Development and characterization of a DNA-launched Getah virus infectious clone

doi:10.21203/rs.3.rs-4984399/v1

Download PDF

Research Article

Development and characterization of a DNA-launched Getah virus infectious clone

https://doi.org/10.21203/rs.3.rs-4984399/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Getah virus (GETV), a neglected and re-emerging mosquito-borne alphavirus, has becoming more serious and posing a potential threat to animal safety and public health. As there is a lack of antivirals and vaccines against GETV, it is necessary to continue the development of tools to further advance our efforts to combat these pathogens, including reverse genetics techniques. Herein, we describe the design and construction of a DNA-launched infectious clone for GETV. The full-length genome of GETV HuN1 strain, flanked by cytomegalovirus immediate-early (CMV) promoter sequence at the 5'-end and the hepatitis delta virus ribozyme along with the bovine growth hormone termination and polyadenylation signal sequences at the 3'-end, was packaged in bacterial artificial chromosome vector to establish a GETV infectious clone pBR322-GETV-HuN1. In parallel, the recombinant reporter viruses carrying the reporter gene EGFP between the E1 gene and the 3' UTR was constructed based on the established CMV-driven cDNA clone. Both in vivo and in vitro experiments have shown that the rescued recombinant virus possesses viral biological activity similar to the parental virus. Taken together, this study develops a concise and efficient GETV infectious cDNA clone and a recombinant virus carrying an EGFP reporter gene. The availability of the GETV infectious clone will facilitate further studies on understanding the molecular mechanisms of GETV virus biology, virulence determinants, molecular pathogenesis, vaccine development and virus-host interaction.

Getah virus

Reverse Genetics System

Infectious clone

Reporter virus.

Alphaviruses transmitted by arthropods are rapidly emerging and re-emerging human pathogens and continue to pose a global threat. Alphavirus can cause serious diseases in animals and humans, especially current epidemic strains revealed increased virulence caused by genetic mutations. Getah virus (GETV) is a member of the genus Alphavirus in the family Togaviridae and is an arthropod-borne virus. It was first isolated from naturally infected mosquitoes in Cambodia in 1966[1]. Currently, Getah virus is distributed worldwide, with reports of virus isolation and animal outbreaks from regions including Australia, Malaysia, Thailand, China, Japan, and Sri Lanka[2–7]. In recent years, incidents of GETV infections have occurred successively across various regions of China[8–11], causing significant losses to the livestock industry. As a member of the genus Alphavirus, Getah virus has a broad host range, capable of infecting horses, pigs, foxes, and cattle[7, 12–14]. Clinical features of Getah virus-infected horses include depression, anorexia, fever, limb swelling, and lymphocyte reduction[13, 15, 16]. Additionally, Getah virus infection in pigs can lead to reproductive disorders in sows, such as mummified or stillborn piglets, as well as diarrhea and death in piglets[17, 18]. The lack of vaccines or antiviral measures is a major obstacle to the treatment of future epidemics. It is important to carefully monitor GETV evolution to prevent further public health issues.

Like typical alphaviruses, GETV has a typical alphavirus structure: a single-stranded RNA genome at the center of the viral particle, surrounded by a capsid protein, enveloped by a lipid membrane, and an outer glycoprotein shell composed of E1 and E2 glycoproteins[19–24]. The genome is approximately 11.7 kb in length, with a 5' methylated cap structure and a 3' poly(A) tail. The genome contains two open reading frames (ORFs), which encode four non-structural proteins (nsP1, nsP2, nsP3, and nsP4) and five structural proteins (Cap, E3, E2, 6K, and E1). The GETV virus particles are spherical, approximately 70 nm in diameter, and are enveloped with spikes on the surface[25].

The increasing emergence of GETV poses a serious threat to animal health and public health. However, the etiology and viral determinants of GETV pathogenesis are limited. Reverse genetics system offers powerful tool for the research of RNA viruses. It has been used to decipher the biological properties of viruses and infectious full-length cDNA clones have been established for several RNA viruses[26]. Bacterial artificial chromosomes, which keep only one or two copies in a bacterium and enable the stable of 300 kb inserts, was used as backbone to enhance the stability of the infectious cDNA clones[27]. pBR322 is an important artificial plasmid known as a universal vector, which constructed through a complex recombination process involving three parental plasmids: pSF2124, pMB1, and pSC101[28]. It is commonly used to achieve virus rescue by either transfecting in vitro-transcribed RNA or transfecting cDNA constructs into susceptible cells, while a chimeric intron with accompanied hammerhead ribozyme (HamRz) sequences were introduced at the beginning of viral genome to enhance the stability of the infectious clone. At present, the Alphavirus genus, such as Chikungunya virus [29], Sindbis virus[30], Mayaro virus[31], and Venezuelan equine encephalitis virus[32], have successfully utilized reverse genetics to establish infectious full-length cDNA clones. In this study, we report the establishment of a full-length infectious cDNA clone based on the isolated GETV HuN1 strain. Using the established CMV-driven cDNA clone, a carrying the EGFP recombinant reporter viruses was also constructed for high-throughput drug screening in the future. This potential of the DNA-launched GETV will be useful for establishing the molecular basis of replication, assembly, and pathogenesis, evaluating potential antiviral drugs, and as a vaccine platform for the development of DNA-based recombinant GETV vaccines.

