLB and CALB

3.7 Effect of organic solvents on the stability and structural conformation of rUMLB and rCALB

4. DISCUSSION

5. CONCLUSIONS

Declarations

References

Supplementary Files

Status:

Version 1