Genetic stability of the CVS-31 standard sample of Lyssavirus rabies after successive passages in mice: mutations in phosphoprotein and glycoprotein genes

doi:10.21203/rs.3.rs-4978823/v1

The Lyssavirus rabies (RABV) is a negative RNA virus of approximately 12kb that encodes five proteins: nucleoprotein (N), phosphoprotein (P), matrix protein (M or M2), glycoprotein (G), and RNA polymerase (L). The aim of the present study was to identify the stability of the P and G genes from the standard sample CVS-31 RABV. Initially, 10% suspensions of the sample were prepared. Groups of 6 Swiss Webster mice were inoculated with this suspension intracerebrally, and after the animals' death, a new suspension was prepared with central nervous system (CNS) of these animals, and then inoculated into a new group of mice. This process was repeated for 10 successive virus passages. The CNS poolin each of the passages was subjected to RNA extraction, reverse transcription followed by polymerase chain reaction (RT-PCR) with specific primers for the P and G genes. The amplicons were sequenced and analyzed phylogenetically. Non-synonymous mutations were identified throughout the fourth and sixth successive passage. The identified mutations occurred in the regions of amino acids P233, G20, and G249, which may be regions with unknown or low activity in the proteins studied. Although the mutations identified in this study were not maintained in subsequent passages, it can be concluded that less than 10 passages in mice were sufficient to mutate the RABV genome. However, the mutations did not generate significant changes in the virus, supporting the stability documented in the literature and likely this stability remains in vitro, given the absence of immunological pressure from the animal.

RABV

Genes

Passages

Mutations

The Lyssavirus rabies (RABV) is one of the most stable viruses among RNA genome viruses, however, the occurrence of quasispecies during its replication process allows the identification of different genetic lineages (Escobar et al., 2023).

These genetic lineages have been identified in different reservoirs of the virus, which, due to their adaptation potential, have the ability to infect various species. The virus genome encode five proteins: the nucleoprotein (N), the phosphoprotein (P), the matrix protein (M), the glycoprotein (G), and the RNA polymerase-dependent protein (L) (ICTV, 2021; Tordo, 1996; WHO, 2022).

The N has been widely studied for phylogenetic purposes and identification of these new genetic lineages of the virus, while G and P are the most variable proteins of RABV and therefore the focus of immunogenic and pathogenic studies (Troupin et al., 2016; Fooks & Jackson, 2020; Castilho et al., 2017).

Louis Pasteur, through multiple passageways of RABV in rabbits, was able to "fix" the incubation period of a sample at approximately seven days, giving rise to the term "fixed virus" or standard virus. These samples are considered standard for RABV and are still used in laboratory tests today, examples of these samples being the Challenge Virus Standard (CVS) and the Pasteur Virus (PV). On the other hand, samples isolated from naturally infected individuals are called “wild virus” or "street virus" RABV samples (Lodmell et al., 1993).

Numerous studies demonstrate that attenuated RABV induces a strong adaptive immune response, resulting in viral elimination through rapid replication, and this strategy is widely used in vaccine production through successive passages in cells or animals, leading to the "fixation" of the virus. This attenuation process is associated with point mutations, such as the mutation in G that substitutes the amino acid asparagine (Asn) for serine (Ser) at position G194, preventing the virus from reverting to a pathogenic state. A mutation to arginine (Arg) at position G333, which showed to be pathogenic or fatal in adult mice after intracerebral inoculation (Ito et al., 2006).

It is believed that the attenuation of the CTN-S1 sample resulting in CTN-181-3 may have occurred due to two substitutions in G at positions G276 (leucine to valine - Leu/Val) and L1496 (methionine to tryptophan - Met/Trp). Understanding how mutations in these genes modify the virus behavior is essential for the understanding of the evolutionary aspects of RABV (Shi et al., 2022).

The molecular mechanisms responsible for regulating the adaptation and pathogenicity of RABV are still not clear. While the G is widely recognized as the main responsible for virulence, there is evidence suggesting the importance of others genes in this aspect. A study conducted by Nitschel et al. (2021) revealed that just ten passages of "wild virus" samples of RABV (rRABV Dog and rRABV Fox) in different cell lines (BHK and MDCK-II) were enough to induce mutations in the G and in the C-terminal region of P.

