Dual-fluorescence labeling of pseudorabies virus for live-cell tracking virus entry and replication

doi:10.21203/rs.3.rs-4982958/v1

Pseudorabies virus (PRV) is a neurotropic herpesvirus. It is not easy to tracking the whole replication progess of PRV, especially the nascent viral genome in the host cells. In this study, we developed a dual-fluorescence-labeled PRV (rPRV-Anchor3-mCherry) with the viral genome and the envelope protein gM labeled by Anchor DNA labeling system and mCherry, respectively. Through single-virus tracking of rPRV-Anchor3-mCherry, we observed that PRV invaded mouse neuroblastoma Neuro2a (N2a) cells via both endocytosis and plasma membrane fusion pathway. During the replication stage, parental and progeny viral genome of rPRV-Anchor3-mCherry in the cell nuclei could be visible, and viral nucleocapsid appeared more specifically than traditional capsid protein labeled PRV particles (rPRV-VP26-EGFP). We found that numerous progeny viral particles were produced in the nucleus, causing the nucleus membrane to break using three-dimensional (3D) live-cell imaging and electron microscopy. Moreover, Our findings confirmed that simultaneously targeting of the UL9 and UL54 genes using a CRISPR-Cas9 system led to the complete inhibit PRV replication. rPRV-Anchor3-mCherry can be used to research multiple steps of the viral cycle.

pseudorabies virus

Anchor3 DNA labeling system

genome

envelope

live-cell imaging

Pseudorabies virus (PRV) belongs to the Alphaherpesvirinae subfamily of the Herpesviridae, serving as a prominent etiological agent in swine infectious disease [1]. Moreover, accumulating evidence suggests that PRV may pose a threat to humans ༻2–4༽. The infection patterns of alphaherpesviruses are intricate in different cell types ༻5༽. Alphaherpesviruses belong to the subfamily of neuroinvasive herpesviruses and can cause acute infections or establish lifelong latent infections in neurogenic cells. Unfortunately, existing antiviral treatments and vaccinations have proven ineffective in clearing latent PRV within the host, making it a persistent challenge to combat PRV ༻6, 7༽. Fluorescent markers, such as various variants of green fluorescent protein (GFP), are extensively employed to chemically label virus particles or incorporate them into fusion proteins. This approach facilitates the tracking of viral entry and exit from the host cells. However, these approaches have their limitations. For instance, labeling the structural proteins of the virus is challenging to monitor the replication of the viral genome. Therefore, an effective tool is critical to track both parental and progeny infections of PRV.

The anchor DNA labeling system is a bipartite system derived from the chromosome segregation machinery in bacteria. Within this system, the ANCH DNA sequence serves as the specific binding target for OR fluorescent proteins (OR-FP) [8]. The OR protein is a member of the GRAS family of proteins, distinguished by the presence of the GRAS domain. In solution, the GRAS domain maintains an irregular conformation, but it undergoes specific folding to form secondary or tertiary structures when exposed to a suitable ligand ༻9༽. GRAS proteins play an important role in cell signal transduction and functional regulation under physiological conditions ༻10༽. When more copies of ANCH DNA was inserted into genome, more copies OR-FP proteins bind to ANCH DNA, and these lead to the generation of an amplified signal, greatly facilitating the detection of the target DNA ༻11༽. Moreover, the Anchor DNA labeling systems have demonstrated the ability to interact with the viral genome without causing disrupting to its structure or function. Consequently, they have proven to be effective tools for studying viral genome replication and the chromatin dynamics of human cytomegalovirus and adenovirus in human cells ༻12, 13༽.

The CRISPR-Cas9 technology has been widely applied in editing or clearing latent herpesvirus [14–15]. Moreover, leveraging CRISPR-Cas9 for silencing the key genes associated with the replication or latent reactivation of PRV would be invaluable ༻16༽. Specifically, the UL9 gene encodes the origin-binding protein that is crucial for viral replication. The UL42 gene encodes the polymerase accessory protein, enhancing the catalytic activity of DNA polymerase, which is essential for viral replication ༻17༽. The UL54 gene encodes an mRNA export factor and is associated with PRV reactivation ༻18༽. It is hypothesized that the simultaneous silencing of these three viral genes may offer an effective strategy to clear latent PRV.

Here, we created a dual-fluorescence-labeled recombinant PRV (rPRV-Anchor3-mCherry) in conjunction with the live-cell imaging technology to meticulously track multiple steps of the viral cycle of PRV in mouse neuroblastoma Neuro2a (N2a) cells. N2a cells were derived from mouse neural crest tissues and chosen for their relevance in investigating axonal growth and signaling pathways [19]. Furthermore, we used the CRISPR-Cas9 technology to inhibit PRV replication in N2a cells. In this study, we aimed to unveil the potential applications of the dual-fluorescence-labeled PRV.

Virus and cells

The WT-PRV strain (PRV TJ, GenBank accession number: KJ789182.1) was isolated and identified previously ［20］. The N2a cells (ATCC CCL-131), the baby hamster kidney 21 (BHK-21, ATCC CCL-10) cells, the human embryonic kidney 293T (HEK293T, ATCC CRL-11268) cells, and the porcine kidney 15 (PK-15, ATCC CCL33) cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS). The construction of rPRV-Anchor3-mCherry was carried out using the fosmid library of the PRV TJ strain ［21］. The mCherry was cloned at the 3' terminus of the UL10 gene just downstream of the termination codon. gM is encoded by the UL10 gene. Similarly, the OR3-EGFP expression cassette with ANCH3 sequences, was inserted downstream of the US9 gene following its termination codon. The OR3-EGFP (66 kDa) expression cassette was regulated by the simian virus 40 (SV40) early promoter and the SV40 poly(A) signal. Additionally, ten copies of ANCH3 sequences (14 bases each) were incorporated downstream of the SV40 poly(A) signal, with about 90 to 100 bases of interval sequences between each repetition ［12］. The recombinant PRVs were rescued in BHK-21 cells, as described previously ［21］. The primers used for constructing the recombinant viruses are listed in Table 1.

Multi-step growth curve and plaque assay

PK-15 cells were seeded in 24-well plates and infected with WT-PRV, rPRV-Anchor3-mCherry, or rPRV-Anchor3 at a multiplicity of infection (MOI) of five, and incubated for 2 hour, then washed with PBS to remove the uninfected viral particles and then cultured in fresh medium. The cell supernatants were harvested at different time points, and the viral titers were determined by TCID₅₀ ［22］. For plaque assay, each PRV strain was serially diluted in 10-fold, and used to infect PK-15 cells for 1 hour. The medium was then replaced with 1% low-melting point agarose in MDEM. The cells were stained with crystal violet at 72 hpi, and about 3 plaques were randomly selected and quantified by the Image J software ［22］.