2.1 Cell, virus, plasmids and reagents

pBR322 plasmid (D2301), trypsin were purchased from Beyotime Biotechnology; porcine-derived Getah virus strain HeN202009-2 (MZ736801.1) was isolated, identified, and stored in Anhui Animal Disease Prevention and Control Center; E. coli DH5α receptor cells, FastPfu DNA Polymerase, PBS and DMEM medium were purchased from TransGen Biotech; fetal bovine serum were purchased from ExCell Bio; restriction endonucleases Xho I, EcoR I, Bgl II and Hind III were purchased from Takara; TIANamp Virus DNA/RNA Kit, Endotoxin-free Plasmid Extraction Kit were purchased from TIANGEN; Hifair V Reverse Transcriptase was purchased from Yeasen; Lipofectamine 3000 was purchased from ThermoFisher; 2.5% glutaraldehyde electron microscope fixative was purchased from Solarbio; recombinant plasmids pCDNA3.1-3×Flag and pEGFP-N1 vector, Baby Hamster Kidney 21 (BHK-21) and GETV E2 protein polyclonal antibodies were prepared and stored in our laboratory.

2.2 The strategy of Construction of full-length cDNA cloning plasmid

The genome sequence of GETV HuN1 strain virus is divided into 8 segments for protein expression. CMV promoter and bGH poly(A) tail nucleotide sequences are cloned from the pCDNA3.1(+) plasmid. These sequences are then cloned respectively into the 5'UTR and 3'UTR of the GETV gene sequence using overlap PCR. The sequence of Hepatitis Delta Virus Ribozyme was artificially synthesized, and then connected to the 3'UTR end of the GETV gene sequence using overlap PCR. The recombinant segments containing CMV promoter, bGH poly(A) tail, and HdvRz were divided into four long segments labeled as A, B, C, and D using overlap PCR or homologous recombination. These segments were sequentially cloned into the pBR322 vector to obtain a recombinant plasmid containing the full-length cDNA clone of the GETV genome, named pBR322-GETV-HuN1. The construction strategy is illustrated in Fig. 1A. Based on the GETV infectious clone, a 44bp subgenomic promoter was inserted at the 11288 nt position of the viral genome as a molecular marker for the rescued virus. An enhanced green fluorescent protein (EGFP) sequence was inserted after the molecularly marked rescued virus sequence as a genetic marker gene. The resulting recombinant plasmid, containing the correct full-length GETV genome cDNA clone, was named pBR322-GETV-EGFP. The construction strategy is illustrated in Fig. 1B.

2.3 Virus Rescue

Two infectious clone plasmids were transfected into BHK-21 cells using Lipo3000 and the empty pBR322 plasmid was transfected as a negative control. Incubate at 37°C for 2 hours, discard the medium, replace it with 5% fresh maintenance medium, and continue culturing in a 37°C, 5% CO₂ incubator. When some cells exhibit cytopathic effects, collect the cells and supernatant for freeze-thaw cycles, centrifuge to obtain the supernatant, and inoculate it onto new BHK-21 cells. After 10 blind passages, perform identification. Take the supernatant of the modified GETV carrying the green fluorescent reporter gene after ten blind passages. Extract RNA and reverse transcribe it into cDNA, perform PCR amplification, gel extraction, and send it to a sequencing company for sequencing.

2.4 Detection of the rescued virus particles by electron microscopy

The rescued GETV virus and the GETV virus with the reporter gene were used to infect BHK-21 cell cultures. The cultures were centrifuged at 12000 rpm (4°C) for 30 minutes. Then, 20 µL of the supernatant was adsorbed onto a carbon-coated copper grid for 5 minutes, stained with 2% phosphotungstic acid (pH 6.5) for 1 minute, and observed under a transmission electron microscope after drying.

2.5 Detection of the rescued virus particles by Immunological Fluorescence Assay

Seed BHK-21 cells into a 12-well plate and incubate until reaching 80% confluence. Inoculate with collected rescued virus culture supernatant and incubate at 37°C for 2 hours. Remove the culture medium, replace with 5% fresh maintenance medium. When cells exhibit cytopathic effects, discard the medium and wash twice with PBS. Fix with 4% paraformaldehyde at room temperature for 30 minutes, then wash twice with PBS. Mix 0.2% Triton X-100 and 4% BSA in a 1:1 ratio for permeabilization and blocking for 30 minutes, followed by two PBS washes. Incubate with sheep anti-mouse secondary antibody labeled with Dylight594 at room temperature in the dark for 1 hour, followed by two PBS washes. Finally, stain the cell nuclei with DAPI, incubate at room temperature for 10 minutes, and wash twice with PBS. Observe fluorescence using a Leica laser confocal microscope and capture images.