A mutant variant CE(NiP) of RABV had its tPs expression increased, resulting in a decrease in morbidity and mortality rates in mice, indicating an essential role of P in the neuroinvasiveness and pathogenesis of RABV (Okada et al., 2016).

For the understanding of viral evolution, among other studies, analyses of samples subjected to serial passages have been carried out to estimate rates of nucleotide and/or amino acid substitutions. In this study, the standard sample of RABV, CVS-31, was subjected to ten successive in vivo passages to observe the stability of the G and P genes in order to identify possible mutations associated with the virus adaptation in an animal model.

2.1. Virus

It was used a standard RABV sample, Challenge Virus Standard (CVS 31).

2.2. Mice

Swiss Webster (SW) mice, aged 3–4 weeks, were used. The animal ethics committee (CEUAIP07/2022) approved all procedures.

2.3. Successive passages in mice

Initially, a 10% suspension (w/v in PBS) was prepared with the CVS-31 sample, which was then inoculated intracerebrally in a group of six mice. This was considered the first passage of the CVS-31 sample. The animals were kept in cages under ideal environmental conditions, with access to food and water ad libitum and were monitored daily. Afterwards the development of characteristic clinical signs of rabies, mice were euthanized in extremis. Each mouse underwent necropsy by trained personnel to Central Nervous System (CNS) collection.

The multiplication of RABV in the CNS was confirmed by direct immunofluorescence (IFD) performed according to usual techniques (Koprowski, 1996). From the CNS pool collected from the mice, a new 10% w/v suspension was prepared in PBS, which was inoculated intracerebrally in a new group of mice. This was considered the second passage of the CVS-31 sample, and the process was repeated up to 10 successive passages. All samples were stored in a freezer at -80°C (-112°F) until their use.

2.4. RT-PCR and genetic sequencing

Each successive passage of the CVS-31 sample in mice underwent RNA extraction using Trizol® Reagent (Invitrogen, Carlsbad, CA, USA), following the manufacturer's instructions. The extracted RNA was then subjected to reverse transcription (RT) in a final volume of 50 µl with the SuperScript II® reverse transcriptase Kit (Invitrogen, Carlsbad, CA, USA), following the manufacturer's instructions. This was followed by polymerase chain reaction (PCR) in a final volume of 50 µl. The amplicons were purified with the GFX™ PCR DNA kit and underwent genetic sequencing. The primers used in RT-PCR and genetic sequencing are: PSENSE1 (CGAATCATGATGAATGGAGG) and Panti1 (TCATTTTATCAGTGGTGTTG) for gene P; Ga3222-40 (CGCTGCATTTTRTCARAGT) and Gb4119-39 (GGAGGGCACCATTTGGTMTC) for gene G. For each identified mutation, three repetitions of genetic sequencing were performed.

2.5. Bioinformatics

The genetic sequences of RABV obtained were edited using the CHROMAS software (version 2.6.6 Copyright© 1998–2018). After editing, the final sequences were aligned with CLUSTAL/W using the BioEdit Sequence Alignment Editor software, and the putative amino acid sequences were analyzed by the same software. The sequences generated in this study were deposited in the public database GenBank (www.ncbi.nlm.nih.gov/genbank/) with the accession numbers: PP583675 to PP583683 (Gene P) and PP706217 to PP706225 (Gene G).

After the alignment, phylogenetic trees were constructed using the Maximum Likelihood method based on the Tamura & Nei model (1993) and 1,000 bootstrap repetitions for statistical support using the software MEGA 11 (Kumar Stecher & Tamura, 2016). In addition to the genetic sequences obtained in this study, sequences available in the GenBank database were included (26 sequences, Table 1).

