KLF2 controls the apoptosis of neutrophils and is associated with disease activity of systemic lupus erythematosus

doi:10.21203/rs.3.rs-4975864/v1

Download PDF

Research Article

KLF2 controls the apoptosis of neutrophils and is associated with disease activity of systemic lupus erythematosus

https://doi.org/10.21203/rs.3.rs-4975864/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Neutropenia is more common in patients with systemic lupus erythematosus (SLE) and is a major cause of life-threatening infections. The increased apoptosis of neutrophils is likely to be an essential cause of neutropenia in SLE. However, the detailed mechanisms of increased neutrophil apoptosis in SLE remain unknown. Recent evidence suggests that Krüppel-like factor 2 (KLF2), a transcription factor associated with susceptibility to SLE, is likely to be a potential therapeutic target for SLE.

Methods

This study focused on the role of KLF2 in the regulation of neutrophil apoptosis and its association with SLE disease activity. First, the expression of KLF2 in neutrophils of SLE was detected by real-time PCR and western blotting. The apoptosis levels and caspase3 mRNA levels in neutrophils from SLE patients and healthy controls were detected and analyzed. The correlation between KLF2 mRNA levels and apoptosis was analyzed. neutrophils from Health controls (HCs) were cultured in RPMI 1640 medium containing the KLF2 inhibitor Geranylgeranyl pyrophosphate (GGPP) or the KLF2 inducer geranylgeranyl transferase inhibitor (GGTI-298), and then the KLF2 levels and the apoptosis levels were detected in neutrophils. Lastly, neutrophils from HCs were cultured in RPMI 1640 medium containing sera from SLE patients, followed by the detection of KLF2 mRNA levels and apoptosis levels of neutrophils. Then, the correlation between KLF2 mRNA levels and SLE disease activity index (SLEDIA) was analyzed.

Results

It was shown that the expression of KLF2 in neutrophils of SLE patients is significantly suppressed, and the decreased KLF2 is associated with the upregulation of neutrophil apoptosis. Moreover, newly diagnosed SLE patients, SLE patients with higher serum IgG and positive anti-Smith antibodies had lower KLF2 expression. Furthermore, we demonstrated that modulating the expression of KLF2 can regulate the apoptosis of neutrophils. The levels of KLF2 in neutrophils were associated with the SLEDIA. In addition, we found that serum from SLE patients could induce apoptosis in neutrophils by down-regulating the expression of KLF2.

Conclusion

In summary, we revealed for the first time that KLF2 can regulate the apoptosis of neutrophils in this study. Moreover, our research showed that the KLF2 levels in neutrophils are closely related to the disease activity of SLE, which suggests that KLF2 in neutrophils may be involved in the occurrence and development of SLE.

Systemic lupus erythematosus

Krüppel-like factor 2

Neutrophil

Apoptosis

SLE disease activity index

Systemic lupus erythematosus (SLE) is a chronic autoimmune disease characterized by a waxing and waning course, a loss of self-tolerance, production of autoantibodies, B-cell hyperreactivity, aberrant formation of immune complexes, and multiorgan impairment [1, 2]. The main features include accumulated cellular debris from various forms of cell death, enhanced type I interferon signaling, and increased autoantibody production [3]. Increased neutrophil death and subsequent ineffective debris clearance in SLE patients contribute to the release of stable autoantigens, amplified inflammatory responses, and promoted tissue damage [4]. Neutropenia and lymphopenia are common features of SLE [5]. However, the detailed molecular mechanisms of increased neutrophil death in SLE have not been fully elucidated.

As the first line of defense against infectious pathogens, mature neutrophils are considered terminally differentiated cells that have a short lifespan and usually die by apoptosis [6]. Neutrophils are the most abundant immune cells and can modulate immune responses by synthesizing many important proinflammatory cytokines and chemokines [7, 8]. Neutrophils from patients with SLE exhibit increased apoptosis, altered phagocytosis, disordered oxidative metabolism, and accelerated cell death [9–11].

