Periodontal pathogen Fusobacterium nucleatum promotes ulcerative colitis by ferroptosis-mediated gut barrier disruption

doi:10.21203/rs.3.rs-4976678/v1

Download PDF

Article

Periodontal pathogen Fusobacterium nucleatum promotes ulcerative colitis by ferroptosis-mediated gut barrier disruption

https://doi.org/10.21203/rs.3.rs-4976678/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Periodontitis and ulcerative colitis (UC), both inflammatory diseases caused by microecological dysregulation and host immune-inflammatory responses, are epidemiologically related and may be interlinked through the “gum-gut” axis. However, the specific mechanisms underlying this association are not fully understood. Fusobacterium nucleatum, one of the major pathogens of periodontitis and a causative agent of the gastrointestinal tract, may be responsible for the link between this comorbidity. This study aimed to investigate the role and possible mechanisms of the periodontal pathogen F. nucleatum in the pathogenesis of UC by constructing a model of UC induced by dextrose sodium sulfate and a model of periodontitis induced by F. nucleatum ATCC 25586 periodontal infection. Our findings showed that F. nucleatum induced periodontal inflammation, alveolar bone loss, and disrupted intestinal barrier thus promoting UC progression in mice. 16S rRNA sequence and LC-MS analyses of mouse colonic content indicated that ferroptosis was involved. F. nucleatum induced ferroptosis in the mouse colon and the normal colonic epithelial cell CCD841 (ATCC CRL-1790), as evidenced by elevated levels of Fe²⁺ and malondialdehyde, decreased glutathione, altered key ferroptosis regulators GPX4, FTH1, and ACSL4, reduced mitochondrial membrane potential, and intracellular reactive oxygen species aggregation. Application of ferroptosis inhibitor Ferrostatin-1 in vivo greatly alleviated UC and rescued intestinal barrier dysfunction by decreasing intestinal permeability, protecting the mucus layer, and upregulating tight junctions Zona occludens 1 and Occludin-1 expression. In conclusion, periodontal pathogen F. nucleatum promotes UC by inducing ferroptosis in intestinal epithelial cells thus disrupting the gut barrier. This study provided new insights into the mechanisms linking periodontitis and UC from the perspective of symbiont F. nucleatum and suggested that ferroptosis may be a potential therapeutic target.

Biological sciences/Microbiology/Bacteria

Biological sciences/Microbiology/Pathogens

The link between periodontitis and systemic diseases has emerged as a growing field of study during the last four decades. To date, more than 50 systemic diseases have been found associated with periodontitis, including atherosclerosis¹, diabetes mellitus², arthritis³, colorectal cancer (CRC)⁴, and inflammatory bowel disease (IBD)⁵. Periodontitis is an immune-mediated chronic inflammatory disease that is the leading cause of tooth loss in adults and ranks as the 11th most prevalent disease worldwide^6–8. Ulcerative colitis (UC) is a chronic non-idiosyncratic gastrointestinal tract inflammatory and immune disorder, mainly affecting the rectum and colon, with clinical manifestations such as abdominal pain, intermittent diarrhea, and bloody purulent stool. It is difficult to cure, has a high recurrence rate, and is closely related to the development of CRC ^9,10. Both periodontitis and UC are serious threats to human health and quality of life.

An association between UC and periodontitis was demonstrated by multiple epidemiological investigations ^5,11–13. One systemic review reported that for subtypes of IBD, periodontitis was associated with the occurrence of UC (pooled RR = 1.12, 95% CI: 1.04–1.21; p = .003; I2 = 38%), but not with Crohn's disease (pooled RR = 0.98, 95% CI: 0.92–1.04; p = .475; I2 = 0%)¹³. A retrospective cohort study based on 135,190 individuals found that after adjusting for confounders, the risk of UC in the periodontitis group was 1.5 times higher than that in the healthy control group (aHR: 1.56, 95% CI: 1.13–2.15; p < 0.05), suggesting that periodontitis may be an independent risk factor for UC ¹⁴. In addition, compared with healthy people, UC patients are at higher risk of developing periodontitis ⁵ and often present more severe periodontal inflammation ¹⁵.

Fusobacterium nucleatum, a gram-negative anaerobic bacterium of the genus Fusobacterium, mediates the adhesion and aggregation of early colonizer and late pathogenic colonizing bacteria during subgingival biofilm formation and is regarded as a critical periopathogen¹⁶. Several studies reported that F. nucleatum oral infections alone are enough to cause periodontitis^17–19. In addition to its involvement in the development of periodontitis, F. nucleatum has also been found to be associated with intestinal diseases such as CRC²⁰, IBD²¹, and acute appendicitis (AA)²². F. nucleatum was enriched in the intestines of UC patients. Chen Y et al. ²³ found that F. nucleatum was detected in 51.78% of intestinal tissues of UC patients and correlated with clinical course, clinical activity, and refractoriness of UC. In a dextran sodium sulfate (DSS)-induced mouse model of UC, it has been found that F. nucleatum promoted the development of UC by activating CARD3 through NOD2-targeted caspases and activating the IL-17 and NF-κB pathways²³. Another study found that F. nucleatum could regulate macrophage polarization towards pro-inflammatory M1-type via the AKT2 pathway, thereby promoting disease progression²⁴. Therefore, we postulated that F. nucleatum may be an important pathogenic agent for periodontitis and UC comorbidity.

Although the pathogenesis of UC is unclear, loss of intestinal barrier function is thought to be one of the key mechanisms. The intestinal epithelium is composed of a monolayer covered with mucus and serves as the body’s first line of defense against external stimuli. Inappropriate intestinal epithelial cells (IECs) death could cause intestinal barrier breakdown and pathogen colonization, resulting in gastrointestinal diseases ²⁵. Stress, inflammation, and microbial dysbiosis cause IECs to undergo a variety of cell death pathways, including apoptosis, necrosis, necroptosis, pyroptosis, and ferroptosis ²⁶.