Table 1

GenBank accession numbers of the P and G gene sequences used in this study showing the species or organisms from which they were isolated, country, and year in which sample was obtained.
GenBank Acession	Gene	Host	Country	Year
X55727.1	P	Dog passage in BHK-21	USA	1990
JX276550.1	P and G	Vero Cells	China	2012
GQ918139.1	P and G	Unkown	France	2009
HM535790.1	P and G	Mouse	USA	2010
KM594034.1	P and G	Nyctinomops laticaudatus	Brazil	2010
KM594033.1	P and G	Tadarida brasiliensis	Brazil	2010
KM594031.1	P and G	Myotis nigricans	Brazil	2010
KM594026.1	P and G	Eptesicus furinalis	Brazil	2009
KM594023.1	P and G	Callithrix jacchus	Brazil	2008
KM594040.1	P and G	Desmodus rotundus	Brazil	2013
KM594039.1	P and G	Cerdocyon thous	Brazil	2009
AB517659.1	P and G	Canis lupus familiaris	Brazil	2009
MT367573.1	G	Unkown	China	2018
MN099706.1	G	Mouse	Nigeria	2017
OP762264.1	G	Didelphis albeventris/N2A	Brazil	2021
OP762225.1	G	Artibeus literatus/N2A	Brazil	2011
OP762206.1	G	Canis lupus familiaris/N2A	Brazil	2011
OR604581.1	G	Dog	Brazil	2023
OP762199.1	G	Artibeus literatus/N2A	Brazil	2018
KU739045.1	G	Bovine	Brazil	2011
KM594029.1	G	Eptesicus furinalis	Brazil	2006
KM594042.1	G	Desmodus rotundus	Brazil	2013
AJ506997.1	G	Mouse	India	2002
KF733452.1	G	BHK-21	France	2013
KR105373.1	G	Mice	India	2015
KR105372.1	G	BHK-21	India	2015

All inoculated animals with the RABV CVS-31 sample, after each passage, showed characteristic clinical signs of rabies. Afterwards, necropsy of the animals was performed, and from pools of the central nervous system (CNS) of each passage, RNA extraction, RT-PCR, and genetic sequencing were carried out. The obtained genetic sequences were compared over the 10 successive passages.

A mutation in gene P was identified in the fourth successive passage, and this sample was designated as CVS-31/1P4, the non-synonymous mutation happened in 223 amino acid (changing Phe→Ser). Additionally, two non-synonymous mutations in gene G were found in the sixth passage in 20(Lys→Thr) and 249(Val→Gly) amino acid, leading to the sample being labeled as CVS-31/2G6.

Phylogenetic analysis was performed using sequences in coding regions of genes P (891 nucleotides) and G (612 nucleotides). For gene P, the region between nucleotides 30-991 (amino acids 10-307) was analyzed, with the CVS-31 sample as a reference, GenBank accession number: X55727.1. For gene G, the region between nucleotides 52-773 (amino acids 18-258) was analyzed, with the CVS-31 sample as a reference, RABV-GenBank accession number: KR105372.1.

In the phylogenetic tree of gene P, two clusters were formed as shown in Figure 1(1A). Cluster 1 included standard RABV CVS and PV samples: X55727.1, GQ918139.1, JX276550.1, HM535790.1; and Cluster 2 included wild virus samples of RABV isolated from Brazil: KM594034.1, KM594033.1, KM594031.1, KM594026.1, KM594023.1, KM594040.1, KM594039.1, and AB517659.1.

In the phylogenetic tree of gene G, two clusters were formed as depicted in Figure 1(1B). Cluster 1 included samples GQ918139.1, JX276550.1, HM535790.1, MT367573.1, MN099706.1, AJ506997.1, KF733452.1, KR105373.1, and KR105372.1; and Cluster 2 included samples KM594034.1, KM594033.1, KM594031.1, KM594026.1, KM594023.1, KM594040.1, KM594039.1, AB517659.1, OP762264.1, OP762225.1, OP762206.1, OR604581.1, OP762199.1, KU739045.1, KM594029.1, and KM594042.1.

The samples in which mutations were identified in this study (CVS-31/1P4 and CVS-31/2G6) remained in the same cluster as the CVS-31 sample without mutation.