KLF2, a zinc-finger transcription factor (KLF) that belongs to the Krüppel-like family, was found to be initially enriched in the lungs and contributed to the maintenance of quiescence in many cell types, including macrophages, monocytes, and T cells [12, 13]. KLF2 was found to decrease the pro-inflammatory activity of nuclear factor kappa B (NF-κB) and negatively regulate inflammation [13, 14]. Induced KLF2 deficiency was reported to lead to T cell apoptosis in spleen and lymph nodes [15]. In addition, KLF2 can regulate neutrophil development and inflammatory activity in atherosclerosis[16]. A recent genome-wide association study identified klf2 as a novel Asian-specific locus for susceptibility to SLE, and lower KLF2 expression may be associated with an increased risk of SLE [17, 18]. However, the correlation between KLF2 expression in neutrophils from SLE patients and disease activity and cell apoptosis has not been addressed. In this study, we aimed to characterize the expression of KLF2 in neutrophils of SLE patients and investigate the correlation between KLF2 levels and the disease activity of SLE.

Patients

A total of 68 patients who fulfilled the 1997 revised American College of Rheumatology (ACR) classification criteria for the SLE [19] were recruited from the First Affiliated Hospital of Nanchang University from 2020.1 to 2024.6. Disease activity was assessed by the SLEDAI [20]. Individuals with other autoimmune or rheumatic diseases, kidney diseases other than lupus nephritis, pregnancy, HIV, or malignancy were excluded from this study. 29 rheumatoid arthritis (RA) patients, and 26 Sjogren's syndrome (SSA) patients were recruited as disease controls and 30 age- and sex-matched healthy subjects who were free of autoimmune diseases were recruited as healthy controls (HCs). The study had approval from the Ethics Committee of the First Affiliated Hospital of Nanchang University (2014003) and complied with the Helsinki Declaration.

Neutrophil preparation and culture

Whole blood was collected from each participant and placed in a vacuum blood collection tube coated with EDTA. According to the manufacturer's instructions, neutrophils were isolated from whole blood by Ficoll density gradient centrifugation. The neutrophil content of the preparation was confirmed to be greater than 95% by flow cytometry. After isolation, neutrophils were cultured in RPMI 1640 medium (Solarbio, Beijing, China), supplemented with 10% fetal bovine serum (FBS; Gibco, Australia), at 37℃ in a humidified atmosphere of 5% CO₂ and 95% air. When indicated, neutrophils were stimulated with 10% fresh human serum from SLE patients or HCs for 4h. To regulate the expression of KLF2, neutrophils were cultured in RPMI 1640 medium with 10 µM of KLF2 inducer GGTI-298 (MedChemExpress, NJ, USA, HY-15871) or KLF2 inhibitor GGPP (Sigma Aldrich, St. Louis, MO, USA, G6025) for 4h.

Apoptosis analysis by flow cytometry

The neutrophil was incubated in a solution containing Annexin V-FITC and P.I.(Bestbio Nanjing, China, BB-4101-50T)according to the reagent manufacturer's instructions. The cells were analyzed by flow cytometry using a Beckman Coulter Cytomics FC 500 Flow Cytometer. The data was analyzed using the Flow Jo software.

Western blot analysis

Cells were washed twice with cold PBS, lysed with lysis buffer (Solarbio, China, BC3710) and centrifuged at 4 ℃ 12000 g for 30 min. The supernatant was pipetted into a new E.P. tube, and the protein concentration was measured using the BCA Protein Concentration Assay Kit (Sosarbio Beijing, China, Solarbio, China, PC0020) according to the reagent manufacturer's instructions. An equal amount of protein (20 µg) for each sample and protein marker were loaded on 12% SDS-PAGE gels, and proteins were separated electrophoretically and then transferred toImmobilon®-P^SQMembrane (PVDF MilliporeMassachusetts, USA, 0000278926). The PVDF membrane was then blocked with 5% non-fat skim milk for 2 h at room temperature. After blocking, the membranes were incubated overnight with the primary antibody to KLF2 (1:1000; Abcam, USA, Ab236507) and GAPDH (1:1000; Proteintech, USA, 00110344) diluted in 5% skim milk (dissolved in Tris-buffered saline with 0.1%Tween 20 detergent, TBST.Sosarbio Beijing China) at 4°C. Wash three times with TBST for 10 minutes each time and re-incubate in species-specific horseradish peroxidase (HRP)-coupled secondary antibody for 1 hour at room temperature. Membranes were rewashed and exposed to SuperKine^TM-enhanced ECL Luminous Liquid (Abbkine, Wuhan, China, ATWL22081). Protein bands were visualized using Image J software and band intensities were normalized to the internal control GAPDH.