PCR and qPCR

Genomic DNA of the WT-PRV and rPRV-Anchor3-mCherry was extracted and used as the template for PCR or qPCR. The total RNA of the infected or uninfected cells was extracted to quantify viral mRNA levels. Viral genes were amplified according to the manufacturer's instructions for Exp Taq GC-rich Polymerase (catalog no. AG12204, Accurate Bio). Additionally, the cells’ viral genome copies were measured by qPCR. The procedures were performed as described previously ［23］. The primers for PCR and qPCR are listed in Table 2.

Western blotting assay

The proteins were harvested in NP40 buffer, and western blotting analysis was performed following previously established protocols ［22］. The flag-tagged viral proteins UL42, UL54, and UL9 were incubated with the anti-Flag antibody (dilution to 1:1000, catalog no. F3165, Sigma-Aldrich). Moreover, the viral gB and gM proteins were incubated with anti-gB monoclonal antibodies (dilution 1:500) and anti-gM polyclonal antibody (dilution to 1:200) prepared in mice. OR-EGFP, β-tubulin, and GAPDH proteins were detected by the anti-EGFP antibody (catalog no. ab184601, Abcam). anti-β-tubulin monoclonal antibody (catalog no. ZRB1124, Sigma-Aldrich) and anti-GAPDH monoclonal antibody (catalog no. A1978, Sigma-Aldrich). A goat anti-mouse IRDye 800CW secondary antibody (dilution 1:10000) was used in the western blotting assay.

Immunofluorescence assay

The cells were fixed with 4% paraformaldehyde (catalog no. BL539A, Biosharp) at room temperature for 30 minutes. After being washed with PBS three times, the cells were permeabilized using 0.15% triton X-100 (catalog no. 1139100, BioFroxx) for 15 minutes, then incubated with anti-Lamin-B1 (catalog no. 12987, Proteintech) or anti-DNA (catalog no. AMS1047, Sigma-Aldrich) for 2 hours at 37°C and washed with PBST three times. Following this, the cells were incubated with the Alexa 488- or Alexa 647-conjugated secondary antibodies for 45 minutes at 37°C. The nuclei were stained with Hoechst (dilution to 1:1000) (catalog no. 33342, Thermo Fisher Scientific). After being washed with PBST three times, the cells were examined with a Zeiss LSM 800 laser-scanning confocal microscope.

TEM and immuno-electron microscopy

WT-PRV and rPRV-Anchor3-mCherry were proliferated on the PK-15 cells. The viral titers of all three PRV initial solutions exceeded 10^7.0 TCID₅₀/mL. Negative staining with 2% phosphotungstic acid was employed to visualize PRV in the PRV-infected cells or PRV stocks using TEM ［24］. Sample preparation and IEM were performed as previously described ［25］. For IEM, a mouse anti-EGFP monoclonal antibody (catalog no. ab184601, Abcam) and a gold-labeled secondary antibody (catalog no. G7652-2ML, Sigma-Aldrich) were used.

Single-particle tracking

Prior to live-cell imaging, rPRV-Anchor3-mCherry (MOI = 1) and N2a cells were co-incubated at 4°C for 20 minutes. After that, the cell monolayers were washed twice with precooled Hank’s balanced salts solution (catalog no. 14175095, Gibco) to remove the extracellular viruses. Following this, the medium was replaced with the FluoroBrite DMEM (catalog no. A1896701, Gibco) containing 5% FBS, and the cells were placed in a cell culture chamber at 37°C with 5% CO₂) for live-cell imaging. To visualize the PRV infection process, the cell nuclei were stained with Hoechst according to the manufacturer’s instructions. Images were captured at an interval of 0.5, 1, or 5 minutes to reduce the photo bleaching of fluorescent dyes or proteins. Consecutive z-stacks were acquired with depths of 500 to 20,000 nm. The Arivis Vision4D software was used for image analysis and 3D reconstruction. Image-Pro v10 software (Medium Cybernetics) was used to measure the trajectories and velocities. The movement pattern of rPRV-Anchor3-mCherry was further analyzed by MSD against time plots ［26, 27］.

Construction of plasmids and lentiviruses

Eukaryotic expression plasmids, namely pflag-UL9, pflag-UL42, and pflag-UL54, were cloned and stored in our lab. The sgRNAs targeting the UL9, UL42, and UL54 genes of PRV TJ were cloned into the Lenti-CRISPR v2 vector (catalog no. 52961, Addgene) according to the method described by Feng Zhang et al ［28］. The specific oligonucleotides for the sgRNAs targeting the UL9, UL42, and UL54 genes are detailed in Table 3.

To prepare lentiviruses, HEK293T cells were co-transfected with the Lenti-CRISPRv2-sgRNA-UL9, -UL42, and -UL54 transfer plasmids in combination with the packaging plasmids pMD2.G and psPAX2 (catalog no.12259 and 12260, Addgene) at a 1:1:1 molar ratio. After incubation for 72 hours, the lentiviruses in the supernatants were collected and stored at -80°C.

Confocal imaging and statistical analysis

We employed a LSM800-ZEISS confocal laser scanning microscope with Airyscan for 2D and 3D imaging of living cells. At least ten fields were captured for each sample. The Image J software was utilized to quantify automated spot and fluorescence spot. The 3D reconstruction and color rendering were assembled into videos using the Arivis Vision4D software. Analysis of the data was performed using the GraphPad Prism 8 statistical software (GraphPad). The student’s two-tailed t-test, one-way analysis of variance, and two-way analysis of variance were used, and significant differences were defined when the p-value was < 0.05.

Generation of a dual-fluorescence-labeled PRV

To comprehensively monitor the replication cycle of PRV, we employed dual-fluorescence labeling PRV. The viral envelope was marked in red and the genome in green (Figure 1A). To label the viral genome, we strategically integrated the Anchor3-EGFP system sequence between the US9 and US2 genes in rPRV-Anchor3-mCherry, as reported previously ［29］. Concurrently, for viral envelope labeling, we fused mCherry with gM, as described previously (Figure 1B) ［30］.

We observed numerous green fluorescent spots in the nucleus and cytoplasm of the rPRV-Anchor3-mCherry-infected N2a cells, while red fluorescence was only present outside of the nucleus. No fluorescence was observed in the wild-type PRV (WT-PRV)-infected N2a cells (Figure 2A). Upon examination under an electron microscope, the morphology of both the recombinant and wt viruses exhibited striking similarities. The membrane structures remained intact, and the observed viral particles had a diameter of approximately 200 nm (Figure 2B).