Although RABV is widely studied, there are still gaps in understanding its genetic evolution. One of the difficulties in conducting more comprehensive evolutionary studies on this virus is the lack of consensus on the target gene to be analyzed. The P and G genes are the most variable in the RABV genome. Analyzes of the P gene are rare, while the same does not hold true for the G gene, probably due to its antigenicity.

In this study, a partial analysis of the RABV genome was performed, including the P and G genes. Studies by Wu (2002), Conselheiro et al. (2022), Oliveira (2010) and Kobayashi (2007, 2010) analyzed part of the RABV genome, focusing on the N and G genes, alone or in association. Despite advances in genetic sequencing tools, studies like Bonnaud et al. (2019), which analyzed the complete RABV genome of samples of wild virus, comparing RABV variation in transmission between dog and fox species, are still a minority.

Although the mutations identified in this study are not synonymous, they did not persist in subsequent passages. This may be associated with the high rate of negative selection of RABV and the high adaptation of CVS-31 to the experimental model used (mice). It is worth noting that the CVS-31 sample is a standard virus sample, therefore more adapted than wild virus samples, where mutations can occur more frequently to achieve more efficient replication.

For a more comprehensive understanding of how RABV evolves, it is important to understand the various factors that can contribute to greater or lesser variation of the virus. Heterogeneity in RABV, as in other viruses, is associated with various factors such as the infection period, transmission route, viral load, host immune system, and interaction between virus and host (Batista et al., 2015).

In this study, the intracerebral route of inoculation was used, which is the most effective in experimental infection. This strategy, however, may have limited virus modulation, as there is no need for the virus to be transported from one tissue to the nervous tissue. Different virus entry points can result in different variations or mutations, depending on its path in the host's body and how the immune system reacts, possibly exerting greater selective pressure and, consequently, greater variation (Conselheiro et al., 2022).

The rate of variation in identity of the RABV among different genetic lineages is approximately 2% across the five RABV genes, a low variation mainly when compared to other RNA genome viruses (Sato et al., 2004, 2006; Kobayash, 2007). When analyzing mutations over successive passages, 148 mutations were identified after five successive passages of RABV isolated from foxes and dogs (Bonnaud et al., 2019).

It is known that host adaptation to the virus is an important factor for RABV alteration. Samples used by Bonnaud et al. were wild viruses, which may explain the high number of mutations, contrasting the results obtained in this study with the standard virus sample CVS-31, where only 3 mutations were identified despite a higher number of passages (10).

In the research conducted by Kissi et al. (1999), successive passages of RABV were carried out in different animal species. Inoculations in mice were not enough to identify virus variations after three passages, while in dogs and cats, 12 mutations were identified in the N, P, and mainly G genes after three successive passages.

A study conducted by our team analyzed the genetic stability of RABV samples with different genetic lineages already identified in Brazil. In three of the RABV isolates, no genetic alterations were identified after ten successive passages. In only one of the analyzed genetic lineages, a non-synonymous mutation in the P gene was identified, indicating that RABV could be less adapted to the non-hematophagous bat (Eptesicus furinalis) in comparison with the other samples analyzed (Batista et al., 2015)..

Mice are widely used as an experimental model for RABV (Fagundes & Taha, 2004). In the present study, three mutations in two RABV genes were identified over the ten successive passages performed. It is possible that a greater number of mutations could have occurred if another animal had been used for these passages. Additionally, the complete genome of the virus was not analyzed, so mutations that were not identified may have occurred; however, the most variable genes of the genome were analyzed in this study.

It is worth noting that the mutations identified were non-synonymous, indicating that the protein structure could be altered. Depending on the position of the amino acid in a protein, it can be involved in one or more functions within its biological activity.

The first 19 amino acids represent the signal peptides (SP), indicating the beginning of the protein and assisting in its entry into the rough endoplasmic reticulum. The region between amino acids 20 and 458 is called the ectodomain (EC), primarily responsible for the pathogenicity of RABV (Carnieli et al. 2009). Mutations identified in the G gene in our study occurred at position G20, in the SP region, and G249, in the EC region.