RT-PCR

The total RNA of neutrophils was isolated using Trizol (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions. The nucleotide sequences of the primer pairs used to determine human GAPDH, Caspase3, and KLF2 mRNA levels were as follows: GAPDH forward primer 5'- TGCACCACCAACTGCTTAGC − 3' and reverse primer 5'- GGCATGGACTGTGGTCATGAG − 3', Caspase3forward primer 5'- AGAGGGGATCGTTGTAGAAGTC − 3' and reverse primer 5'- ACAGTCCAGTTCTGTACCACG − 3', KLF2 forward primer 5'- CTACACCAAGAGTTCGCATCTG − 3' and reverse primer 5’-CCGTGTGCTTTCGGTAGTG − 3'. The concentration and integrity of the RNA were assessed by a NanoDrop ND-1000 spectrophotometer (Invitrogen Bio, Waltham, MA, United States). Reverse transcription (RT) and quantitative PCR (RT-PCR) were carried out with the PrimeScript™ RT kit (Takara Bio Inc., Kyoto, Japan) and SYBR Premix Ex Taq™ II (Takara Bio Inc., Kyoto, Japan), respectively. RT-PCR was performed on an ABI 7500 Real-Time PCR System (Invitrogen, California, USA) with the following PCR thermocycler protocol: initial denaturation step at 95℃for 5 min, followed by 40 cycles of 95℃ for 15 sec (denaturation), 60℃ for 1 min (annealing and elongation), and 72℃ for 2 min (final extension). GAPDH was used as an internal control. The data were analyzed using the 2^−ΔΔCt method.

Statistical Analysis

Statistical analysis and graphic presentation were carried out with GraphPad Prism 10.0 and SPSS version 20.0. A Student's t-test was used between two groups where the samples passed the normality test; otherwise, the nonparametric Mann-Whitney test was used to analyze the data. Spearman's method was used for correlation analysis. P < 0.05 was considered to indicate statistically significant differences.

Peripheral blood neutrophil counts are reduced and inversely correlate with disease activity in SLE

A total of 68 SLE patients,85 disease counterparts (29 rheumatoid arthritis (RA) patients,26 Sjogren's syndrome (SSA) patients), and 30 healthy controls (HCs) were included in this study. Peripheral neutrophil counts of each subject were determined, and the SLEDAI of SLE patients was assessed. Compared to disease controls and healthy controls, the neutrophil counts of patients with SLE were significantly reduced, with 29.4% of them showing neutropenia, defined as a peripheral neutrophil count less than 2×10⁹/L (Fig. 1a). Further analysis revealed that neutrophils were significantly fewer in newly diagnosed SLE patients than in follow-up patients (Fig. 1b). Interestingly, SLE patients with high serum IgG (> 15.5 g/ml) had fewer neutrophils than those with normal serum IgG (7-15.5 g/ml) (Fig. 1c). Moreover, Neutrophils were significantly fewer in SLE patients with positive anti-Smith antibody (Sm+) than in those with negative anti-Smith antibody (Sm-) (Fig. 1d). Neutrophils were significantly fewer in SLE patients with positive anti-double-stranded DNA antibody (dsDNA+) than in dsDNA- SLE patients. Furthermore, peripheral neutrophil counts were inversely correlated with the disease activity of SLE patients, as indicated by the SLEDA (Fig. 1f).