2.6 Plaque Assay and One-Step Growth Curve Establishment

Prepare a 10-fold serial dilution by mixing 100 µL of virus solution with 900 µL of DMEM. Use 100 µL of each dilution to infect BHK-21 cells. After 2 hours of incubation, overlay the cell monolayer with 2 mL of DMEM containing 5% FBS and 1% low melting point agarose. The cells were cultured in a 37°C, 5% CO₂ incubator for 4 days. After removing the culture medium, cells were fixed with 4% paraformaldehyde for half an hour. Subsequently, they were stained with 1% neutral red staining solution for 12 hours, air-dried naturally, and counted for plaque numbers. Simultaneously, BHK-21 cells were seeded in 6 cm cell culture dishes and allowed to reach 80% confluence. Subsequently, cells were separately infected with GETV-HeN, pBR322-GETV-HuN1 and pBR322-GETV-EGFP. Virus-containing supernatants were collected at 4, 8, 12, 16, 20, and 24 hours post-infection, and viral titers (TCID₅₀) were determined. Growth curves were plotted based on these measurements.

2.7 Genetic stability analysis of rescued Getah viruses

To test the genetic stability of the recombinant viruses, the rescued viruses were continuously passaged for 10 generations (P10). The expression of the Cap protein in GETV-infected cells at passages P1, P3, P5 and P9 was verified by Western Blot. The expression of the green fluorescent protein in the GETV virus carrying the green fluorescent reporter gene at passages P2, P4, P6, P8, and P10 was observed using laser confocal microscopy.

2.8 Analysis of the pathogenicity of the rescued Getah virus in mice

The animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of Anhui Agricultural University. The animals used in the experiments conformed to the ARRIVE guidelines for the welfare and ethics of laboratory animals at Anhui Agricultural University (AHAUB2023100). Three-day-old ICR suckling mice were selected, and the control group and the experimental group were intracranially inoculated with DMEM medium and GETV infectious clone respectively. After virus inoculation, the condition of the suckling mice was observed daily at a fixed time, and their body weight was recorded regularly. After 84 hours of infection, the suckling mice were dissected, and any deaths during the infection period were recorded and dissected immediately. After dissection, organs from the deceased mice and the control group mice were collected in EP tubes. RNA was extracted from the various tissues and organs of the suckling mice, reverse transcribed into cDNA, and the viral load in the tissues and organs was detected using quantitative PCR (qPCR).

2.9 Histopathological examination of the mice infected with rescued Getah viruses

Pathological sections were prepared from tissues with significant clinical lesions and high viral loads, including heart, lung, brain and intestine. Tissues were fixed in 4% paraformaldehyde followed by gradient dehydration. The dehydrated tissue samples were then placed in a wax infiltration medium and embedded in paraffin blocks. After embedding, the tissues were sectioned, deparaffinised and stained with haematoxylin-eosin (HE).

2.10 Statistical analysis

Data are represented as mean ± standard error of the mean (SEM) (standard deviation [SD]). Statistical analyses were performed with GraphPad Prism 8 software using two-way ANOVA followed by Bonferroni post hoc test or unpaired Student t-test. Statistically significant and very significant results were defined as P < 0.05 and P < 0.01.

3.1 Construction of a full-length infectious clone of Getah Virus and a clone with a Genetic Marker

To facilitate the study of GETV HuN1, we divided the entire genome of the GETV HuN1 strain into eight fragments and cloned into the pBR322 vector, as described in the Methods section and shown in Fig. 1A. The DNA-launched infectious clone contains a CMV promoter at the 5' end of the viral genome, the full-length genome sequence of the GETV HuN1 strain, a 25-nucleotide poly(A) tail at the 3' end of the genome, followed sequentially by the HdvRz sequence and the bGH signal sequence. The strategy for constructing the EGFP-containing infectious clone as shown in Fig. 1B. Sequence analysis of both the full-length infectious clone and the EGFP-containing infectious clone revealed no base mutations compared to the GETV HuN1 strain. In addition, the sequencing results showed that the genes of SG promoter and EGFP were successfully inserted into the middle of the E1 and 3'UTR sequences (Fig. 2). The sequences of the PCR primers used for each fragment are shown in Table 1.