Certain amino acids, such as 36, 37, and 38, are involved in protein glycosylation. Amino acids between 189 and 214 are involved in RABV internalization, while amino acids between 102 and 179 are involved in virus G binding to receptors at a low pH. Considering the positions of the identified alterations in this study, there was likely no significant change in protein activity, as the mutations were not maintained in subsequent passages, and the lethality remained at 100% in all passages. This lack of change may be due to the fact that CVS-31 is already efficient in infecting and killing mice; therefore, if any alteration occurred, it would likely be a reduction in pathogenicity, which did not happen over the passages.

The study by Okada et al. (2016) was used to understand the activity regions of P. It comprises 297 amino acids, and its translation can produce both the full P gene (P1) and the tPs (P2, P3, P4, and P5), which are important inhibitors of cellular antiviral actions, recognized by interferons and involved in RABV neuroinvasiveness.

These tPs are translations of parts of the P gene. The mutation found in this study occurred in amino acid P223, which plays a role in tP production and acts in virus neuroinvasiveness, but this alteration did not persist in subsequent passages.

The results of this study confirm the genetic stability of the standard virus CVS-31. This result should be considered for the development of laboratory techniques and vaccines against rabies, as its immunogenic and pathogenic capacity was not altered after several successive passages.

Specific mutations in the P and G genes of RABV CVS-31 were identified over ten successive passages in mice, indicating an evolutionary dynamic of the virus in response to selective pressures imposed by the host and environment. However, it is important to note that these specific mutations were not maintained in subsequent passages, demonstrating the high rate of negative selection and efficient adaptation of CVS-31 to the mouse host.

The analysis revealed that despite intracerebral inoculation being an effective strategy to infect mice, allowing RABV multiplication in the central nervous system, it may have limited the virus modulation due to the absence of neurotropism.

Although there are gaps in the comprehensive understanding of RABV evolution, this study contributed to the investigation of specific genetic mutations, as mutations were found in less studied regions of the proteins, providing significant insights into the evolutionary dynamics of the virus in an animal model. However, additional studies are needed to understand the relationship between the identified genetic mutations and the functional changes in the P and G proteins, especially regarding the virus biological activity.

Ethical approval:

The animal ethics committee (CEUAIP07/2022) approved all procedures.

Conflicts of interest:

The authors declare that there are no conflicts of interest.

Funding information:

This project was funded by Instituto Pasteur, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Universidade Federal do ABC and FAPESP, Brazil in 2013 (Project Code No., 2013/15760-0).

Author Contribution

Juliana S. Lima: The main author of the study, did the all the steps of the studyHelena B. C. R. Batista: was my advisor and mentor of the work, helping with all steps of the studyCamila M. Barboza: Helped with methodology, data analysis and text reviewMichelli Cocchi: Helped with data analysis and phylogenetic treeJaíne G. Garcia: Helped with data analysis

Data Availability

The sequences generated in this study were deposited in the public database GenBank (www.ncbi.nlm.nih.gov/genbank/) with the accession numbers: PP583675 to PP583683 (Gene P) and PP706217 to PP706225 (Gene G).In addition to the genetic sequences obtained in this study, sequences available in the GenBank database were included (accession numbers: X55727.1, JX276550.1, GQ918139.1, HM535790.1, KM594034.1, KM594033.1, KM594031.1, KM594026.1, KM594023.1, KM594040.1, KM594039.1, AB517659.1, MT367573.1, MN099706.1, OP762264.1, OP762225.1, OP762206.1, OR604581.1, OP762199.1, KU739045.1, KM594029.1, KM594042.1, AJ506997.1, KF733452.1, KR105373.1 and KR105372.1).