The neutrophil KLF2 levels in SLE are significantly decreased and correlate with cell apoptosis

The KLF2 expression in neutrophils from SLE patients and healthy controls was detected by RT-PCR and Western Blot. The results showed that both the mRNA and protein levels of KLF2 were markedly decreased compared with HCs (Fig. 2a,b,c). The apoptosis levels and caspase3 mRNA levels in neutrophils from SLE patients and healthy controls were detected and analyzed. It was shown that the apoptosis levels of neutrophils in SLE patients were significantly increased compared to HCs (Fig. 2d). The caspase3 mRNA levels of neutrophils in SLE patients were markedly increased compared with HCs, as expected (Fig. 2e). Considering that KLF2 contributes to the maintenance of quiescence in a wide range of cell types, the relationship between the KLF2 levels and the apoptosis levels in neutrophils was analyzed. It was shown that the KLF2 mRNA levels in neutrophils were positively correlated with the neutrophil counts in SLE patients (r = 0.5395,P = 0.0209; Fig. 2f). The KLF2 mRNA levels in neutrophils were inversely correlated with the proportion of apoptosis cells in SLE patients (r=-0.5375,P = 0.0214; Fig. 2h). Furthermore, the neutrophils counts were inversely correlated with the frequency of apoptosis cells (r=-0.7641,P = 0.0002; Fig. 2j) and the caspase3 mRNA levels (r=-0.5358,P = 0.0219; Fig. 2k).

KLF2 controls the apoptosis of neutrophil

To determine the effect of KLF2 on neutrophil apoptosis, neutrophils isolated from HCs were cultured in RPMI 1640 medium containing the KLF2 inhibitor Geranylgeranyl pyrophosphate (GGPP) or the KLF2 inducer geranylgeranyl transferase inhibitor (GGTI-298), and then the KLF2 levels and the apoptosis levels were detected in neutrophils. The results showed that the mRNA levels of KLF2 were significantly decreased in the presence of GGPP while markedly increased in the presence of GGTI-298 (Fig. 3a). Concurrently, treatment with GGPP resulted in a dramatic increase of neutrophil apoptosis, while GGTI-298 significantly suppressed the apoptosis of neutrophils (Fig. 3b,c,d).

SLE serum regulates KLF2 expression and induces apoptosis in neutrophils

To clarify whether serum from SLE patients affects neutrophil KLF2 expression and apoptosis, neutrophils from HCs were cultured in RPMI 1640 medium containing sera from SLE patients, followed by the detection of KLF2 mRNA levels and apoptosis levels of neutrophils. Interestingly, the levels of KLF2 mRNA in HCs neutrophils were significantly decreased when incubated with SLE serum, compared to autologous serum (Fig. 4a). In addition, the apoptosis levels of neutrophils were significantly increased after the incubation with SLE serum compared to autologous serum as expected (Fig. 4b,c).

KLF2 levels in neutrophils of SLE patients are associated with SLEDIA

The aforementioned results demonstrated that the expression of KLF2 in neutrophils was significantly suppressed in SLE patients, and the levels of KLF2 in neutrophils modulated the apoptosis of neutrophils. Considering the fact that peripheral neutrophil counts were inversely correlated with the disease activity of SLE patients, we therefore want to explore whether the expression of KLF2 in neutrophils plays some roles in the disease activity of SLE patients. It was shown that KLF2 levels in neutrophils were significantly lower in newly diagnosed SLE patients than in follow-up patients (Fig. 5a). KLF2 levels were significantly lower in patients with higher serum IgG than their counterparts (Fig. 5b). KLF2 levels in neutrophils were decreased in SLE patients with positive Sm but not in patients with positive dsDNA (Fig. 5c,d). The KLF2 mRNA levels in neutrophils were inversely correlated with SLEDAI of SLE patients (r=-0.4768, P = 0.0454; Fig. 5e). Further analysis found that the KLF2 mRNA expression in neutrophils was positively correlated with serum complement 3 (C3) (r = 0.3665, P = 0.0464; Fig. 5f).

The study demonstrated that the KLF2 levels in neutrophils of SLE patients were significantly decreased, and the percentage of neutrophil apoptosis was significantly increased in SLE patients. Further analyses revealed that the level of KLF2 mRNA expression was correlated with absolute neutrophil values, the percentage of apoptosis cells, and SLEDIA values. Stimulated by SLE-serum neutrophils showed a reduction of KLF2 expression, which was associated with apoptosis. The effect of KLF2 deficiency or overexpression on neutrophil apoptosis was then elucidated. Current research is focused on determining the molecular involvement of KLF2 in neutrophil apoptosis, which will provide new molecular targets for therapeutic options for granulocyte deficiency in SLE.