Ferroptosis is a unique type of regulated cell death (RCD) proposed by Dixon in 2012, characterized by iron accumulation and lipid peroxidation²⁷. Iron storage proteins include ferritin light chain and ferritin heavy chain 1 (FTH1), which can be degraded by lysosomes to increase free iron levels. Excessive iron results in lethal reactive oxygen species (ROS) via the Fenton reaction. One of the vital lipid peroxide repair systems, the glutathione/glutathione peroxidase 4 (GSH/GPX4) axis is compromised, triggering ferroptosis²⁸. Acyl-CoA synthetase long-chain family member 4 (ACSL4) is an enzyme involved in fatty acid metabolism, and up-regulation of ACSL4 increases the content of polyunsaturated fatty acids (PUFA) in phospholipids, which are susceptible to oxidative reactions and subsequent ferroptosis²⁹. Furthermore, ROS oxidizes PUFA in lipid membranes, producing high lipid peroxides such as malondialdehyde (MDA) and causing membrane damage with concomitant ferroptosis ^27,30. Recent research has connected ferroptosis to UC. High dietary iron intake increases the risk of developing UC ³¹. Chen Y et al³² found that ferroptosis occurred in DSS-induced UC mice, and Ferrostatin-1 (Fer-1), a ferroptosis inhibitor, alleviated colonic inflammation through the Nrf2/HO-1 signaling pathway. Xu M et al ³³ found significant ferroptosis in IECs of UC patients and colitis mice, which was mediated by endoplasmic reticulum stress signaling, whereas in vivo application of Fer − 1 was able to alleviate colitis.

In this study, we aimed to investigate the role of the periodontal pathogen F. nucleatum in the pathogenesis of UC and to identify possible underlying mechanisms by establishing a mouse model of UC (free-drinking 2.5%DSS solution) and a periodontitis model (F. nucleatum periodontal infection). We observed significant inflammatory destruction of both periodontium and intestine in UC mice by F. nucleatum infection. The capacity of F. nucleatum to invade the gut barrier was demonstrated by fluorescence in situ hybridization (FISH) staining. With the help of 16S rRNA sequencing and LC-MS analysis of colonic content in mice, ferroptosis was found involved and then verified by in vivo and in vitro experiments. Inhibition of ferroptosis in mice significantly alleviated F. nucleatum-induced intestinal barrier dysfunction and UC progression, providing new perspectives on the pathogenesis, prevention, and therapeutic options for this comorbidity.

1. F. nucleatum promoted periodontal and intestinal destruction in mice.

UC model was constructed by free-drinking 2.5%DSS solution and the periodontitis model was constructed by F. nucleatum periodontal infection (Fig. 1A). Compared to gCON and gFN, the survival rates of mice in gUC and gUF declined to 90% and 70%, respectively (Fig. 1B). The weight of mice in gCON showed a continuous increase, fluctuated around the initial weight in gFN, decreased significantly in gUC, and decreased further in gUF (Fig. 1C). The disease activity index (DAI) score elevated significantly in gUC and gUF compared with gCON and gFN, and was the highest in gUF (Fig. 1D). In addition, colon length decreased progressively and statistically in four groups (Fig. 1E, 1F). The colon was then stained using hematoxylin and eosin (H&E) to assess its histopathological characteristics (Fig. 1G). In gCON, the colonic epithelium and crypts were intact and continuous. In gFN, the inflammatory cell infiltration was fragmented. In gUC, the crypt structure was disrupted and there was significant infiltration of inflammatory cells in the submucosal layer, with some epithelial damage. In gUF, a large number of crypts were missing, and inflammatory cell infiltration and epithelial disruption were more pronounced. Meanwhile, H&E scores showed an increasing trend between the four groups (p < 0.05).

Mice exhibited periodontitis symptoms after F. nucleatum periodontal infection. H&E staining showed scattered inflammatory cell infiltration in gUC compared to gCON, disruption of gingival epithelial integrity, disorganization of periodontal ligament arrangement, inflammatory cell infiltration, and alveolar bone resorption in gFN. In contrast, periodontal inflammation was most significant in gUF (Fig. 1H). Micro CT showed alveolar bone resorption in gFN, as evidenced by an increase in the cemento-enamel junction-alveolar bone crest (CEJ-ABC) distance and trabecular separation (Td.Sp.) and a decrease in bone tissue volume (BV/TV) and bone surface area-tissue volume ratio (BS/TV) in the mandibular first molar (p < 0.01). Mice in gUF exhibited the highest alveolar bone resorption (p_CON−UF<0.001). Slight alveolar bone resorption was also observed in gUC, but it was not statistically significant (p_CON−UC>0.05) (Fig. 1I, 1J).

These data suggest that F. nucleatum is capable of destroying both periodontal and intestinal tissues, and may be a potential bridge symbiont for the association between periodontitis and UC.

2. F. nucleatum promoted intestinal barrier disruption in UC mice.

To confirm the invasive ability of F. nucleatum in the intestinal tract, we performed FISH experiment (Fig. 2A). The results showed that F. nucleatum from periodontal infections accumulated in the intestinal lumen and adhere to the IECs. In gFN, the number of invaded F. nucleatum in the lamina propria was limited (p_CON−FN>0.05). In contrast, a large amount of F. nucleatum could be seen invading the deeper layers in gUF (p_CON−UF<0.001). This suggests that the intestinal barrier is effective in isolating pathogenic F. nucleatum invasion in physiological states. Furthermore, F. nucleatum abundance was significantly higher in gUC intestinal tissue (p_CON−UC<0.001). We also confirmed that elevated F. nucleatum levels in the colon of the gUF were oral in origin (Fig. S1 and Table. S3).