Batista, H. B. C. R., Schmidt E., Teixeira T.F., Schaefer R., & Roehe P.M. (2015). Antigenic and Genetic Stability of Rabies Virus, Donnish Journal.
Bonnaud EM, Troupin C, Dacheux L, Holmes EC, Monchatre-Leroy E, Tanguy M (2019) Comparison of intra- and inter-host genetic diversity in rabies virus during experimental crossspecies transmission. PLoS Pathog 15(6). DOI: 10.1371/journal.ppat.1007799.
Conselheiro, J.A.; Barone, G.T.; Miyagi, S.A.T.; de Souza Silva, S.O.; Agostinho, W.C.; Aguiar, J.; Brandão, P.E. Evolution of Rabies Virus Isolates: Virulence Signatures and Effects of Modulation by Neutralizing Antibodies. Pathogens 2022. DOI: 10.3390/pathogens11121556
Castilho, J. G; Achkar, S; Macedo, C. I; Mori, E.; Costa, W. A. Situação atual do diagnóstico da raiva em cães e gatos no estado de São Paulo: risco de transmissão para a população humana? BEPA 2017;14(163):39-41. Access: <https://periodicos.saude.sp.gov.br/BEPA182/article/view/37921>
Carnieli Jr, P.; Castilho, Juliana Galera ; Fahl, Willian de Oliveira ; Véras, Nazle Mendonça Collaço ; Timenetsky, Maria do Carmo Sampaio Tavares . Genetic characterization of Rabies virus isolated from cattle between 1997 and 2002 in an epizootic area in the state of São Paulo, Brazil.. Virus Research, 2009. DOI: 10.1016/j.virusres.2009.05.001
Escobar, L.E., Velasco-Villa, A., Satheshkumar, P.S. et al. Revealing the complexity of vampire bat rabies “spillover transmission”. Infect Dis Poverty 12, 10 (2023). DOI: https://doi.org/10.1186/s40249-023-01062-7.
Fagundes, D. J., & Taha, M. O. (2004). Modelo animal de doença: critérios de escolha e espécies de animais de uso corrente. Acta Cirúrgica Brasileira, 19, 59-65. DOI: https://doi.org/10.1590/S0102-86502004000100010
Fooks, A. R., & Jackson, A. C. (2020). Rabies: Scientific Basis of the Disease and Its Management. In Expert Rev Vaccines. (4a Edition). Elsevier eBook ISBN: 9780128205723
ICTV. (2021). Genus: Lyssavirus. Virus Taxonomy: 2020 Release EC 52: Access: <https://talk.ictvonline.org/ictv-reports/ictv_online_report/negative-sense-rna-viruses/w/rhabdoviridae/795/genus-lyssavirus>
Ito, N., Takayama, M. , Yamada, K, Y. Shoji, S. Inoue, T. Iijima, T. Sakai, I. Kurane, K. Morimoto, A highly attenuated rabies virus HEP-Flury strain reverts to virulent by single amino acid substitution to arginine at position 333 in glycoprotein. Virus Res. 119(2), 208–215 (2006). DOI: 10.1016/j.virusres.2006.01.014
Kissi B, Badrane H, Audry L, Lavenu A, Tordo N, Brahimi M, Bourhy H. 1999. Dynamics of rabies virus quasispecies during serial passages in heterologous hosts. J.of Gen. Virol., 80, 2041–2050. DOI: 10.1099/0022-1317-80-8-2041
Kobayashi, Y., Inoue, N., Sato, G., Itou, T., Santos, H. P., Brito, C. J., ... & Sakai, T. (2007). Phylogenetic characterization of rabies virus isolates from Carnivora in Brazil. Journal of Veterinary Medical Science, 69(7), 691-696. DOI: 10.1292/jvms.69.691
Kobayashi, Yiki, Yoshiyuki Suzuki, Takuya Itou, Adolorata A.B. Carvalho, Elenice M.S. Cunha, Fumio H. Ito, Takashi Gojobori, Takeo Sakai, Low genetic diversities of rabies virus populations within different hosts in Brazil, Infection, Genetics and Evolution, Volume 10, Issue 2, 2010. DOI: 10.1016/j.meegid.2009.12.003
Koprowski, H., 1996. The mouse inoculation test. In: Meslin, F.-X., Kaplan, M.M., Koprowski, H. (Eds.), Laboratory Techniques in Rabies. World Health Organization, Geneva, pp. 80–86. ISBN: 9241544791