It is well known that neutropenia is more common in patients with SLE and leads to morbidity and mortality from increased susceptibility to infection [21].SLE patients' peripheral blood neutrophils showed increased apoptosis in association with disease activity, double-stranded DNA antibodies, and neutropenia [22]. The study demonstrated that absolute neutrophil values were significantly lower in SLE patients, especially first-time patients, compared to controls. Neutrophil reduction was more pronounced in autoimmune antibody dsDNA + or Sm + SLE patients. Neutrophil counts are positively correlated with disease activity SLEDIA values, a clinical index for the assessment of SLE disease activity. Further analyses revealed that the percentage of neutrophil apoptosis was significantly increased in SLE patients and was inversely correlated with absolute neutrophil values consistent with the previous study [22]. Our demonstration that apoptotic neutrophils were increased provides a possible mechanism for the increase in neutropenia in SLE. Considering that KLF2 contributes to the maintenance of quiescence in many cell types, neutrophil KLF2 mRNA expression and its relationship to neutrophil apoptosis were investigated.

KLF2 is an essential regulator of cell quiescence, transport, and differentiation in several cell types and can negatively regulate cellular inflammatory responses [16, 23].

KLF2-deficient (K2KO) mice as a pro-inflammatory genetic model that regulated cardiac hypertrophy through the neutrophil/KLF2/NET axis [24]. Decreased levels of KLF2 in neutrophils may increase their migration in asthmatics by regulating the expression of CXCR1 and CXCR2 [25]. The mechanism of KLF2 in neutrophil physiopathology is not well defined, and the role of KLF2 in the pathogenesis of SLE patients is poorly reported. We discovered that KLF2 mRNA and protein expression levels of neutrophils were significantly decreased in SLE patients. Reduction of KLF2 expression was associated with a decrease in neutrophils, increased apoptosis, and SLEDIA values. The results of the study offered a possibility that down-regulation of KLF2 may contribute to the increased apoptosis of neutrophils in SLE patients.

To further determine the function of KLF2 on neutrophil apoptosis in SLE patients, KLF2 levels and apoptosis levels in neutrophils were examined after stimulating SLE serum. It was shown that the levels of KLF2 in neutrophils were significantly decreased in SLE. However, further studies are needed to characterize the mechanisms by which neutrophil KLF2 low-expression contributes to apoptosis in patients with SLE. KLF2 expression in neural-like cells is downregulated in the presence of GGPP, whereas GGTI-298 promotes increased KLF2 expression [26]. It was shown that the mRNA expression of KLF2 was significantly decreased in the presence of GGPP compared to the control. In contrast, the mRNA expression of KLF2 was markedly increased in the presence of GGTI-298 compared to the control, which was consistent with the previous study [26]. To further investigate the effect of KLF2 on neutrophil apoptosis, we performed KLF2 deficiency, which increases the level of apoptosis in neutrophils. Next, we performed a KLF2 overexpression assay using a KLF2 inducer and confirmed that KLF2 overexpression inhibited neutrophil apoptosis and increased cell activity. Further analysis revealed that neutrophils exhibited down-regulation of KLF2 expression accompanied by increased levels of apoptosis by stimulation of serum from SLE patients. In addition, This finding indicates that KLF2 is an essential transcription factor in modulating apoptosis of peripheral blood neutrophils during the cell biological cycle.

Given that KLF2 regulates neutrophil apoptosis, which is an essential factor in the exacerbation of the disease process in SLE, we further analyzed the correlation between KLF2 expression in neutrophils and SLEDIA. We first reported that the KLF2 mRNA expression in neutrophils was inversely correlated with SLEDAI values and significantly decreased in patients with the newly diagnosed. In addition, KLF2 levels of neutrophils were reduced in SLE patients with increased antibodies to Sm and were positively correlated with C3. These observations suggest that KLF2 downregulation of neutrophils correlated with SLE disease activity, Autoantibody generation, and C3 depletion, suggesting that KLF2 downregulation in neutrophils might potentially serve as a biomarker for lupus activity in clinical practice. To our knowledge, it is not reported that KLF2 expression of neutrophils is linked to the development of SLE.