The multi-step growth curve showed that the viral titers of rPRV-Anchor3-mCherry and WT-PRV peaked at 72 hours post-infection (hpi), with values of 2.1 (± 0.46) ×10⁸ and 4.4 (± 0.82) ×10⁸ 50% tissue culture infective dose (TCID₅₀)/mL, respectively (Figure 2C). Moreover, there were no obvious differences in growth kinetics (Figure 2C) or plaque phenotypes (Figure 2D) between rPRV-Anchor3-mCherry and WT-PRV. Remarkably, even after the 30th generation of rPRV-Anchor3-mCherry, the Anchor3 and mCherry genes were detectable, confirming the stable genetic integrity of rPRV-Anchor3-mCherry (Figure 2E). Additionally, the expression of the gB and gM-mCherry proteins increased gradually over the course of rPRV-Anchor3-mCherry and WT-PRV infection. The level of the OR3-EGFP protein increased slowly in the rPRV-Anchor3-mCherry-infected N2a cells. However, there was no OR3-EGFP protein in the WT-PRV-infected cells (Figure 2F). The above results demonstrated that the expected dual-fluorescence-labeled PRV was generated and the insertion of the Anchor3 and mCherry sequences did not disrupt the structure or replication of PRV.

Real-time visualization of the complete replication cycle of a single rPRV-Anchor3-mCherry particle

The complete replication cycle of a single rPRV-Anchor3-mCherry particle was observed in the N2a cells (Figure 3A). Initially, a red particle adhered to the cytoplasmic membrane at 0 minutes post-infection (mpi), and then it gradually moved from the cytoplasmic membrane towards the vicinity of the cell nucleus before 30 mpi. At 55 mpi, this particle transitioned to green due to the envelope dissolution from the nuclear pore. Subsequently, the green particle moved gradually within the cell nucleus at 65 and 80 mpi. After viral genome replication, more green particles accumulated in the nucleus at 480 hpi. Additionally, we observed red fluorescence (gM-mCherry) on the cytoplasmic membrane around 480 mpi. Notably, gM-mCherry expression remained consistent from 540 to 750 mpi, contributing to the assembly of mature viral particles ［31］.

The trajectory (Figure 3B), immediate velocity (Figure 3C), and mean-squared displacement (MSD) (Figure 3D) of rPRV-Anchor3-mCherry from the initial entry to the emergence of infectious progeny virus were analyzed based on Fig. 3A. We divided the PRV replication process into three distinct phases: (i) the rapid invasion phase of viral particles, (ii) the slow nucleation phase of the viral core, and (iii) the rapid emergence phase of the progeny virus.

The transmission electronic microscopy (TEM) showed that viral particles are engaged in endocytosis at the cytoplasmic membrane at 0.25 and 0.5 hpi. Subsequently, the viral genome was observed to replicate in the cell nucleus at 5 hpi. Eventually, the nucleocapsids were formed in the nucleus and migrated to the cytoplasm by 8 hpi (Figure 3E). Notably, the single-particle tracking results indicated that PRV completed a replication cycle in approximately 12.5 hours. Specifically, the viral genome was observed to enter the nucleus between 1 and 1.5 hpi, while the assembly of gM on progeny particles occurred at 8 hpi.

Endocytosis is one invasion pathway of rPRV-Anchor3-mCherry in N2a cells

In order to accurately reveal invasion process of rPRV-Anchor3-mCherry, the fluorescence intensity and frequency distribution of red virions in solution and cells were analyzed (Figure 4A and B). The average fluorescence intensity of virions in solution and cells were 20.73 ± 6.01 and 20.23 ± 6.65 fluorescent units (FU), respectively. Individual particle fluorescence intensities were enriched at 20 RU, followed by 10 and 30 FU.

After endocytosis, viral particles travel through early endosomes (Rab5) to late endosomes (Rab7) or recycling endosomes (Rab11), and eventually reach lysosomes for viral membrane degradation ［32］. To determine whether the red particles entered into the N2a cells through endocytosis, N2a cells were transfected with the eukaryotic expression plasmids pBFP-Rab5 and pEGFP-Rab7 respectively, and infected with rPRV-Anchor3-mCherry 24 hours later. We observed that red fluorescent particles entered the regions with high expression of BFP-Rab5 at 5 mpi and leaved at 30 mpi (Figure 4C). We also identified endocytosis of rPRV-Anchor3-mCherry using the inhibitor 1,1′-Disulfanediyldinaphthalen-2-ol (IPA3) and Chlorpromazine (CPZ) ［33］. All the viral incubated particles were distributed in the periphery of the cytoplasmic membrane in the inhibitor-treated cells except for the control cells (Figure 4D). The average particle count per cell treated with two inhibitors was obviously less than that in the control cells (Figure 4E). These observations collectively reveal that rPRV-Anchor3-mCherry enter N2a cells through endocytosis pathways.

Single rPRV-Anchor3-mCherry particles invade N2a cells via the plasma membrane fusion pathway

Herpesviruses exhibit the ability to invade host cells through either endocytosis or plasma membrane fusion pathways, with the specific mode employed varying depending on the cell type ［33］. A detailed and visual plasma membrane fusion process of rPRV-Anchor3-mCherry in the N2a cells was represented in Fig. 5A. Initially, a red viral particle attached to the cell surface at 0 mpi, subsequently, transitioned to yellow between 2 to 3 mpi. The characteristic overlapping yellow spot resulted from the co-localization of the mCherry signal (red) and the OR3-EGFP signal (green), indicating the viral envelope released from its nucleocapsid. The green nucleocapsid progressed towards the nucleus at 30 mpi, reached the nuclear membrane at 60 mpi, and ultimately entered the nucleus at 70 mpi. The trajectory (Figure 5B), velocity (Figure 5C), and mean-squared displacement (Figure 5D) were evaluated based on the image of particle tracking. The virus initially exhibited restricted movement along the cytomembranes for approximately 5 minutes (i), followed by rapid transportation into the cytoplasm for about 60 minutes (ii). Subsequently, the nucleocapsid reached the nuclear envelope and remained in a static state for about 5 minutes (iii). Following this, it penetrated the nucleus, undergoing rapid movement for 12 minutes (iv), and then exhibited limited movement inside the nucleus for 18 minutes (v). Additionally, we visualized the fusion event using TEM and immunoelectron microscopy (IEM). A PRV particle was attached to the plasma membrane at 0.25 hpi, with a diameter of approximately 200 nm. Subsequently, its size reduced to just over 100 nm after the viral particle entered the cytoplasm at 0.5 hpi, and it further diminished to approximately 20 nm in the nucleus of N2a cells (Figure 5E). These compelling findings strongly support the notion that plasma membrane fusion is one route employed by PRV to invade N2a cells.