Kumar S, Stecher G, Tamura K (2016) MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol 33:1870–1874. DOI: 10.1093/molbev/msw054
Mochizukin N, Kobayashi Y, Sato G, Hirano S, Itou T, Ito FH, Sakai T. 2011. Determination and Molecular Analysis of the Complete Genome Sequence of Two Wild-Type Rabies Viruses Isolated from a Haematophagous Bat and a Frugivorous Bat in Brazil. J Vet Med Sci. Jun;73(6):759-66. DOI: 10.1292/jvms.10-0238
Okada, K., Ito, N., Yamaoka, S., Masatani, T., Ebihara, H., Goto, H., Nakagawa, K., Mitake, H., Okadera, K. & Sugiyama, M. (2016). Roles of the rabies virus phosphoprotein isoforms in pathogenesis. Journal of virology, 90(18), 8226-8237. DOI: 10.1128/JVI.00809-16
Oliveira, R. D. N.; Souza, S. P. De; Lobo, R. S. V.; Castilho, J. G.; Macedo, C. I.; Carnieli, P.; Fahl, W. O.; Achkar, S. M.; Scheffer, K. C.; Kotait, I.; Carrieri, M. L.; Brandão, P. E. Rabies virus in insectivorous bats: implications of the diversity of the nucleoprotein and glycoprotein genes for molecular epidemiology. Virology, v. 405, n. 2, p. 352–60, Sep. 2010. DOI: 10.1016/j.virol.2010.05.030
Sato, G., Itou, T., Shoji, Y., Miura, Y., Mikami, T., Ito, M., Kurane, i., Samara, S. I., Carvalho, A. A. B., Nociti, D. P. & Sakai, T. (2004). Genetic and phylogenetic analysis of glycoprotein of rabies virus isolated from several species in Brazil. Journal of Veterinary Medical Science, 66(7), 747-753. DOI: https://doi.org/10.1292/jvms.66.747
Sato, G., Kobayashi, Y., Shoji, Y., Sato, T., Itou, T., Ito, F. H., Santos, H. P., Brito, C. J. C. & Sakai, T. (2006). Molecular epidemiology of rabies from Maranhão and surrounding states in the northeastern region of Brazil. Archives of virology, 151, 2243-2251. DOI: 10.1007/s00705-006-0770-7
Tamura K & Nei M (1993) Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol 10:512–526. DOI: 10.1093/oxfordjournals.molbev.a040023
Tordo, N. (1996). Characteristics and molecular biology of the rabies virus. In: Laboratory Techniques in Rabies. . Geneva: World Health Organization, 28–51. ISBN: 92 4 154479 1
Troupin, C. , Dacheux, L. , Tanguy, M. , Sabeta, C. , Holmes, E. C. , Bouchier, C., Vignuzzi, M., Duchene, S., Holmes, E. C. & Vignuzzi, M. (2016). Large-scale phylogenomic analysis reveals the complex evolutionary history of rabies virus in multiple carnivore hosts. PLoS Pathogens. DOI: 10.1371/journal.ppat.1006041
Wu, X. F. , Gong, X. M. , Foley, H. D. , Schnell, M. J. , & Fu, Z. F. (2002). Both viral transcription and replication are reduced when the rabies virus nucleoprotein is not phosphorylated. Journal of Virology, 76. DOI: 10.1128/JVI.76.9.4153-4161.2002

No competing interests reported.

ImagensArticleJuliana24.8.24.docx

Genetic stability of the CVS-31 standard sample of Lyssavirus rabies after successive passages in mice: mutations in phosphoprotein and glycoprotein genes

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials and methods

2.1. Virus

2.2. Mice

2.3. Successive passages in mice

2.4. RT-PCR and genetic sequencing

2.5. Bioinformatics

3. Results

4. Discussion and conclusions

Declarations

Ethical approval:

Funding information:

Author Contribution

Data Availability

References

Additional Declarations

Supplementary Files

Status:

Version 1