Table 1

Sequence of the primers
Gene	Sequence(5’→3’)
cmv-(BamHI)-F-pcDNA3.1(+)3×FLAG	F:AGAGAATTCGATATCGGATCCGACATTGATTATTGACTAGTT
nsp2-(XhoI)-R-pcDNA3.1(+)3×FLAG	R:TTTAAACTTACCGGTCTCGAGGAATTCGTGGAAAGGTGGATTG
(NSP1-)nsp2-F	F:GAATTAACCTTCAGAGCCGGAGCCGGGGTTGTGGAAACACCCAG
NSP1(-nsp2)-R	R:CTGGGTGTTTCCACAACCCCGGCTCCGGCTCTGAAGGTTAATTC
(pcDNA3.1-3×FLAG-)NSP2-F	F:AGAGAATTCGATATCGGATCCGAATTCGCATACGAAGGACTCAAGATC
(pcDNA3.1-3×FLAG-)NSP3-R	R:TTTAAACTTACCGGTCTCGAGAGATCTGCTCGTTAGCATCTTGG
(pCAGGS-HA-EcoRI) BglI-NSP3-F	F:TTCCAGATTACGCTGAATTCAGATCTGCCTGTACGCCCTAG
SGp-C-E3(XhoI)-R(EcoRI-pCAGGS-HA)	R:GGTACCATCGATGAGCTCGAATTCCTCGAGCAGATCGTAGTAGCCC
(pCAGGS-HA-EcoRI-)E3-F	F:TTCCAGATTACGCTGAATTCCTCGAGGCCACGATGACGT
E3-3'UTR(-25A-HdvRz)-R	R:CTTCGGATGCCCAGGTCGGACCGCGAGGAGGTGGAGATGCCATGCCGACCCTTTTTTTTTTTTTTTTTTTTTTTTTGTAAAATATTAAAAAAACAAATTAG
(HdvRz-)BGH-F	F:CCGACCTGGGCATCCGAAGGAGGACGTCGTCCACTCGGATGGCTAAGGGAGAGGATCCCTGTGCCTTCTAGTTGCCAG
BGH(-pCAGGS-HA)-R	R:ACCATCGATGAGCTCGAATTCCCATAGAGCCCACCGCATCCCCA
(E1-SGp-)EGFP-F	F:CATCTAAAGACCACGTATTACAGACATCATGGTGAGCAAGGGCGAGGA
E1(-SGpromoter)-R	R:GTCTGTAATACGTGGTCTTTAGATGTAGTGTAATCCTGCATTTAGCGGCGCATAGTCACACACGT
(EGFP-)3'UTR-F	F:CCGGGAGGCTTGACTTAATGTATATATATAAGC
EGFP(-3'UTR)-R	R:CATTAAGTCAAGCCTCCCGGCTTGTACAGCTCGTCCATGCCGA
B-F	F:GACAGCTTATCATCGATAAGCTTGAATTCGCATACGAAGGACTCAAGAT
B-R	R:ATGCGTCCGGCGTAGAGGATCCCTCGAGAGATCTGCTCGTTAGCATCTTGG
C-F	F:TTCCAGATTACGCTGAATTCAGATCTGCCTGTACGCCCTAG
C-R	R:GGTACCATCGATGAGCTCGAATTCCTCGAGCAGATCGTAGTAGCCC
A-F	F:TGACAGCTTATCATCGATAAGCTTGAATTCGACATTGATTATTGA
A-R	R:GGATCTTGAGTCCTTCGTATGCGAATTCGTGGAAAGGTGGATTGATTA
D-F	F:GTGGACCGCCCGGGCTACTACGATCTGCTCGAGGCCACGATGACGTGTAACAAT
D-R	R:GCCACGATGCGTCCGGCGTAGAGGATCCCTCGAGCCATAGAGCCCACCGCATCC

3.2 Significant Cytopathic Effects and Observation of Viral Particles

It is showed that a typical cell damages such as rounded and shriveled, fusion and fallout, after transfecting the recombinant plasmid pBR322-GETV-HuN1 into BHK-21 cells for 20 hours. Subsequently, as the virus infected the cells and continuous passaging was performed, the onset of CPE was accelerated, and the cytopathic effects became more pronounced. In contrast, control group cells maintained normal morphology with clear outlines (Fig. 3A–B). Using transmission electron microscopy with negative staining, we observed viral particles of the infectious clones pBR322-GETV-HuN1 and pBR322-GETV-EGFP with an average diameter of around 70 nm (Fig. 3C and 3E). Subsequently, both infectious clones were employed to infect BHK-21 cells, and ultrathin sections were prepared for transmission electron microscopy (TEM) observation. Both types of virus particles were successfully visualized in the ultrathin sections (Fig. 3D and 3F). These results indicate that both infectious clones, generated through reverse genetics, exhibited cytopathic effects and displayed a biological structure comparable to that of the wild-type virus.

3.3 Generation and characterization of recombinant virus

To further substantiate the biological activity of constructed GETV rescue viruses, plaque assays and one-step growth curve analyses were performed. These rescued viruses were initially introduced into Vero cells and showed the formation of plaques (Fig. 4A). This result was subsequently replicated in BHK-21 cells (Fig. 4B). Finally, the recombinant plasmid carrying the EGFP gene was introduced into both cell types, resulting in the formation of plaques in both cases (Fig. 4C–D). To further investigate the growth characteristics of the rescued virus, BHK-21 cells were infected with the rescued virus pBR322-GETV-HuN1, pBR322-GETV-EGFP and the virus GETV-HeN at a multiplicity of infection (MOI) of 0.5. Cell culture supernatants were collected at different time points to determine their TCID₅₀ values, and growth curves for the rescued and parental viruses were plotted. The results showed that the rescued virus and the parental virus exhibit similar replication capability and growth characteristics (Fig. 4E-F). The results provide further confirmation of the biological activity of the infectious clone of Getah virus.