The viral particle of rPRV-Anchor3-mCherry is more specific than rPRV-VP26-EGFP in the nucleus

During the invasion progress of rPRV-Anchor3-mCherry, we noticed that the virion initially appeared red, and then turned green before entering the nucleus. To clarify the difference between the naked and encapsidated viral genomes in the presence of OR-EGFP. We used rPRV-VP26-EGFP as a control to observe the morphology of the rPRV-Anchor3-mCherry-infected N2a cells at various time points. The fluorescence intensity and frequency distribution of green particles in the nucleus of the rPRV-Anchor3-mCherry- and rPRV-VP26-EGFP-infected cells were analyzed (Figures 6A and B). The average fluorescence intensities were 19.83 ± 6.57 and 20.60 ± 8.25 FU, respectively. Individual particle fluorescence intensities were between 10 and 30 FU.

The green virion of rPRV-Anchor3-mCherry approaching the nucleus was observed at 1 hpi and disappeared at 2.5 hpi. The number of green virions in the nucleus of the rPRV-Anchor3-mCherry-infected N2a cells increased gradually from 5 to 20 hpi (Figure 6C). We also observed green particles outside the nucleus of the rPRV-VP26-EGFP-infected cells at 1 hpi. More green particles were smaller than viral nucleocapsids distributed around the cell nucleus at 2.5 hpi. Progeny nucleocapsids in the nucleus were sporadically labeled with green fluorescent at 5 hpi again. The number of green nucleocapsid in the nucleus of the N2a cells infected with rPRV-VP26-EGFP increased continuously from 5 to 10 hpi (Figure 6D)

The excess progeny virions disrupt the nuclear membrane

The 3D imaging and reconstruction techniques were utilized in cells during the later stages of rPRV-Anchor3-mCherry infection. We observed that the viral genome occupied in the cell nucleus, and numerous red punctuations generated by the gM-mCherry fusion proteins contained in the cytoplasm at 24 hpi. However, the host cell nucleus exhibited a distinctive, asymmetrically dumbbell-shaped morphology, with minimal presence of viral genome in the nucleus and more red punctuation around the nucleus at 48 hpi (Figure 7A). The 3D reconstruction images provided compelling evidence that the viral genome was accumulated in the cell nucleus, albeit with a disordered distribution at 24 hpi, and disappeared at 48 hpi (Figure 7B). Additionally, the fluorescence intensity of both EGFP and mCherry in the rPRV-Anchor3-mCherry-infected cells at 48 hpi was reduced remarkably compared with those at 24 hpi (Figure 7C). TEM imaging further allowed us to observe that the “virus factory” was positioned adjacent to the host chromatin, with a distinct boundary separating them, and the overall shape of the nucleus remained relatively normal at 24 hpi, but, nuclear membrane rupture in the rPRV-Anchor3-infected N2a cells at 48 hpi (Figure 7D).

It has been documented that the nuclear membrane ruptured when the nuclear lamina was weakened ［34］. The nuclear lamina, which is embedded in the inner nuclear membrane, is made up of lamins and lamin-binding proteins. Lamin-B1 is a member of the B-type lamin family ［35］. To further assess the integrity of the nuclear membrane, the protein level of lamin-B1 in the mock- or rPRV-Anchor3-mCherry-infected N2a cells was determined using the immunofluorescence assay (IFA). The results indicated lamin-B1 was highly expressed with enrichment around the cell nucleus in the mock- or PRV-infected N2a cells at 24 hpi. However, they were rare and did not overlap with the cell nucleus at 48 hpi (Figure 7E). The viral DNA in the WT-PRV-infected N2a cells at 24 hpi were more than 48 hpi, and no DNA was detected at 0 hpi (Figure 7F). These findings suggest that in the late stage of PRV infection, a large amount of progeny virions are assembled in the nucleus, leading to the disruption of nuclear membrane, allowing viral DNA to escape from the nucleus, and ultimately causing the death of the cells.

Prevention rPRV-Anchor3-mCherry replication of by CRISPR-Cas9

In this study, the CRISPR-Cas9 system was utilized to PRV prevent replication. The sgRNAs targeting the PRV UL42, UL9, and UL54 genes were inserted into the lentivirus vector. The resulting lentiviruses were transduced into N2a cells followed by rPRV-Anchor3-mCherry infection. The 3D live-cell imaging assay showed that a large number of the green fluorescence particles appeared in the N2a cells transduced with Lenti-UL42-sgRNA1/3 at 36 hpi. Only a few green fluorescence particles were observed in the N2a cells transduced with Lenti-UL9-sgRNA1/3 or Lenti-UL54-sgRNA1/3. Meanwhile, there was no fluorescence particle in the N2a cells co-transduced with Lenti-UL9-sgRNA1/3 and Lenti-UL54-sgRNA1/3. However, both green and red fluorescence signals were abundant in the N2a cells transduced with Lenti-CRISPR-V2 (Figure 8A). The red (mCherry) and green (EGFP) fluorescence intensities in the Lenti-CRISPR-V2-transduced N2a cells were significantly higher than those of the other groups (Figure 8B). The mRNA levels of IE180, EP0 and gB in the N2a cells transduced with Lenti-CRISPR-V2 were the highest among all groups. Meanwhile, the mRNA levels of the four genes in the N2a cells co-transduced with the Lenti-UL9-sgRNA1/3 and Lenti-UL54-sgRNA1/3 were the lowest (Figure 8C).

To detect whether sgRNAs can inhibit the expression of its target genes, each sgRNA expression plasmid was co-transfected with its target gene expression plasmid into the HEK293T cells. The UL42, UL9, and UL54 proteins were identified at 36 hpt through western blotting. Based on the relative levels of each protein compared to GAPDH, UL42-sgRNA1/2/3 (Figure 8D), UL9-sgRNA1/2/3 (Figure 8E), and UL54-sgRNA1/2/3 (Figure 8F) can reduce the target gene expression obviously. Thus, sgRNA1 and sgRNA3 for each gene were utilized to prevent the reactivation of rPRV-Anchor3-mCherry. The gB protein of rPRV-Anchor3-mCherry in all the lentivirus-transduced N2a cells shown in Fig. 8A was analyzed using western blotting. The protein levels of gB in the Lent-UL42-sgRNA-1/3, Lent-UL9-sgRNA-1/3, and Lent-UL54-sgRNA-1/3 were lower than the control. No gB protein was detected in the Lent-UL9-sgRNA-1/3- and Lent-UL54-sgRNA-1/3- co-transduced N2a cells.