Next, we tested the intestinal barrier function. ‌Alcian blue/periodic acid-Schiff, (AB-PAS) staining results showed that F. nucleatum aggravated intestinal mucus layer destruction in UC (p_UC−UF < 0.05) (Fig. 2B). Transmission electron microscopy (TEM) revealed that the tight junctions (TJs) between the IECs were intact, and the intestinal villi were neatly arranged and moderately dense in gCON. Although the TJs appeared intact, there were fewer intestinal villi in gFN. In gUC, typical disruption of TJs and loss of villi were observed. While in gUF, the intestinal villi were largely absent, TJs were disrupted, the intercellular gap widened, and the organelles were detached (Fig. 2C). Serum FD4 concentration, representing intestinal permeability, increased substantially following F. nucleatum challenges (p_UC−UF < 0.0001) (Fig. 2D). We then detected the expression of the TJs proteins Zona occludens 1 (ZO-1) and Claudin 1 (CLDN-1) using immunohistochemical staining (IHC) and western blot (WB). In comparison to gCON, ZO-1 and CLDN-1 protein expressions were lower in gUC and gUF (Fig. 2E, 2F), as well as mRNA (p < 0.05) (Fig. 2G).

These results showed that F. nucleatum could aggravate the intestinal barrier disruption in UC mice.

3. F. nucleatum promoted UC development associated with ferroptosis.

The colonic content of the mice was analyzed using 16S rRNA sequencing and LC-MS technique. The rarefaction curves flattened, and the sequencing data reached saturation, enabling coverage of most of the species. Gut microbial diversity was significantly reduced in gUF (Fig. S2). Beta diversity showed a clear trend of dispersion between gCON and gUF (Fig. 3A), as did the community abundance composition (Fig. 3B). Analysis of the species with significant differences based on LEfSe revealed that Fusobacteriaceae was one of the dominant bacteria in the gFN, gUC, and gUF (Fig. 3C). The sample-species relationships are shown in Fig. S3. The PICRRUSt2 functional prediction heat map showed that “cell growth and death” from level 1 “cellular process” was implicated in the differential pathway between four groups, with “necroptosis, ferroptosis, and apoptosis” as the specific mechanism (Fig. 3D).

Based on the metabolomic analysis, the PCA score plot revealed differences between gCON and gUC (Fig. 3E). The Venn diagram showed the different metabolite compositions between groups (Fig. 3F). Diagram after comparing and statistically mapping intestinal metabolites with categorization information from the HMDB 4.0 database was shown in Fig. 3G. The KEGG functional pathway identified “ferroptosis” and "apoptosis” as the main pathways involved in “cell growth and death” (Fig. 2H). KEGG pathway enrichment and iPath metabolic pathway analyses are shown in Fig. S4 and S5.

The combined 16S rRNA sequencing and LC-MS results suggested that the aggravation of UC by F. nucleatum infection may be associated with ferroptosis.

4. F. nucleatum induced ferroptosis in the colon of UC mice.

To confirm this hypothesis, we examined the expression of the ferroptosis regulators GPX4, FTH1, and ACSL4. IHC and WB of mouse colon showed decreased GPX4 protein levels but increased FTH1 and ACSL4 protein levels (Figs. 4A, 4B). RT-qPCR identified changes in the mRNA levels of GPX4, FTH1, and ACSL4, which were consistent with the protein results (Fig. 4C). Moreover, MDA and iron contents, particularly ferroptosis-related Fe²⁺, were upregulated in the colon, whereas the reduction ratio of GSH was downregulated (Fig. 4D-F). These results suggested that F. nucleatum infection increased susceptibility to ferroptosis and exacerbated colonic ferroptosis in UC mice.

Immunofluorescence staining revealed significantly altered positive signaling cells, primarily in the epithelium. We therefore performed double immunofluorescence staining for the epithelial cell marker CK18 and ferroptosis marker GPX4. The results revealed that the overlapping signals of CK18 and GPX4 were significantly reduced in gUC and gUF compared with gCON and gFN (Fig. 4G). Based on the above data, we hypothesized that F. nucleatum adheres to and induces ferroptosis in IECs, thereby disrupting the gut barrier.

5. F. nucleatum induced ferroptosis in the colonic epithelial cells.

To further clarify the effect of F. nucleatum on the IECs, we investigated ferroptosis in the normal colonic epithelial cell CCD841 (ATCC CRL-1790). DSS solutions and F. nucleatum suspensions were selected at appropriate concentrations and co-cultured with the cells for 24 h (Fig. S6). Cell viability and LDH release were then assessed. F. nucleatum significantly inhibited cell proliferation and caused cell damage (Figs. 5A, 5B). Furthermore, F. nucleatum promoted cell ferroptosis, as evidenced by increased MDA levels, decreased GSH ratios, and intercellular Fe²⁺ aggregation (Figs. 5C, 5D, and 5G). RT-qPCR and WB results showed decreased GPX4 and increased FTH1 and ACSL4 mRNA and protein levels, consistent with in vivo experiments. (Figs. 5E, 5F). The IHC staining results further confirmed the trend changes in GPX4, FTH1, and ACSL4 (Fig. 5H).

Next, we introduced the ferroptosis inhibitors Fer-1 and deferoxamine (DFO), determined their optimal concentrations (data not shown), and found that Fer-1 outperformed DFO in rescuing CCD-841 cell activity (Fig. S7). Fer-1 significantly inhibited F. nucleatum-induced intercellular ROS aggregation and mitochondrial membrane potential (MMP) decrease, which are characteristic of ferroptosis (Fig. 5I, 5J).

These studies suggested that F.nucleatum increased cell ferroptosis in IECs and that Fer-1 could partially rescue this process.

6. Ferroptosis inhibitor rescued F.nucleatum-induced intestinal barrier disruption in UC mice.

To validate the effect of inhibiting ferroptosis on the progression of UC with F.nucleatum infection, we added Fer-1 treatment to the original grouping, and the mice were modeled as shown in Fig. 6A. The safety of Fer-1 intraperitoneal injection has been tested (Fig. S8). Compared to gUC and gUF, the survival rates of mice in gUC + Fer-1 and gUF + Fer-1 increased from 85.7–100% and from 62.5–85.7%, respectively (Fig. 6B). From day 25 of modeling, the weight of mice in gUC + Fer-1 and gUF + Fer-1 were significantly higher than those in gUC and gUF (p < 0.05) (Fig. 6C). The DAI score was significantly decreased in gUF + Fer-1 compared to gUF and even lower than that of gUC + Fer-1 after 31 days of modeling (p < 0.001) (Fig. 6D). Colon length was significantly increased in gUC + Fer-1 and gUF + Fer-1 compared to gUC and gUF (p < 0.01). In addition, there was no statistically significant difference between gUC + Fer-1 and gUF + Fer-1 (Fig. 6E, 6F). These results suggested that inhibition of ferroptosis is effective in suppressing disease progression in UC with F.nucleatum infection.