In conclusion, although most current studies consider the production of autoreactive T and B lymphocytes to be the primary cause of induced autoimmune disease development, our findings suggest that neutrophil KLF2 low-expression and aberrant apoptosis may be implicated in the pathogenesis of SLE, and KLF2 activator (GGTI-298) and inhibitor (GGPP) can affect apoptosis by regulating neutrophil KLF2 expression, which provides a possible therapeutic modality for the treatment of lupus by targeting KLF2 transcripts and neutrophil apoptosis. However, there are a number of limitations to this study. It does not provide insights into specific mechanisms of KLF2 affecting neutrophil apoptosis, and whether KLF2 downregulation in neutrophils is a causative factor for SLE development is unclear. More future studies are needed to explore the pathological role of KLF2 in SLE and neutrophil apoptosis.

Acknowledgments

Not applicable.

Authors' contributions

JML, QL,and HSZ participated in designing the study, performing statistical analyses, and drafting the manuscript. ZCL and PMZ carried out flow cytometry analysis and drafted the manuscript. SMX and JYR performed data acquisition of disease activity and severity, performed statistical analyses, and drafted the manuscript.

Ethics approval and consent to participate.

This study was approved by the Human Ethics Committee of The First Affiliated Hospital of Nanchang University (Ethical Review No. (2024)CDYFYYLK(06-028)). Informed consent was approved to be exempt.

Patient consent for publication

Not applicable.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Funding

The present study was supported by the National Natural Science Foundation of China (grant nos. 82160307, 82160308), the Jiangxi Provincial Natural Science Foundation of China (grant nos. 20224BAB216038).

Availability of data and materials

The dataset supporting the conclusions of this article will be available to the Editors and Reviewers upon request.