3.4 Detection of rescued Getah virus and gene-marked rescued Getah virus via IFA.

To further confirm the presence of the virus and quantify both infectious clones, BHK-21 cells were separately infected with two types of rescued viruses and the parental virus. Immunofluorescence assay (IFA) using GETV Cap protein polyclonal antibodies (polyclonal antibodies against GETV Cap were generated previously) showed specific reactivity in cells infected with both the parental virus and rescued viruses, showing distinct fluorescence signals. In contrast, the negative control group did not exhibit specific fluorescence reactions. The bright-field imaging also revealed that the cells in the virus-infected groups exhibited nuclear shrinkage and fragmentation, accompanied by a lack of intact cellular morphology, in stark contrast to the control group cells (Fig. 5). Our IFA results, corroborated the hypothesis that the constructed infectious clone of Getah virus was successfully rescued.

3.5 Rescued Getah viruses can be genetically stabilized and replicated

In order to ascertain whether the rescued Getah virus was capable of sustaining infection, we employed standard molecular biology techniques for assessment. The stable expression of the Cap protein in cells throughout viral replication was demonstrated by Western blot analysis (Fig. 6A). The number of rescued viruses expressing the green fluorescent protein (EGFP) was observed to increase with each passage of the virus carrying the EGFP reporter gene, as revealed by laser confocal microscope analysis (Fig. 6B). These findings suggest that the rescued viruses display consistent genetic attributes. The expression profile of Cap was detected by RT-qPCR. The results show that the amount of Cap protein mRNA increases and then stabilizes for both infectious clones, pBR22-GETV-HuN1 and pBR22-GETV-EGFP (Fig. 6C–D). Furthermore, the band intensity observed in the PCR also correlates with the RT-qPCR results (Fig. 6E). These results confirm that the infectious clone of Getah virus has strong infectivity and can stably express EGFP.

3.6 Pathogenicity of the rescued Getah viruses in mice

To examine the pathogenic effects and in vivo distribution of the virus, we performed intracranial injections of viral supernatant derived from BHK-21 cells into 3-day-old ICR suckling mice, administering 1 MOI of the viral solution per mouse. The control group received an equivalent volume of DMEM medium via injection. Over a period of 84 hours post-inoculation, seven mice succumbed, corresponding to a mortality rate of 70%. Conversely, the control group mice displayed no clinical symptoms and exhibited normal growth (Fig. 7A). The mice were systematically monitored, with their body weight recorded at regular intervals. At 60 hours post-inoculation, a reduction in body weight was noted in the infected cohort. By 84 hours post-inoculation, a statistically significant difference in body weight was evident between the infected and control groups (Fig. 7B). Mice were necropsied 48 and 84 hours after inoculation and TCID₅₀ of virus were measured in heart, intestine, lung and brain organs; the highest TCID₅₀ were found in the brain organs of the infected group of mice, and TCID₅₀ at 84 hours were slightly higher than those at 48 hours (Fig. 7C-F).

3.7 A pathological evaluation of organ lesions and tissue changes in mice infected with the virus.

In order to evaluate the impact of pathological injury of recombinant virus infection in mice, a series of observations and anatomical analyses were conducted. Twenty-four hours following infection, the challenge group exhibited loss of appetite, low activity, the presence of yellow, watery discharge around the anus, and a deterioration of mental state compared to the control group (Fig. 8A). Seventy-two hours after infection, mice displayed a more pronounced hunchback and were significantly smaller (Fig. 8B). Anatomical observations revealed a marked reduction in stomach size and volume in infected mice compared with the control mice, which exhibited full, food-filled stomach (Fig. 8C). The brains of the challenge group displayed evidence of vascular congestion, perivascular inflammation, and microthrombi, whereas the brains of the control mice exhibited no abnormalities (Fig. 8D). Compared to the control group, Infection of the brain is accompanied by a large infiltration of inflammatory cells(Fig. 8E). Significant congestion of the alveolar interstitium and hyperplasia of the interstitial tissue were observed in the lung tissue of the infected group (Fig. 8F), while small intestine revealed a significant increase in the incidence of villous epithelial cell detachment, rupture (Fig. 8G) and diarrhea in lactating mice. Histopathological examination of the myocardial tissue showed evidence of inflammatory cell infiltration, disorganised muscle fibre arrangement and cardiomegaly (Fig. 8H).

Establishing a reverse genetics platform for GETV allows for the modification and manipulation of its genes at the DNA level. DNA-launched infectious system is a useful tool with high rescue efficiency that allows the introduction of mutations in specific positions to investigate the function of an individual viral element. Rescued virus particles could be harvested by directly transfecting the DNA-launched recombinant plasmid to the host cells, which will reduce labor and experimental cost by skipping the in vitro transcription assay.