Next, we measured the intestinal barrier following the inhibition of ferroptosis. Serum FD4 concentration was significantly lower in gUF + Fer-1 compared with gUF (p < 0.0001) but was not statistically different in gUC and gUC + Fer-1 (Fig. 6G). The histopathological changes were evaluated using H&E staining and AB-PAS staining, as shown in Fig. 6H, and 6I. Compared to gUC and gUF, lighter epithelial damage, fewer inflammatory cell infiltration, and less crypt disruption as well as increased mucus production were observed in gUC + Fer-1 and gUF + Fer-1. WB and IHC staining showed that ZO-1 and CLDN-1 protein expressions were significantly upregulated in gUC + Fer-1 and gUF + Fer-1 compared with gUC and gUF (p < 0.05) (Fig. 6J, 6K). These results proved that the application of ferroptosis inhibitors can significantly rescue intestinal barrier disruption aggravated by F.nucleatum.

F. nucleatum is a resident bacterium in the oropharynx and gastrointestinal tract of humans. It has a wide range of virulence factors, including lipopolysaccharide, FadA, Fap2, FadD, FomA, FplA, and Fad-I that allow it to survive and thrive in an inflammatory environment ^34,35. Dzink J et al. ³⁶divided F. nucleatum into three subspecies: (1) Fusobacterium nucleatum subsp. nucleatum, ATCC25586; (2) Fusobacterium nucleatum subsp. polymorphum, ATCC10953; and (3) Fusobacterium nucleatum subsp. vincentii, ATCC49256. Of all the subtypes, F. nucleatum ATCC25586 was isolated mainly from periodontitis sites and was most frequently detected in subgingival plaque biofilms³⁷. In addition, F. nucleatum ATCC25586 is one of the standard strains of common gastrointestinal bacteria and is highly associated with intestinal inflammation and CRC^38,39. Therefore, in this experiment, F. nucleatum ATCC 25586 was selected as a representative subspecies of periodontal pathogenic bacteria infecting mice to investigate its role in UC progression.

The human gastrointestinal tract and oral cavity are the first and second largest bacterial repositories, with more than 500 and 770 species, respectively⁴⁰. These bacteria coexist with the host immune system in a dynamic equilibrium, maintaining niche homeostasis. Recent research has linked gastrointestinal inflammation to periodontal bacteria, including Fusobacterium nucleatum, Fusobacterium varium, Porphyromonas gingivalis, Atopobium parvulum, Campylobacter concisus, Staphylococcus aureus, Klebsiella spp., and Enterobacter spp. ^41,42. With the booming development of high-throughput sequencing technology and the continuous improvement of microbial and metabolite databases, the roles of intestinal flora and their metabolites in intestinal diseases have been continuously revealed. By 16S rRNA sequencing technology, the similarity between subgingival biofilm composition and intestinal flora changes in UC patients was found, and abnormal enrichment of periodontal pathogens could be detected in the intestine^41,43,44. The gut flora of UC patients is more similar to the oral flora compared to healthy individuals, and the microbiota may modulate the effects of periodontitis on UC^45,46. Thus, periodontal and intestinal symbiont-host interactions may be a potential common etiology of immunoinflammatory diseases in both sites.

Periodontal-derived bacteria can migrate to the gastrointestinal tract via the saliva or hematopoietic routes ⁴⁴. Kitamoto S et al. ^47,48 suggested that at least two conditions must be met for ectopic colonization of the gut by oral pathogens. First, the colonization resistance of the resident microbiota in the gut is disrupted, and second, inflammation in the oral cavity causes the number of oral pathogens to reach a certain threshold in the gut. Our previous study showed that oral gavage of F. nucleatum caused intestinal inflammation and microbiota dysbiosis in UC mice, which were highly associated with a decrease in probiotics such as Bifidobacterium and Faecalibacterium, as well as an increase in opportunistic pathogen Escherichia-Shigella¹⁸. In this study, FISH staining results showed that F. nucleatum ATCC 25586 of periodontal origin could migrate to the intestinal tract and colonize a limited number in the colon, but was able to ectopic colonize a large number in UC mice, leading to barrier disruption and thus promoting the development of UC. These data suggested that under physiological conditions a healthy intestinal epithelial barrier insulates F. nucleatum, whereas a damaged intestinal barrier in the pathological state of UC provides favorable conditions for its invasion.

Through 16S rRNA sequencing and LC-MS analysis of mouse colonic content, we found that ferroptosis may play a role in this process and further confirmed that F. nucleatum exacerbated gut ferroptosis in UC. Notably, altered ferroptosis indices were also observed with F. nucleatum infection alone, suggesting that F. nucleatum can increase the susceptibility of IECs to ferroptosis. Subsequently, in in vitro experiments, we demonstrated that F. nucleatum induced ferroptosis in colonic epithelial cells CCD-841 (ATCC CRL-1790). The ferroptosis inhibitor Fer-1 not only significantly reduced cell damage and ferroptosis in in vitro experiments, but also showed efficacy and safety in in vivo experiments, rescuing F. nucleatum-induced barrier dysfunction in UC mice with F. nucleatum infection.

In addition, mild alveolar bone resorption and inflammation were observed in UC mice, whether this phenomenon is due to the deleterious effects of colitis on the periodontium or due to the effects of DSS remains to be investigated. Moreover, the inability of DSS to fully mimic the pathological changes of UC, as well as the age and sex differences of the experimental mice, require more in-depth studies.

In conclusion, our findings support the substantial link between periodontitis and UC from the perspective of symbiont F. nucleatum. Periodontal pathogen F. nucleatum exacerbated UC by promoting IECs ferroptosis-mediated intestinal barrier dysfunction. This study shed light on host-symbiont interactions and revealed that inhibition of ferroptosis may be a promising therapeutic approach to comorbidity. By achieving this, we look forward to the realization of more prominent personalized treatments for this comorbidity.