In summary, CRISPR-Cas9 technology has proven to be effective in editing the PRV genome. Double-sgRNA targeting of UL42, UL9, or UL54 genes can decrease rPRV-Anchor3-mCherry replication in the N2a cells. The sgRNA targeting UL9 and UL54 genes simultaneously prevent the replication of rPRV-Anchor3-mCherry completely.

Swine are the natural host and reservoir of PRV [36]. After infection via the oral and nasal routes, PRV replicates in the upper respiratory tract and subsequently targets sensory neurons, invading the nervous system to establish latent infection ༻37༽. Additionally, it is reported that PRV infect various other mammals, including cats, dogs, cattle, and other mammals, leading to neurological signs and deaths ༻38༽. Since 2018, the cases of PRV infections in humans have increased, indicating the emergence of a new zoonotic virus threat to human health ༻4༽. Furthermore, PRV is also widely applied as a powerful tool for the study of alphaherpesviruses ༻39, 40༽.

In this study, a dual-fluorescence-labeled rPRV-Anchor3-mCherry was successfully constructed. It was the initial use of the Anchor3 DNA labeling system for tracking the PRV genome. The green fluorescence-labeled viral genome and red fluorescence-labeled envelope protein were enough for live-cell imaging and real-time quantitative analysis of PRV infection in N2a cells. No additional supplement of the fluorescence materials and experiments are required. This approach simplifies the experimental process, reduces experimental costs, and eliminates external condition-related impacts on the physiological state of cells, thereby avoiding interference with the investigation of virus infection mechanisms as other reports [49, 41–44] .

Single-particle tracking allows the visualization of molecular events in real time, such as virus entry, un-coating, and virus-host interactions [42, 45]. We found that PRV can invade N2a cells through two pathways: endocytosis and plasma membrane fusion. It has been reported that alpha herpesviruses only invade primary neurons via plasma membrane fusion ༻46༽, and PRV invades HeLa and Vero cells via endocytosis and plasma membrane fusion ༻33༽. Therefore, we speculate that N2a cells may retain the biological properties of primary neurons while having the advantage of immortalized cell lines. In addition, we should also consider the importance of research strategies and tools in exploring PRV invasion patterns. This study employed a combination of single virus tracking technology, 3D live-cell imaging technology, and electron microscopy, which collectively maximized the acquisition of crucial information.

So far, the PRV replication cycle is not fully understood due to technical limitations. We clarified that the complete PRV replication cycle is around 12.5 hours in N2a cells. It has been reported that the budding time of PRV on hippocampal neurons and chicken dorsal root ganglia is at 14–16 and 10–13 hpi, respectively [47–49]. The viral replication cycle obtained in this study is within a reasonable time range, and more accurate.

Recombinant PRV with fluorescently marked VP26 protein has been extensively utilized for tracing viral replication. In this research, the viral particles of rPRV-VP26-EGFP and rPRV-Anchor3-mCherry were observed before to their entering into the nucleus at 1 hpi, and disappeared within the nucleus at 2.5 hpi during the viral genome replication. We observed some interesting phenomena. Firstly, the de novo VP26-EGFP protein was expressed earlier than the OR-EGFP, as it was observed at 2.5 hpi and 5 hpi, respectively. Secondly, the de novo VP26-EGFP formed particles smaller than the mature nucleocapsid in the cytoplasm. They remained outside the nucleus at 2.5 hpi until they received a signal to enter the cell as shown in Fig. 6D. Additionally, the mean green fluorescence intensity for rPRV-Anchor3-mCherry was lower than that of rPRV-VP26-EGFP. Meanwhile, the green fluorescence particles of rPRV-Anchor3-mCherry were smaller than those of rPRV-VP26-EGFP within the nucleus. The quantum dot labeling method can track the PRV genome in live cells, but is unable to track the progeny virions [33]. The Anchor3 labeling method can track not only the viral genome of parental and progeny PRV, but also the viral genome during latent infection. The Anchor3 labeling method will be more extensively used than other methods in the future.

We identified that viral DNA was distributed on the inner side of the nucleus membrane in the PRV-infected cells at 24 hpi using IFA, while the DNA disappeared at 48 hpi. 3D live-cell imaging also showed no green fluorescent marked viral genome in the cells at 48 hpi. This indicated that the viral genome was released through the broken nucleus membrane. Moreover, the cell nuclei staining with Hoechst was homogeneous at the early stage of infection as shown in Fig. 6. However, the viral genome or the packaged viral nucleocapsid occupied the space of the nucleus after the viral genome replication. The Hoechst staining nuclear substances, viral genome and nucleocapsid distributed in different spaces within the nucleus as showed in 2D and 3D images of Figs. 6 and 7. Additionally, no green particles were observed in the N2a cells infected with rPRV-Anchor3-mCherry (Fig. 7A) and rPRV-Anchor3 (Fig. 7E) at 48 hpi. However, viral DNA was still detected in the N2a cells infected with WT-PRV (Fig. 7E) at 48 hpi. It seems that OR3-EGFP protein is insufficient in marking all the viral genome during the later stages of infection. These findings suggest that the viral replication results in rearrangements of nuclear material and the death of host cells, as described previously [50] .

The CRISPR-Cas9 technology has been widely used in research on PRV [51–53]. We identified the UL9, UL42, and UL54 genes as potential targets to inhibit PRV replication and confirmed that silencing both the UL9 and UL54 genes using CRISPR-Cas9 technology can complete inhibit PRV replication.

This study describes the first application of the Anchor3 DNA labeling system in generating recombinant PRV. Firstly, based on the recombinant viruses and live-cell imaging technology, this study indicated that PRV could invade N2a cells via two pathways: endocytosis and plasma membrane fusion. Secondly, this study confirmed both parental and progeny viral genome can be indicated using Anchor3 system. Furthermore, our research strategy can also be applicable to other DNA viruses.

Acknowledgements

We acknowledge all the members of the imaging platform and the cryo-electron microscopy platform from the State Key Laboratory for Animal Disease Control and Prevention, Chinese Academy of Agricultural Sciences, Harbin, China for the imaging facility, training and technical assistance. We thank Dr. Yong-Bo Yang, Prof. Xin Yin, and Dr. Rong Wang for generously providing reagents and valuable advice. We thank Ms. Xiao-Ying Deng for providing generous support for experiment assistance.