By observing phenotypic changes in rescued viruses, the functions of corresponding genes can be determined. This enables a deeper understanding of the structure and function of the GETV genome as well as its pathogenic mechanisms. Such insights are crucial for addressing the growing threat of GETV to livestock health, poultry farming, and public health safety in China. Previously, Ren et al.[33] successfully cloned the complete sequence of the GETV GX201808 strain into the pBR322 vector. They developed a reverse genetics system for the GETV GX201808 strain under the control of the 3' CMV promoter and the 5' bGH Poly(A) signal sequence. Compared to the parental virus, the infectious clone of GETV cDNA contains seven nucleotide mutations, resulting in six amino acid changes. Although the growth kinetics are similar to the parental virus, the clinical symptoms, mortality rate, and brain tissue pathology in infected mice are indistinguishable from those caused by the parental virus. However, the time to death in mice infected with the infectious clone was delayed, which is likely due to the six nucleotide mutations in the cloned genome. WANG et al.[34] established a reverse genetics system for GETV by cloning the GETV-HN strain into the PSMART-LCKAN plasmid. This was achieved by introducing a CMV promoter in the 3'UTR and incorporating the HdvRz hepatitis delta virus ribozyme sequence and bGH Poly(A) signal sequence in the 5'UTR region. They successfully rescued the wild-type rGETV-HN and the mutant viruses E2-K253R and E2-K253A. Du et al.[35] introduced HamRz and HdvRz ribozyme sequences after the 3' UTR of the full-length GETV cDNA sequence, constructing a stable infectious cDNA clone named pGETV-SC483. Although the growth characteristics were similar to the parental virus, noticeable cytopathic effects (CPE) were observed only two days post-transfection. This differs from the time to CPE appearance in the infectious clone constructed by WANG et al.[34].

In this study, the two infectious clone plasmids pBR322-GETV-HuN1 and pBR322-GETV-EGFP were established. In the first and second generations of transfected BHK-21 cells, cytopathic effects (CPE) were not easily observed. However, as the number of passages increased, CPE became more apparent. This observation is different from the experimental results reported by Du et al.[35] and Ren et al.[33]. In the constructed pBR322-GETV-EGFP infectious clone plasmid, it was initially challenging to detect the EGFP reporter gene in the first two passages of virus. Subsequently, with increasing passages, EGFP expression became more apparent. However, the proportion of rescued viruses expressing GFP remained consistently low. We speculate that this may be due to the instability in the genetic transmission of the GETV infectious clone plasmid carrying the green fluorescent protein marker gene, which could be attributed to the construction strategy we employed. There is a stop codon after the E1 protein gene sequence. When originally designing the infectious clone plasmid containing the EGFP reporter gene for GETV, we chose to retain this stop codon to preserve the integrity and fidelity of the viral genome sequence. This decision may contribute to the lower proportion of GETV particles capable of expressing EGFP in the total rescued virus population.

Therefore, based on the summary of previous studies, this research employed OverlapPCR to add a CMV promoter upstream of the 5' UTR of the GETV genome and introduced a continuous sequence of 25 adenosine triphosphates (ATP), HDVRz sequence, and bGH Poly(A) signal sequence downstream of the 3' UTR. This successfully established a more efficient and rapid reverse genetic system for the GETV HuN1 strain.

In this study, for the first time, the hepatitis delta virus ribozyme (HDVRz) sequence, the bovine growth hormone poly(A) tail sequence (bGH poly(A)) and the cytomegalovirus promoter (CMV) sequence were simultaneously inserted into both ends of the genome to construct a genetically stable GETV infectious cDNA clone. In addition, based on the established infectious clone, we constructed a GETV infectious clone that stably expresses the EGFP reporter gene. The infectious clones constructed using this method could be successfully rescued through liposome transfection, resulting in the production of recombinant viruses that could be stably passaged. We believe that the establishment of the GETV reverse genetics system will facilitate further studies to understand the molecular mechanisms of GETV virus biology, virulence determinants, molecular pathogenesis, vaccine development and virus-host interaction.

Ethics approval and consent to participate

Consent for publication

Not applicable.

Availability of date and material

The datasets analysed during the current study are available.

Competing Interests

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Funding

This research was funded by the National Natural Science Foundation of China (grant number 32402839); National Key Research and Development Program (grant number 2023YFD1802200)；Anhui Higher Institutions Natural Science Foundation, China (grant number 2023AH051034); the Anhui Agricultural University’s Scientific Research Funding Projects for Introducing and Stabling Talents (grant number rc392212), and the Research Funds of Joint Research Center for Food Nutrition and Health of IHM (grant number 2023SJY01).

Author contributions

R.C. and Z.W. designed the experiments, interpreted the data and wrote the article. R.C., Q.H. and Q.W. performed the experiments with assistance and advice from X.W., Z.C., Z.Y., F.C., J.S., Y.S., X.S. and K.Q. J.T. and Z.W. reviewed and edited the paper.

Acknowledgments

We thank the Biotechnology Center of Anhui Agricultural University (Xiuhong Zhou and Qin Wang) for providing technical support with laser scanning confocal microscope and transmission electron microscopy.