Bacterial culture

State Key Laboratory of Oral Diseases & National Center for Stomatology provided F. nucleatum (ATCC 25586). F. nucleatum was inoculated in blood agar plates anaerobically at 37℃ for 2 days, and a single colony was transferred to brain heart infusion broth with Vitamin K (0.2 µg mL^− 1) and heme chloride (5 µg mL^− 1). Regularly check for bacterial contamination under an oil microscope.

Animals and study design

Animal welfare and experimental protocols followed the ARRIVE guidelines (Animal Research: Reporting of In Vivo Experiments). Specific-pathogen-free (SPF) C57BL/6J mice (male, 6–8 weeks, 20-22g) were housed in the SPF facility (environmental temperature remained around 23℃ and humidity around 55%). After 7–14 days of acclimation, mice were randomly divided into 4 groups (n = 10, each group): healthy control (CON), F. nucleatum infection (FN), chronic UC (UC), and UC with F. nucleatum infection (UF). The chronic UC model was established by freely drinking 2.5% DSS (molecular weight 36–50 kDa, MP Biomedicals, Inc., USA) solution for 6 days, followed by distilled water for 6 days, and the model was repeated for 3 cycles, 36 days in total. F. nucleatum was centrifuged at 4000 rpm for 10 minutes at 4℃, diluted with PBS to a concentration of 1×10⁹ CFU mL^− 1. A suspension of F. nucleatum was injected into the periodontal pocket of the maxillary first molar and swallowed (10 ml kg-1) every 3 days. Later, mice were randomly divided into 8 groups: CON (n = 5), CON + Fer-1 (n = 5), FN (n = 5), FN + Fer-1 (n = 5), UC (n = 8), UC + Fer-1 (n = 8), UF (n = 8), UF + Fer-1 (n = 8). On the basis of the previous four-group modeling approach, intraperitoneal injections of ferrostatin-1 (2.5 µmol/kg) every three days. The survival rate, weight, and DAI score ⁴⁹ of mice were monitored (Appendix Table 1). Collection of blood, colon, colon contents, and maxilla after euthanasia in mice.

Ethics Statement: This study was approved by the Ethics Committee of West China School of Stomatology, Sichuan University (Approval ID WCHSIRB-D- 2021-007).

Cell culture and models

Human normal colon epithelial cells CCD841 (ATCC CRL-1790) were purchased from ATCC (Manassas, VA, USA). CCD841 cells were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum (Gibco, NY, USA) and 1% P/S in a humidified atmosphere containing 5% CO2 at 37°C. Cells were seeded into 6-well plates at a density of 2 × 10⁵ cells/well. Subsequently, cells were treated with DSS at various concentrations or co-cultured with F. nucleatum resuspended in cell medium (Multiplicity of infection:100:1) for 24 h to establish the injury model.

Cell viability assay and cell injury detection.

Cell viability was assessed by Cell Counting Kit-8 (CCK-8) Assay (B5058, APExBIO, USA). Cell injury was measured by releasing lactate dehydrogenase (LDH) with the LDH Cytotoxicity Assay Kit (C0016, Beyotime, China).

Iron, MDA and GSH determination

The iron concentration of mice colon tissue was assessed with an Iron Assay Kit (ab83366, Abcam, UK). The determination of MDA and GSH were determined by Lipid Peroxidation MDA Assay Kit (S0131M, Beyotime, China) and GSH and GSSG Assay Kit (S0053, Beyotime, China), respectively.

Western blot analysis

The total proteins of colon tissue and cells were obtained by Total Protein Extraction Kit (PE001, Signalway Antibody/SAB, USA), and the protein concentrations were assessed by BCA Protein Assay Kit (P0010, Beyotime, China). The lysates were separated by SDS-PAGE and transferred to polyvinylidene difluoride membranes (IPVH 00010, Millipore, USA). Primary antibodies of GPX4, FTH1, ACSL4, ZO-1, and CLDN-1 were diluted 1:1000 and the second antibodies were diluted 1:10000 (HUABIO, China). Membranes were developed using SuperKine West Femto Maximum Sensitivity Substrate (BMU102-CN, Abbkine Scientific, China). The protein signals were detected by the ChemiDocTMXRS + system (Bio-Rad, USA). β-actin and ɑ-tubulin were used as the internal control.

Quantitative real-time polymerase chain reaction (qRT-PCR)

The total RNA of the mice colon was extracted by an RNA extraction kit (RP55012, Bioteke, Beijing). Qualified RNA solution was transcribed to cDNA using Prime Script® RT reagent Kit With gDNA Eraser Kit (RR047A, Takara, Japan), and qRT-PCR was performed by automatic thermocycler (QuantStudio™ 6 Flex PCR, Life Technologies, MD, USA), with TB Green® Premix Ex Taq™ Kit (RR420A, Takara, Japan). The primers used in the process were listed (Appendix Table 2).

Histopathological assessment, AB-PAS, IHC, and IF staining

Colons were fixed in 10% formalin for 24h and then made into paraffin sections and then stained with H&E and AB-PAS. The histopathological assessment was evaluated from two aspects: Crypt score: 0 = crypt integrity, 1 = disappearance of the bottom 1/3 crypt, 2 = disappearance of the bottom 2/3 crypt, 3 = disappearance of all crypts with intact surface epithelium, 4 = disappearance of all crypts and surface epithelium.

These changes are quantified as percentage of affected area :1 = 1–25%, 2 = 26–50%, 3 = 51–75%, 4 = 100%. The product of the two is the crypt score. Inflammation score: 0 = no significant inflammation, 1 = inflammation confined to the mucosa, 2 = inflammation infiltrating into the submucosa layer, 3 = transmural inflammatory infiltration. These changes are quantified as a percentage of the area affected :1 = 1–25%, 2 = 26–50%, 3 = 51–75%, 4 = 76–100%. The product of the two is the inflammation score. The intestinal histopathological score was the sum of the crypt score and inflammation score.