Authors’ contributions

WHX LMZ and PL performed most of the experiments in the manuscript, and WHX and PL wrote the article. SY and QHJ corrected the manuscript and designed the study. KF provided key material. All the authors have read and approved the fnal manuscript.

Funding

The work was supported by the Natural Science Foundation of Heilongjiang Province of China (Grant no. JQ2022C007), and the Central Public-interest Scientific Institution Basal Research Fund (Grant no. 1610302022004).

Competing interests

The authors declare that they have no competing interests.

Wang G, Zha Z, Huang P, Sun H, Huang Y, He M, Chen T, Lin L, Chen Z, Kong Z, Que Y, Li T, Gu Y, Yu H, Zhang J, Zheng Q, Chen Y, Li S, Xia N (2022) Structures of pseudorabies virus capsids. Nat Commun 13: 1533
Wang H, Zeng L, Li W, Wang S (2022) Teaching neuroImage: human encephalitis caused by pseudorabies virus infection. Neurology 99: 311–312
Liu Q, Wang X, Xie C, Ding S, Yang H, Guo S, Li J, Qin L, Ban F, Wang D, Wang C, Feng L, Ma H, Wu B, Zhang L, Dong C, Xing L, Zhang J, Chen H, Yan R, Wang X, Li W (2021) A novel human acute encephalitis caused by pseudorabies virus variant strain. Clin Infect Dis 73: e3690-e3700
Ai JW, Weng SS, Cheng Q, Cui P, Li YJ, Wu HL, Zhu YM, Xu B, Zhang WH (2018) Human endophthalmitis caused by pseudorabies virus infection, China, 2017. Emerg Infect Dis 24: 1087–1090
Gong D, Kim YH, Xiao Y, Du Y, Xie Y, Lee KK, Feng J, Farhat N, Zhao D, Shu S, Dai X, Chanda SK, Rana TM, Krogan NJ, Sun R, Wu TT (2016) A herpesvirus protein selectively inhibits cellular mRNA nuclear export. Cell Host Microbe 20: 642–653
Lu JJ, Yuan WZ, Zhu YP, Hou SH, Wang XJ (2021) Latent pseudorabies virus infection in medulla oblongata from quarantined pigs. Transbound Emerg Dis 68: 543–551
Zhao X, Tong W, Song X, Jia R, Li L, Zou Y, He C, Liang X, Lv C, Jing B, Lin J, Yin L, Ye Gang, Yue G, Wang Y, Yin Z (2018) Antiviral effect of resveratrol in piglets infected with virulent pseudorabies virus. Viruses 10: 457
Hinsberger A, Graillot B, Blachère LC, Juliant S, Cerutti M, King LA, Possee RD, Gallardo F, Lopez FM (2020) Tracing baculovirus AcMNPV infection using a real-time method based on ANCHOR(TM) DNA labeling technology. Viruses 12: 50
Li S, Zhao Y, Zhao Z, Wu X, Sun L, Liu Q, Wu Y (2016) Crystal structure of the GRAS domain of SCARECROW-LIKE7 in oryza sativa. Plant Cell 28: 1025–1034
Wang Z, Wong DCJ, Wang Y, Xu G, Ren C, Liu Y, Kuang Y, Fan P, Li S, Xin H. Liang Z (2021) GRAS-domain transcription factor PAT1 regulates jasmonic acid biosynthesis in grape cold stress response. Plant Physiol 186: 1660–1678
Gallardo F, Schmitt D, Brandely R, Brua C, Silvestre N, Findeli A, Johann F, Top S, Kappler-Gratias S, Quentin-Froignant C, Renaud M, Lagarde JM, Bystricky K, Bertagnoli S, Erbs P (2020) Fluorescent tagged vaccinia virus genome allows rapid and efficient measurement of oncolytic potential and discovery of oncolytic modulators. Biomedicines 8: 543
Mariame B, Kappler-Gratias S, Kappler M, Balor S, Gallardo F, Bystricky K (2018) Real-time visualization and quantification of human cytomegalovirus replication in living cells using the ANCHOR DNA labeling technology. J Virol 92: e00571-18
Komatsu T, Quentin-Froignant C, Carlon-Andres I, Lagadec F, Rayne F, Ragues J, Kehlenbach RH, Zhang WL, Ehrhardt A, Bystricky K, Morin R, Lagarde JM, Gallardo F, Wodrich H (2018) In vivo labelling of adenovirus DNA identifies chromatin anchoring and biphasic genome replication. J Virol 92: e00795-18
Tang YD, Liu JT, Wang TY, An TQ, Sun MX, Wang SJ, Fang QQ, Hou LL, Tian ZJ, Cai XH (2016) Live attenuated pseudorabies virus developed using the CRISPR/Cas9 system. Virus Res 225: 33–39
Van Diemen FR, Kruse EM, Hooykaas MJ, Bruggeling CE, Schurch AC, van Ham PM, Imhof SM, Nijhuis M, Wiertz EJ, Jan Lebbink R (2016) CRISPR/Cas9-mediated genome editing of herpesviruses limits productive and latent infections. PLoS Pathog 12: e1005701
Denes CE, Everett RD, Diefenbach RJ (2020) Tour de herpes: cycling through the life and biology of HSV-1. Methods Mol Biol 2060: 1–30
Wang Y, Huang L, Du W, Wei Y, Wu H, Feng L, Liu C (2016) Targeting the pseudorabies virus DNA polymerase processivity factor UL42 by RNA interference efficiently inhibits viral replication. Antiviral Res 132: 219–224
Pan L, Li M, Zhang X, Xia Y, Mian AM, Wu H, Sun Y, Qiu HJ (2023) Establishment of an in vitro model of pseudorabies virus latency and reactivation and identification of key viral latency-associated genes. Viruses 15: 808
Tremblay, R, Marianna S, Jagdeep K, Patricia L, Maria R, Mahmud B (2010) Differentiation of mouse Neuro 2a cells into dopamine neurons. J Neurosci Methods 186: 60–67
Luo Y, Li N, Cong X, Wang C, Du M, Li L, Zhao B, Yuan J, Liu D, Li S, Li Y, Sun Y, Qiu HJ (2014) Pathogenicity and genomic characterization of a pseudorabies virus variant isolated from bartha-K61-vaccinated swine population in China. Vet Microbiol 174: 107–115
Zhou M, Abid M, Yin H, Wu H, Teklue T, Qiu HJ, Sun Y (2018) Establishment of an efficient and flexible genetic manipulation platform based on a fosmid library for rapid generation of recombinant pseudorabies virus. Front Microbiol 9: 2132
Qi H, Wu H, Abid M, Qiu HJ, Sun Y (2020) Establishment of a fosmid library for pseudorabies virus SC strain and application in viral neuronal tracing. Front Microbiol 11: 1168
Meng X, Luo Y, Liu Y, Shao L, Sun Y, Li Y, Li S, Ji S, Qiu HJ (2016) A triplex real-time PCR for differential detection of classical, variant and bartha-K61 vaccine strains of pseudorabies virus. Arch Virol 161: 2425–2430
Wilcox CL, Smith RL (1998) HSV latency in vitro: In situ hybridization methods. Methods Mol Med 10: 317–326