Chastel C, Rageeu J (1966) [Isolation of arbovirus in Cambodia from naturally infected mosquitoes]. Medecine Tropicale: Revue Du Corps De Sante Colonial 26:391–400
Doherty RL, Wetters EJ, Gorman BM, Whitehead RH (1970) Arbovirus infection in Western Queensland: Serological studies, 1963–1969. Trans R Soc Trop Med Hyg 64:740–747. https://doi.org/10.1016/0035-9203(70)90016-7
Marchette NJ, Rudnick A, Garcia R (1980) Alphaviruses in Peninsular Malaysia: II. Serological evidence of human infection. Southeast Asian J Trop Med Public Health 11:14–23
Zhai Y, Wang H-Y, Sun X, et al (2008) Complete sequence characterization of isolates of Getah virus (genus Alphavirus, family Togaviridae) from China. J Gen Virol 89:1446–1456. https://doi.org/10.1099/vir.0.83607-0
Perera LP, Calisher CH, Karunaratne SHPP, et al (1994) Viruses Isolated from Mosquitoes Collected in Sri Lanka. Am J Trop Med Hyg 51:154–161. https://doi.org/10.4269/ajtmh.1994.51.154
Leake CJ, Ussery MA, Nisalak A, et al (1986) Virus isolations from mosquitoes collected during the 1982 Japanese encephalitis epidemic in northern Thailand. Trans R Soc Trop Med Hyg 80:831–837. https://doi.org/10.1016/0035-9203(86)90397-4
Liu H, Zhang X, Li L-X, et al (2019) First isolation and characterization of Getah virus from cattle in northeastern China. BMC Veterinary Research 15:320. https://doi.org/10.1186/s12917-019-2061-z
Li Y, Fu S, Guo X, et al (2019) Serological Survey of Getah Virus in Domestic Animals in Yunnan Province, China. Vector-Borne and Zoonotic Diseases 19:59–61. https://doi.org/10.1089/vbz.2018.2273
Meng W-S, Zhang J-B, Sun X-H, et al (2009) [Isolation and identification of arboviruses from mosquito pools in some regions of Liaoning province, China]. Zhonghua Liu Xing Bing Xue Za Zhi = Zhonghua Liuxingbingxue Zazhi 30:50–54
Li XD, Qiu FX, Yang H, et al (1992) Isolation of Getah virus from mosquitos collected on Hainan Island, China, and results of a serosurvey. Southeast Asian J Trop Med Public Health 23:730–734
Shortridge K, Mason D, Watkins K, Aaskov J (1994) Serological evidence for the transmission of Getah virus in Hong Kong. Vet Rec 134:527–528. https://doi.org/10.1136/vr.134.20.527
Shi N, Li L-X, Lu R-G, et al (2019) Highly Pathogenic Swine Getah Virus in Blue Foxes, Eastern China, 2017. Emerg Infect Dis 25:1252–1254. https://doi.org/10.3201/eid2506.181983
Kono Y, Sentsui H, Ito Y (1980) An epidemic of Getah virus infection among racehorses: properties of the virus. Res Vet Sci 29:162–167. https://doi.org/10.1016/S0034-5288(18)32658-4
Chang C-Y, Huang C-C, Huang T-S, et al (2006) Isolation and Characterization of a Sagiyama Virus from Domestic Pigs. J Vet Diagn Invest 18:156–161. https://doi.org/10.1177/104063870601800203
Wada R, Kamada M, Fukunaga Y, et al (1982) Equine Getah Virus Infection : Pathological Study of Horses Experimentally Infected with the MI-110 Strain. Jpn J Vet Sci 44:411-415,418. https://doi.org/10.1292/jvms1939.44.411
Lu G, Ou J, Ji J, et al (2019) Corrigendum: Emergence of Getah Virus Infection in Horse With Fever in China, 2018. Front Microbiol 10:2601. https://doi.org/10.3389/fmicb.2019.02601
Yang T, Li R, Hu Y, et al (2018) An outbreak of Getah virus infection among pigs in China, 2017. Transbound Emerg Dis 65:632–637. https://doi.org/10.1111/tbed.12867
Kumanomido T, Wada R, Kanemaru T, et al (1988) Clinical and virological observations on swine experimentally infected with Getah virus. Veterinary Microbiology 16:295–301. https://doi.org/10.1016/0378-1135(88)90033-8
Lescar J, Roussel A, Wien MW, et al (2001) The Fusion Glycoprotein Shell of Semliki Forest Virus. Cell 105:137–148. https://doi.org/10.1016/S0092-8674(01)00303-8
Wang JC-Y, Chen C, Rayaprolu V, et al (2015) Self-Assembly of an Alphavirus Core-like Particle Is Distinguished by Strong Intersubunit Association Energy and Structural Defects. ACS Nano 9:8898–8906. https://doi.org/10.1021/acsnano.5b02632
Zhang R, Hryc CF, Cong Y, et al (2011) 4.4 Å cryo-EM structure of an enveloped alphavirus Venezuelan equine encephalitis virus: 4.4 Å cryo-EM structure of an enveloped alphavirus. Embo J 30:3854–3863. https://doi.org/10.1038/emboj.2011.261
Sherman MB, Weaver SC (2010) Structure of the Recombinant Alphavirus Western Equine Encephalitis Virus Revealed by Cryoelectron Microscopy. J Virol 84:9775–9782. https://doi.org/10.1128/JVI.00876-10