Colon paraffin sections and cells underwent dewaxing, rehydration, and antigen retrieval and were then incubated with 3% hydrogen peroxide (H₂O₂) to inactivate endogenous peroxidase activity. blocked with 3% bovine serum albumin (BSA) for 1h at RT, and incubated with primary antibodies and secondary antibodies, DAB (BL732A, Biosharp, China) was used as the final chromogen. For IF, cells were fixed in 2% paraformaldehyde for 10 min at room temperature, washed with PBS, permeabilized for 10 min with 0.5% Triton X-100, and blocked for 1 h. Alexa Fluor-conjugated secondary antibodies were incubated for 1 h at room temperature and the cell nucleus was counterstained with DAPI. For the detection of ROS, the C11 BODIPY 581/591 fluorescent probe (GC40165, GlpBio, USA) was used. For the detection of Fe²⁺, FeRhoNox-1 fluorescent probe (MX4558, MaoKangbio, China) Images were acquired with a fluorescence microscope (DMi8, LEICA, German) for confocal imaging.

Transmission electron microscopy (TEM)

Colon tissue and cells were prefixed with a 3% glutaraldehyde, then post-fixed in 1% osmium tetroxide, dehydrated in series acetone, infiltrated in Epox 812 for a longer, and embedded. The semithin sections were stained with methylene blue and the Ultrathin sections were cut with a diamond knife, and stained with uranyl acetate and lead citrate. Sections were examined with a JEM-1400-FLASH Transmission Electron Microscope.

In situ hybridization (FISH double labeling) assay

Tissue sections were dewaxed, digested with proteinase K, pre-hybridized with probes, hybridized with probes, washed, DAPI re-stained nuclei, sealed, and photographed by microscopy. Probe Information: Probe name: FUS664 (Green), Probe sequence: CUUGUAGUUUCCGCUACCUC, Probe marker: 5'6-FAM, RNA, 3'6-FAM. Probe name: EUB338 (red), Probe sequence: GCUGCCUCCCGUAGGAGU, Probe marker: 5'CY3, RNA, 3'CY3.

Determination of permeability

One day after the last gavage, the mice were fasted on solids and liquids for 4 h and then were gavaged with FD4 (Sigma-Aldrich, USA) (60 mg/100 g body weight). 4 hours later, they were euthanized and blood was collected by cardiac puncture. The serum was obtained by centrifugation. The concentration of FD4 was detected using a fluorescence microplate reader (Thermo, USA) at 485nm, excitation, and 525nm, emission⁵⁰.

16S ribosomal RNA (16S rRNA) gene sequencing

Total microbial DNA was extracted according to the instructions of the E.Z.N.A.® soil DNA kit (Omega Bio-tek, Norcross, GA, USA), and the quality of the DNA extracted was checked by agarose gel electrophoresis with 1% agarose, and DNA concentration and purity were determined by NanoDrop2000.The DNA concentration and purity were determined by NanoDrop2000. PCR products from the same samples were mixed and recovered on a 2% agarose gel, purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, CA, USA), detected by electrophoresis on a 2% agarose gel, and quantified by quantitative assay using the Quantus™ Fluorometer (Promega, USA). Fluorometer (Promega, USA) for quantification of the recovered products. Library construction was performed using the NEXTflexTM Rapid DNA-Seq Kit (Bioo Scientific, USA). Sequencing using Illumina's Miseq PE300/NovaSeq PE250 platforms (Appendix Table 3–5).

Liquid chromatograph-mass spectrometer (LC-MS) analysis

The extraction of 50 mg intestinal content was settled at -20^oC and treated by High throughput tissue crusher Wonbio-96c (Wanbo Biotechnology Co., LTD, China) at 50 Hz for 6 min, then followed by vortex for 30 s and ultrasound at 40 kHz for 30 min at 5^oC. The samples were placed at -20^oC for 30 min to precipitate proteins. After centrifugation at 13000g at 4^oC for 15 min, the supernatant was transferred to sample vials for LC-MS/MS analysis. Chromatographic separation of the metabolites was performed on a Thermo UHPLC system equipped with an ACQUITY BEH C18 column (100 mm × 2.1 mm i.d., 1.7 µm; Waters, Milford, USA). After UPLC-TOF/MS analyses, the raw data were imported into the Progenesis QI 2.3 (Nonlinear Dynamics, Waters, USA) for peak detection and alignment (Appendix Table 6).

Statistical analysis

Statistical data were analyzed by SPSS version 21.0 (IBM, Chicago, IL). Data were represented as mean ± SEM. Experimental data and graphs were prepared by GraphPad Prism 9.0 software (La Jolla, CA, USA). Differences among groups were analyzed using one-way or 2way ANOVA with Tukey’s multiple comparisons test, followed by a post-hoc test if data were normally distributed. Otherwise, Kruskal-Wallis and Mann-Whitney U tests were used to evaluate differences. The significance of the Kaplan-Meier survival analysis was calculated by the Log-rank test. The rank sum test was used for data with unequal variances. Pp < 0.05 was considered statistically significant.

Acknowledgments:

We thank Dr.Yafei Wu for her valuable advice during the conception and design process. And we thank Majorbio^® for providing the 16S rRNA gene sequencing and LC-MS platform.

Author contributions:

L.Z. and L.C. contributed to the conception and design and critically revised the manuscript; X.Z. contributed to the conception and design, acquisition, analysis, and interpretation, drafted the manuscript, and critically revised the manuscript; S.S. and Q.W. contributed to the acquisition, analysis, and interpretation; J.Z. and H.W. contributed to the conception and design and critically revised the manuscript. All authors gave final approval and agreed to be accountable for all aspects of the work.

Declaration of conflicting interests:

The authors declare no competing financial interests.

Funding:

This work was supported by the National Natural Science Foundation of China (grant # 81970944), the National Natural Science Foundation of China Youth Program (grant # 82301089), Develop Program, the Natural Science Foundation of Sichuan Province (grant # 2023NSFSC0553), West China Hospital of Stomatology Sichuan University (grant # RCDWJS2024-(2)), and Research and Develop Program, West China Hospital of Stomatology Sichuan University (RD-03-202105).