Hoffmann RF, Moshkin YM, Mouton S, Grzeschik NA, Kalicharan RD, Kuipers J, Wolters AH, Nishida K, Romashchenko AV, Postberg J, Lipps H, Berezikov, E, Sibon OC, Giepmans BN, Lansdorp PM (2016) Guanine quadruplex structures localize to heterochromatin. Nucleic Acids Res 44: 152–163
Liu A, Zhang Z, Sun E, Zheng Z, Zhang Z, Hu Q, Wang H, Pang D (2016) Simultaneous visualization of parental and progeny viruses by a capsid-specific HaloTag labeling strategy. ACS Nano 10: 1147–1155
Liu S, Wang Z, Xie H, Liu A, Lamb D, Pang D (2020) Single-virus tracking: from imaging methodologies to virological applications. Chem Rev 120: 1936–1979
Sanjana NE, Shalem O, Zhang F (2014) Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods 11: 783–784
Muhammad A, Teklue T, Li Y, Wu H, Wang T, Qiu HJ, Sun Y (2019) Generation and immunogenicity of a recombinant pseudorabies virus co-expressing classical swine fever virus E2 protein and porcine circovirus type 2 capsid protein based on fosmid library platform. Pathogens 8: 279.
Klupp BG, Nixdorf R, Mettenleiter TC (2000) Pseudorabies virus glycoprotein M inhibits membrane fusion. J Virol 74: 6760–6768
Hogue IB, Bosse JB, Hu JR, Thiberge SY, Enquist LW (2014) Cellular mechanisms of alpha herpesvirus egress: live cell fluorescence microscopy of pseudorabies virus exocytosis. PLoS Pathog 10: e1004535
Liu SL, Wu QM, Zhang LJ, Wang ZG, Sun EZ, Zhang ZL, Pang DW (2014) Three-dimensional tracking of Rab5- and Rab7-associated infection process of influenza virus. Small 10: 4746–4753
Yang Y, Tang Y, Hu Y, Yu F, Xiong J, Sun M, Lyu C, Peng J, Tian Z, Cai X, An T (2020) Single virus tracking with quantum dots packaged into enveloped viruses using CRISPR. Nano Lett 20: 2931
Raab M, Gentili M, de Belly H, Thiam HR, Vargas P, Jimenez AJ, Lautenschlaeger F, Voituriez R, Lennon-Duménil AM, Manel N, Piel M (2016) ESCRT III repairs nuclear envelope ruptures during cell migration to limit DNA damage and cell death. Science 352: 359–362
Reilly A, Philip Creamer J, Stewart S, Stolla MC, Wang Y, Du J, Wellington R, Busch S, Estey EH, Becker PS, Fang M, Keel SB, Abkowitz JL, Soma LA, Ma J, Duan Z, Doulatov S (2022) Lamin B1 deletion in myeloid neoplasms causes nuclear anomaly and altered hematopoietic stem cell function. Cell Stem Cell 29: 577–592
Freuling CM, Muller TF, Mettenleiter TC (2017) Vaccines against pseudorabies Virus (PRV). Vet Microbiol 206: 3–9
Nawynck HJ, Pensaert MB (1995) Cell-free and cell-associated viremia in pigs after oronasal infection with Aujeszky's disease virus. Vet Microbiol 43: 307–314
Skinner GRB, Ahmad A, Davies JA (2001) The infrequency of transmission of herpesviruses between humans and animals; postulation of an unrecognized protective host mechanism. Comp Immunol Microb 24: 255–269
Ma Z, Bai J, Jiang C, Zhu H, Liu D, Pan M, Wang X, Pi J, Jiang P, Liu X (2022) Tegument protein UL21 of alpha-herpesvirus inhibits the innate immunity by triggering CGAS degradation through TOLLIP-mediated selective autophagy. Autophagy 19: 1512–1532
Lee BH, Tebaldi G, Pritchard SM, Nicola AV (2022) Host cell neddylation facilitates alphaherpesvirus entry in a virus-specific and cell-dependent manner. Microbiol Spectr 10: e0311422
Lv C, Lin Y, Sun E, Tang B, Ao J, Wang J, Zhang Z, Zheng Z, Wang H, Pang D (2018) Internalization of the pseudorabies virus via macropinocytosis analyzed by quantum dot-based single-virus tracking. Chem Commun (Camb) 54: 11184–11187
Yin W, Li W, Li Q, Liu Y, Liu J, Ren M, Ma Y, Zhang Z, Zhang X, Wu Y, Jiang S, Zhang XW, Cui Z (2020) Real-time imaging of individual virion-triggered cortical actin dynamics for human immunodeficiency virus entry into resting CD4 T cells. Nanoscale 12: 115–129
Lv C, Lin Y, Liu A, Hong Z, Wen L, Zhang Z, Zhang Z, Wang H, Pang D (2016) Labeling viral envelope lipids with quantum dots by harnessing the biotinylated lipid-self-inserted cellular membrane. Biomaterials 106: 69–77
Fu P, Cheng X, Su B, Duan L, Wang C, Niu X, Wang J, Yang G, Chu B (2021) CRISPR/Cas9-based generation of a recombinant double-reporter pseudorabies virus and its characterization in vitro and in vivo. Vet Res 52: 95
Chin CR, Perreira JM, Savidis G, Portmann JM, Aker AM, Feeley EM, Smith MC, Brass A (2015) Direct visualization of HIV-1 replication intermediates shows that capsid and CPSF6 modulate HIV-1 intra-nuclear invasion and integration. Cell Rep 13: 1717–1731
Chowdary TK, Cairns TM, Atanasiu D, Cohen GH, Eisenberg RJ, Heldwein EE (2010) Crystal structure of the conserved herpesvirus fusion regulator complex gH-gL. Nat Struct Mol Biol 17: 882–888
Daniel GR, Sollars PJ, Pickard GE, Smith GA (2015) Pseudorabies virus fast axonal transport occurs by a pUS9-independent mechanism. J Virol 89: 8088–8091
Kratchmarov R, Enquist LW, Taylor MP (2015) Us9-independent axonal sorting and transport of the pseudorabies virus glycoprotein gM. J Virol 89: 6511–6514
Liu Y, Shivakoti S, Jia F, Tao C, Zhang B, Xu F, Lau P, Bi G, Zhou Z (2020) Biphasic exocytosis of herpesvirus from hippocampal neurons and mechanistic implication to membrane fusion. Cell Discov 6: 2
Tang D, Comish P, Kang R (2020) The hallmarks of COVID-19 disease. PLoS Pathog 16: e1008536
Wang J, Yuan S, Zhu D, Tang H, Wang N, Chen W, Gao Q, Li Y, Wang J Liu H, Zhang X, Rao Z, Wang X (2018) Structure of the herpes simplex virus type 2 capsid with capsid-vertex-specific component. Nat Commun 9: 3668
Yin C, Zhang T, Qu X, Zhang Y, Putatunda R, Xiao X, Li F, Xiao W, Zhao H, Dai S, Qin X, Mo X, Young WB, Khalili K, Hu W (2017) In vivo excision of HIV-1 provirus by saCas9 and multiplex single-guide RNAs in animal models. Mol Ther 25: 1168–1186
Hu W, Kaminski R, Yang F, Zhang Y, Cosentino L, Li F, Luo B, Alvarez-Carbonell D, Garcia-Mesa, Y, Karn J, Mo X, Khalili K (2014) RNA-directed gene editing specifically eradicates latent and prevents new HIV-1 infection. Proc Natl Acad Sci U S A 111: 11461–11466