Kiriakidou, M. and C.L. Ching, Systemic Lupus Erythematosus. Ann Intern Med, 2020. 172(11): p. Itc81-itc96.
Manson, J.J. and D.A. Isenberg, The pathogenesis of systemic lupus erythematosus. Neth J Med, 2003. 61(11): p. 343-6.
Lisnevskaia, L., G. Murphy, and D. Isenberg, Systemic lupus erythematosus. Lancet, 2014. 384(9957): p. 1878-1888.
Bosch, X., Systemic lupus erythematosus and the neutrophil. The New England journal of medicine, 2011. 365(8): p. 758-60.
Pascual, V., J. Banchereau, and A.K. Palucka, The central role of dendritic cells and interferon-alpha in SLE. Curr OpinRheumatol, 2003. 15(5): p. 548-56.
Gabelloni, M.L., et al., Mechanisms regulating neutrophil survival and cell death. Semin Immunopathol, 2013. 35(4): p. 423-37.
Garcia-Romo, G.S., et al., Netting Neutrophils Are Major Inducers of Type I IFN Production in Pediatric Systemic Lupus Erythematosus. Science Translational Medicine, 2011. 3(73): p. 73ra20.
Scapini, P., et al., The neutrophil as a cellular source of chemokines. Immunological reviews, 2000. 177: p. 195-203.
Garcia-Romo, G., et al., Netting neutrophils are major inducers of type I IFN production in pediatric systemic lupus erythematosus. Science translational medicine, 2011. 3(73): p. 73ra20.
Chauhan, S.K., et al., Differential clearance mechanisms, neutrophil extracellular trap degradation and phagocytosis, are operative in systemic lupus erythematosus patients with distinct autoantibody specificities. Immunology Letters, 2015. 168(2): p. 254-259.
Midgley, A., et al., The role of neutrophil apoptosis in juvenile‐onset systemic lupus erythematosus. Arthritis & Rheumatism, 2009. 60(8): p. 2390-2401.
Laha, D., M. Deb, and H. Das, KLF2 (kruppel-like factor 2 [lung]) regulates osteoclastogenesis by modulating autophagy. Autophagy, 2019. 15(12): p. 2063-2075.
Jha, P. and H. Das, KLF2 in Regulation of NF-κB-Mediated Immune Cell Function and Inflammation. International Journal of Molecular Sciences, 2017. 18(11).
Das, H., et al., Kruppel-like factor 2 (KLF2) regulates pro-inflammatory activation of monocytes. Proceedings of the National Academy of Sciences of the United States of America, 2006. 103(17): p. 6653-8.
C T, K., V. M L, and L. J M, LKLF: A transcriptional regulator of single-positive T cell quiescence and survival. Science, 1997. 277.
Lingrel, J.B., et al., Myeloid-Specific Krüppel-Like Factor 2 Inactivation Increases Macrophage and Neutrophil Adhesion and Promotes Atherosclerosis. Circulation Research, 2012. 110(10): p. 1294-1302.
Qin, S., et al., Genome-wide association study on Northern Chinese identifies KLF2, DOT1L and STAB2 associated with systemic lupus erythematosus. Rheumatology (Oxford), 2021. 60(9).
Singh, M.K., et al., KLF2enhancer variant rs4808485 increases lupus risk by modulating inflammasome machinery and cellular homoeostasis. Annals of the Rheumatic Diseases, 2024. 83(7): p. 879-888.
Izmirly, P.M., et al., Prevalence of Systemic Lupus Erythematosus in the United States: Estimates From a Meta‐Analysis of the Centers for Disease Control and Prevention National Lupus Registries. Arthritis & Rheumatology, 2021. 73(6): p. 991-996.
Zhang, X., et al., Transcriptome sequencing reveals novel molecular features of SLE severity. Frontiers in Genetics, 2023. 14.
Fayyaz, A., et al., Haematological manifestations of lupus. Lupus Science & Medicine, 2015. 2(1).
P A, C., et al., Increased apoptotic peripheral blood neutrophils in systemic lupus erythematosus: relations with disease activity, antibodies to double stranded DNA, and neutropenia. Ann Rheum Dis, 1999. 58(5).
Liu, Y.-S., et al., Atorvastatin counteracts high glucose-induced Krüppel-like factor 2 suppression in human umbilical vein endothelial cells. Postgraduate Medicine, 2015. 127(5): p. 446-454.
Tang, X., et al., KLF2 regulates neutrophil activation and thrombosis in cardiac hypertrophy and heart failure progression. Journal of Clinical Investigation, 2022. 132(3).
Zhu, L.-m., et al., KLF2 regulates neutrophil migration by modulating CXCR1 and CXCR2 in asthma.Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease, 2020. 1866(12).
Prateeksha, P., et al., KLF2 Regulates Neural Differentiation of Dental Pulp-derived Stem Cells by Modulating Autophagy and Mitophagy. Stem cell reviews and reports, 2023. 19(8): p. 2886-2900.

No competing interests reported.

supplementaryfile.zip

Download PDF

Editorial decision: Revision requested
21 Sep, 2024
Reviews received at journal
21 Sep, 2024
Reviews received at journal
20 Sep, 2024
Reviewers agreed at journal
13 Sep, 2024
Reviewers agreed at journal
08 Sep, 2024
Reviewers agreed at journal
08 Sep, 2024
Reviewers invited by journal
07 Sep, 2024
Editor assigned by journal
29 Aug, 2024
Submission checks completed at journal
28 Aug, 2024
First submitted to journal
26 Aug, 2024

You are reading this latest preprint version

KLF2 controls the apoptosis of neutrophils and is associated with disease activity of systemic lupus erythematosus

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Introduction

Materials and methods

Patients

Neutrophil preparation and culture

Apoptosis analysis by flow cytometry

Western blot analysis

RT-PCR

Statistical Analysis

Results

Peripheral blood neutrophil counts are reduced and inversely correlate with disease activity in SLE

The neutrophil KLF2 levels in SLE are significantly decreased and correlate with cell apoptosis

KLF2 controls the apoptosis of neutrophil

SLE serum regulates KLF2 expression and induces apoptosis in neutrophils

KLF2 levels in neutrophils of SLE patients are associated with SLEDIA

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1