Data availability:

All data generated or analyzed during this study are included in this article (and its supplementary materials).

Febbraio, M., Roy, C. B. & Levin, L. Is There a Causal Link Between Periodontitis and Cardiovascular Disease? A Concise Review of Recent Findings. International Dental Journal vol. 72 37–51 Preprint at https://doi.org/10.1016/j.identj.2021.07.006 (2022).
AlSharief, M. & Alabdurubalnabi, E. Periodontal Pathogens and Adverse Pregnancy Outcomes: A Narrative Review. Life 13, 1559 (2023).
Wang, H. et al. Clonal hematopoiesis driven by mutated DNMT3A promotes inflammatory bone loss. Cell 187, 3690-3711.e19 (2024).
Di Spirito, F. et al. The association between periodontitis and human colorectal cancer: Genetic and pathogenic linkage. Life 10, 1–18 (2020).
Zhang, Y. et al. The Association between Periodontitis and Inflammatory Bowel Disease: A Systematic Review and Meta-analysis. BioMed Research International vol. 2021 Preprint at https://doi.org/10.1155/2021/6692420 (2021).
Janakiram, C. & Dye, B. A. A public health approach for prevention of periodontal disease. Periodontol 2000 84, 202–214 (2020).
Kwon, T., Lamster, I. B. & Levin, L. Current Concepts in the Management of Periodontitis. Int Dent J 71, 462–476 (2021).
Wu, L., Zhang, S., Zhao, L., Ren, Z. & Hu, C. Global, regional, and national burden of periodontitis from 1990 to 2019: Results from the Global Burden of Disease study 2019. J Periodontol 93, 1445–1454 (2022).
Kobayashi, T. et al. Ulcerative colitis. Nat Rev Dis Primers 6, 74 (2020).
Kucharzik, T., Koletzko, S., Kannengießer, K. & Dignaß, A. Ulcerative Colitis—Diagnostic and Therapeutic Algorithms. Dtsch Arztebl Int (2020) doi:10.3238/arztebl.2020.0564.
Lorenzo-Pouso, A. I., Castelo-Baz, P., Rodriguez-Zorrilla, S., Pérez-Sayáns, M. & Vega, P. Association between periodontal disease and inflammatory bowel disease: a systematic review and meta-analysis. Acta Odontol Scand 79, 344–353 (2021).
de Mello-Neto, J. M., Nunes, J. G. R., Tadakamadla, S. K. & Figueredo, C. M. da S. Immunological traits of patients with coexistent inflammatory bowel disease and periodontal disease: A systematic review. International Journal of Environmental Research and Public Health vol. 18 Preprint at https://doi.org/10.3390/ijerph18178958 (2021).
Wang, Q., Chen, S., Zhou, J. & Zhao, L. Bidirectional associations between periodontitis and inflammatory bowel disease: A systematic review of longitudinal studies with meta‐analysis and trial sequential analysis. J Periodontal Res (2024) doi:10.1111/jre.13291.
Lin, C. Y. et al. Increased risk of ulcerative colitis in patients with periodontal disease: A nationwide population-based cohort study. Int J Environ Res Public Health 15, (2018).
Habashneh, R. A., Khader, Y. S., Alhumouz, M. K., Jadallah, K. & Ajlouni, Y. The association between inflammatory bowel disease and periodontitis among Jordanians: a case–control study. J Periodontal Res 47, 293–298 (2012).
LKent Jr, R. RL: Microbial Complexes in Subgingival Plaque. J Clin Periodontol vol. 25 (1998).
Song, B. et al. Akkermansia muciniphila inhibited the periodontitis caused by Fusobacterium nucleatum. NPJ Biofilms Microbiomes 9, 49 (2023).
Lin, S. et al. Fusobacterium nucleatum aggravates ulcerative colitis through promoting gut microbiota dysbiosis and dysmetabolism. J Periodontol 94, 405–418 (2023).
Chaushu, S. et al. Direct Recognition of Fusobacterium nucleatum by the NK Cell Natural Cytotoxicity Receptor NKp46 Aggravates Periodontal Disease. PLoS Pathog 8, e1002601 (2012).
Ma, C., Luo, H., Gao, F., Tang, Q. & Chen, W. Fusobacterium�nucleatum promotes the progression of colorectal cancer by interacting with E‑cadherin. Oncol Lett (2018) doi:10.3892/ol.2018.8947.
Strauss, J. et al. Invasive potential of gut mucosa-derived fusobacterium nucleatum positively correlates with IBD status of the host. Inflamm Bowel Dis 17, 1971–1978 (2011).
Swidsinski, A. et al. Acute appendicitis is characterised by local invasion with Fusobacterium nucleatum/necrophorum. Gut 60, 34–40 (2011).
Chen, Y. et al. Fusobacterium nucleatum facilitates ulcerative colitis through activating IL-17F signaling to NF-κB via the upregulation of CARD3 expression. Journal of Pathology 250, 170–182 (2020).
Liu, L. et al. Fusobacterium nucleatum aggravates the progression of colitis by regulating M1 macrophage polarization via AKT2 pathway. Front Immunol 10, (2019).
Turner, J. R. Intestinal mucosal barrier function in health and disease. Nature Reviews Immunology vol. 9 799–809 Preprint at https://doi.org/10.1038/nri2653 (2009).
Subramanian, S., Geng, H. & Tan, X.-D. Cell death of intestinal epithelial cells in intestinal diseases. Acta Physiologica Sinica 72, 308–324 (2020).
Dixon, S. J. et al. Ferroptosis: An iron-dependent form of nonapoptotic cell death. Cell 149, 1060–1072 (2012).
Ursini, F. & Maiorino, M. Lipid peroxidation and ferroptosis: The role of GSH and GPx4. Free Radical Biology and Medicine vol. 152 175–185 Preprint at https://doi.org/10.1016/j.freeradbiomed.2020.02.027 (2020).
Doll, S. et al. ACSL4 dictates ferroptosis sensitivity by shaping cellular lipid composition. Nat Chem Biol 13, 91–98 (2017).
Xie, Y. et al. Ferroptosis: Process and function. Cell Death and Differentiation vol. 23 369–379 Preprint at https://doi.org/10.1038/cdd.2015.158 (2016).
Kobayashi, Y. et al. Association between dietary iron and zinc intake and development of ulcerative colitis: A case–control study in Japan. Journal of Gastroenterology and Hepatology (Australia) 34, 1703–1710 (2019).
Chen, Y., Zhang, P., Chen, W. & Chen, G. Ferroptosis mediated DSS-induced ulcerative colitis associated with Nrf2/HO-1 signaling pathway. Immunol Lett 225, 9–15 (2020).
Xu, M. et al. Ferroptosis involves in intestinal epithelial cell death in ulcerative colitis. Cell Death Dis 11, (2020).
Brennan, C. A. & Garrett, W. S. Fusobacterium nucleatum — symbiont, opportunist and oncobacterium. Nature Reviews Microbiology vol. 17 156–166 Preprint at https://doi.org/10.1038/s41579-018-0129-6 (2019).
Baima, G. et al. Shared microbiological and immunological patterns in periodontitis and IBD: A scoping review. Oral Diseases vol. 28 1029–1041 Preprint at https://doi.org/10.1111/odi.13843 (2022).
DZINK, J. L., SHEENAN, M. T. & SOCRANSKY, S. S. Proposal of Three Subspecies of Fusobacterium nucleatum Knorr 1922: Fusobacterium nucleatum subsp. nucleatum subsp. nov., comb. nov.; Fusobacterium nucleatum subsp. polymorphum subsp. nov., nom. rev., comb. nov.; and Fusobacterium nucleatum subsp. vincentii subsp. nov., nom. rev., comb. nov. Int J Syst Bacteriol 40, 74–78 (1990).
Thurnheer, T., Karygianni, L., Flury, M. & Belibasakis, G. N. Fusobacterium Species and Subspecies Differentially Affect the Composition and Architecture of Supra- and Subgingival Biofilms Models. Front Microbiol 10, (2019).
Qu, H. et al. A rapid and sensitive CRISPR-Cas12a for the detection of Fusobacterium nucleatum. Microbiol Spectr 12, (2024).
Ternes, D. et al. The gut microbial metabolite formate exacerbates colorectal cancer progression. Nat Metab 4, 458–475 (2022).
Thursby, E. & Juge, N. Introduction to the human gut microbiota. Biochemical Journal vol. 474 1823–1836 Preprint at https://doi.org/10.1042/BCJ20160510 (2017).
Cai, Z., Zhu, T., Liu, F., Zhuang, Z. & Zhao, L. Co-pathogens in Periodontitis and Inflammatory Bowel Disease. Frontiers in Medicine vol. 8 Preprint at https://doi.org/10.3389/fmed.2021.723719 (2021).
Gheorghe, D. N. et al. Periodontitis, Metabolic and Gastrointestinal Tract Diseases: Current Perspectives on Possible Pathogenic Connections. Journal of Personalized Medicine vol. 12 Preprint at https://doi.org/10.3390/jpm12030341 (2022).
Xun, Z., Zhang, Q., Xu, T., Chen, N. & Chen, F. Dysbiosis and Ecotypes of the Salivary Microbiome Associated With Inflammatory Bowel Diseases and the Assistance in Diagnosis of Diseases Using Oral Bacterial Profiles. Front Microbiol 9, (2018).
Bao, J. et al. Periodontitis may induce gut microbiota dysbiosis via salivary microbiota. Int J Oral Sci 14, (2022).
Qian, J. et al. Periodontitis Salivary Microbiota Worsens Colitis. J Dent Res 101, 559–568 (2022).
Li, L. et al. Gut Microbiota May Mediate the Influence of Periodontitis on Prediabetes. J Dent Res 100, 1387–1396 (2021).
Kitamoto, S. & Kamada, N. Periodontal connection with intestinal inflammation: Microbiological and immunological mechanisms. Periodontology 2000 vol. 89 142–153 Preprint at https://doi.org/10.1111/prd.12424 (2022).
Kitamoto, S. et al. The Intermucosal Connection between the Mouth and Gut in Commensal Pathobiont-Driven Colitis. Cell 182, 447-462.e14 (2020).
Yang, L. et al. Expansion of Myeloid Immune Suppressor GrCD11b Cells in Tumor-Bearing Host Directly Promotes Tumor Angiogenesis. http://www.cancercell.
Liu, L., Liang, L., Yang, C., Zhou, Y. & Chen, Y. Extracellular vesicles of Fusobacterium nucleatum compromise intestinal barrier through targeting RIPK1-mediated cell death pathway. Gut Microbes 13, 1–20 (2021).