Table 1. PCR primers used for constructing the recombinant pseudorabies virus.

Primers	Sequences (5¢-3¢)	Targets
US9-rpsl-F	TCTGCTCGCTGTCCGCGCTACTCGGGGGCATCGTCGCCAGGCACGTGTAGGGCCTGGTGATGATGGCGGGATC	US9-rpsl
US9-rpsl-R	GGGCGCGGCGGATGGGGGCGGGCCCCCGCTCCCGTTCGCTCGCTCGCTCGTCAGAAGAACTCGTCAAGAAGGC	US9-rpsl
US9-left-arm-F	AGGACGACTCGGACTGCTACTA	US9-5¢UTR
US9-left-arm-R	AAGCTTCTACACGTGCCTGGCGA	US9-5¢UTR
US9-right-arm-F	CGAGCGAGCGAGCGAACGGGAGC	US9-3¢UTR
US9-right-arm-R	GAAGGCTGCTGTGTGCGCCCGGA	US9-3¢UTR
UL10-rpsl-F	CGGCGAGAGACGGACACGAGAGGACCATGTGCGATCGAAACGAACGTTTAGGCCTGGTGATGATGGCGGGATC	UL10-rpsl
UL10-rpsl-R	ACGAGTTTGACGACGGCGACGAGGTCGTGTACGAGAACCTCGGCTTTGAATCAGAAGAACTCGTCAAGAAGGC	UL10-rpsl
UL10-mCherry-F	CGGCGAGAGACGGACACGAGAGGACCATGTGCGATCGAAACGAACGTTTACTTGTACAGCTCGTCCATGCCG	mCherry
UL10-mCherry-R	ACGAGTTTGACGACGGCGACGAGGTCGTGTACGAGAACCTCGGCTTTGAATCCGCCATGGTGAGCAAGGGCGAGGAGGA	mCherry

Table 2. Primers used for PCR and qPCR.

Primers	Sequences (5¢-3¢)	Targets
US9-JC-F1 (PCR)	GGCGTGACCGCCAACCGCCTGTTGATGTCC	US9
US9-JC-R1 (PCR)	ACCATCGACGCGTAGCACCACTCGGTGAGC	US9
UL10-JC-F1 (PCR)	GGTGTGAGACGATGGCCGAGGA	UL10
UL10-JC-R1 (PCR)	TGGTCCGCGCCTGCATCGCCCACCGCGCCCGGGG	UL10
IE180-F (qPCR)	CTGGCAGAACTGGTTGAAGC	IE180
IE180-R (qPCR)	TCGTGCGCCTCATCTACAG	IE180
EP0-F (qPCR)	TGCGCCGATATGTCAAACAG	EP0
EP0-R (qPCR)	TCGTGGACAACATCGTCGAG	EP0
gB-F (qPCR)	TCCTCGACGATGCAGTTGAC	gB
gB-R (qPCR)	ACCAACGACACCTACACCAAG	gB
LAT-F (qPCR)	ACGTGACGTTTTTGCCGATG	LAT
LAT-R (qPCR)	GCGCGATATGCAGATGAGATC	LAT

Table 3. The sgRNAs against target genes.

Primers	Sequences (5¢-3¢)
UL9-sgRNA1	CACCGCCATCGGAGCGCGCGCCACG
	AAACCGTGGCGCGCGCTCCGATGGC
UL9-sgRNA2	CACCGGAAATGGCTCTCCGCGGCGC
	AAACGCGCCGCGGAGAGCCATTTCC
UL9-sgRNA3	CACCGCGTCCATGACGAGGACCCGC
	AAACGCGGGTCCTCGTCATGGACGC
UL9-sgRNA4	CACCGCACGATCAACGCGCAGCTCG
	AAACCGAGCTGCGCGTTGATCGTGC
UL42-sgRNA1	CACCGTCCACACGAACGTGCTGAAC
	AAACGTTCAGCACGTTCGTGTGGAC
UL42-sgRNA2	CACCGGTGTTCCTGGGCAACGTCGA
	AAACTCGACGTTGCCCAGGAACACC
UL42-sgRNA3	CACCGCGCTGCCGTCGACGTTGCCC
	AAACGGGCAACGTCGACGGCAGCGC
UL42-sgRNA4	CACCGCGCTCAAGGTCGACCGGCGG
	AAACCCGCCGGTCGACCTTGAGCGC
UL54-sgRNA1	CACCGCGTGCGGCCGCACCTCAAAC
	AAACGTTTGAGGTGCGGCCGCACGC
UL54-sgRNA2	CACCGGGCGCGCGTGCTCCGCGAGA
	AAACTCTCGCGGAGCACGCGCGCCC
UL54-sgRNA3	CACCGGCGCCCAGGCGCTCGCGGAC
	AAACGTCCGCGAGCGCCTGGGCGCC
UL54-sgRNA4	CACCGAGCGGCCGCCCGTCCGGGCG
	AAACCGCCCGGACGGGCGGCCGCTC

Dual-fluorescence labeling of pseudorabies virus for live-cell tracking virus entry and replication

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Results

Discussion

Declarations

References

Tables

Status:

Version 1