Ribeiro-Filho HV, Coimbra LD, Cassago A, et al (2021) Cryo-EM structure of the mature and infective Mayaro virus at 4.4 Å resolution reveals features of arthritogenic alphaviruses. Nat Commun 12:3038. https://doi.org/10.1038/s41467-021-23400-9
Hasan SS, Sun C, Kim AS, et al (2018) Cryo-EM Structures of Eastern Equine Encephalitis Virus Reveal Mechanisms of Virus Disassembly and Antibody Neutralization. Cell Rep 25:3136-3147.e5. https://doi.org/10.1016/j.celrep.2018.11.067
Kobayashi D, Isawa H, Ejiri H, et al (2016) Complete Genome Sequencing and Phylogenetic Analysis of a Getah Virus Strain (Genus Alphavirus , Family Togaviridae ) Isolated from Culex tritaeniorhynchus Mosquitoes in Nagasaki, Japan in 2012. Vector-Borne and Zoonotic Diseases 16:769–776. https://doi.org/10.1089/vbz.2016.2017
Baric RS, Sims AC (2007) A Reverse Genetics System for dsRNA Viruses. Cell Host & Microbe 1:90–91. https://doi.org/10.1016/j.chom.2007.04.004
Almazán F, González JM, Pénzes Z, et al (2000) Engineering the largest RNA virus genome as an infectious bacterial artificial chromosome. Proc Natl Acad Sci USA 97:5516–5521. https://doi.org/10.1073/pnas.97.10.5516
Sutcliffe JG (1979) Complete Nucleotide Sequence of the Escherichia coli Plasmid pBR322. Cold Spring Harbor Symposia on Quantitative Biology 43:77–90. https://doi.org/10.1101/SQB.1979.043.01.013
Suzuki Y, Tanaka A, Maeda Y, et al (2021) Construction and characterization of an infectious clone generated from Chikungunya virus SL11131 strain. Virology 552:52–62. https://doi.org/10.1016/j.virol.2020.09.006
Wu-yang Z, Guo-dong L (2011) Research on basis of reverse genetics system of a Sindbis-like virus XJ-160. Virol J 8:519. https://doi.org/10.1186/1743-422X-8-519
Chuong C, Bates TA, Weger-Lucarelli J (2019) Infectious cDNA clones of two strains of Mayaro virus for studies on viral pathogenesis and vaccine development. Virology 535:227–231. https://doi.org/10.1016/j.virol.2019.07.013
Davis NL, Willis LV, Smith JF, Johnston RE (1989) In vitro synthesis of infectious venezuelan equine encephalitis virus RNA from a cDNA clone: analysis of a viable deletion mutant. Virology 171:189–204. https://doi.org/10.1016/0042-6822(89)90526-6
Ren T, Min X, Mo Q, et al (2022) Construction and characterization of a full-length infectious clone of Getah virus in vivo. Virologica Sinica 37:348–357. https://doi.org/10.1016/j.virs.2022.03.007
Wang N, Zhai X, Li X, et al (2022) Attenuation of Getah Virus by a Single Amino Acid Substitution at Residue 253 of the E2 Protein that Might Be Part of a New Heparan Sulfate Binding Site on Alphaviruses. J Virol 96:e01751-21. https://doi.org/10.1128/jvi.01751-21
Du, Bingchen, Wang, Ming, Liu, Chunguo, et al. (2023). Construction of the infectious cDNA clone of GETV strain SC483. Chinese Journal of Agricultural Sciences, 56, 3479–3486.

Download PDF

Version 1

posted

You are reading this latest preprint version

Development and characterization of a DNA-launched Getah virus infectious clone

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials and Methods

2.1 Cell, virus, plasmids and reagents

2.2 The strategy of Construction of full-length cDNA cloning plasmid

2.3 Virus Rescue

2.4 Detection of the rescued virus particles by electron microscopy

2.5 Detection of the rescued virus particles by Immunological Fluorescence Assay

2.6 Plaque Assay and One-Step Growth Curve Establishment

2.7 Genetic stability analysis of rescued Getah viruses

2.8 Analysis of the pathogenicity of the rescued Getah virus in mice

2.9 Histopathological examination of the mice infected with rescued Getah viruses

2.10 Statistical analysis

3. Results

3.2 Significant Cytopathic Effects and Observation of Viral Particles

3.3 Generation and characterization of recombinant virus

3.4 Detection of rescued Getah virus and gene-marked rescued Getah virus via IFA.

3.5 Rescued Getah viruses can be genetically stabilized and replicated

3.6 Pathogenicity of the rescued Getah viruses in mice

3.7 A pathological evaluation of organ lesions and tissue changes in mice infected with the virus.

4. Discussion

5. Conclusion

Declarations

References

Status:

Version 1