No competing interests reported.

GA.png
Graphical abstract
Supplementarymaterials.docx

Download PDF

Reviews received at journal
30 Oct, 2024
Reviewers agreed at journal
19 Oct, 2024
Reviewers agreed at journal
07 Sep, 2024
Reviewers invited by journal
07 Sep, 2024
Editor assigned by journal
03 Sep, 2024
Submission checks completed at journal
28 Aug, 2024
First submitted to journal
26 Aug, 2024

You are reading this latest preprint version

Periodontal pathogen Fusobacterium nucleatum promotes ulcerative colitis by ferroptosis-mediated gut barrier disruption

Status:

Version 1

Abstract

Figures

Introduction

Results

Discussion

Methods

Bacterial culture

Animals and study design

Cell culture and models

Iron, MDA and GSH determination

Western blot analysis

Quantitative real-time polymerase chain reaction (qRT-PCR)

Histopathological assessment, AB-PAS, IHC, and IF staining

Transmission electron microscopy (TEM)

In situ hybridization (FISH double labeling) assay

Determination of permeability

16S ribosomal RNA (16S rRNA) gene sequencing

Liquid chromatograph-mass spectrometer (LC-MS) analysis

Statistical analysis

Declarations

Acknowledgments:

Author contributions:

Declaration of conflicting interests:

Funding:

Data availability:

References

Additional Declarations

Supplementary Files

Status:

Version 1