The expression of TRPM4 protein is increased in the hippocampus of aged PND rats, and ulinastatin affects TRPM4 and apoptosis to enhance cognition dysfunction

doi:10.21203/rs.3.rs-4990939/v1

Download PDF

Research Article

The expression of TRPM4 protein is increased in the hippocampus of aged PND rats, and ulinastatin affects TRPM4 and apoptosis to enhance cognition dysfunction

https://doi.org/10.21203/rs.3.rs-4990939/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Methods

Forty18-month-old male Sprague-Dawley rats were divided into four groups: group C (sham-operated); surgery group (internal fixation of tibial fracture); UTI group (Ulinastatin + surgery), and 9- phenanthrol group (TRPM4 channel inhibitor + surgery). Western blotting, qPC,and IF were used to detect the expression levels of TRPM4 in different groups of rats. The neurocognitive function of rats was detected by the Y-maze and NOR test. The expression of apoptosis-related proteins in rat hippocampal cells was detected, and the apoptosis level of rat hippocampal cells was detected by the TUNEL method. Mitochondrial morphology was observed by transmission electron microscopy.

Results

TRPM4 expression was significantly higher in the hippocampus of rats in the surgery group compared with the sham surgery group. Behavioral assays in the 9-phenanthrol group showed better results than those in the surgery group, with decreased expression of BAX, an apoptosis-related protein, elevated expression of BCL-2, and decreased tunel Apoptosis Index in the hippocampus of rats. The Ulinastatin group and the inhibitor group had similar results.

Conclusion

TRPM4 expression is elevated in the hippocampus of aged PND rats, and inhibition of its expression attenuates hippocampal apoptosis and protects perioperative neurocognitive function in rats, with a similar effect to that of Ulinastatin protection.

TRPM4

PND

apoptosis

UTI

Perioperative neurocognitive dysfunction (PND) describes alterations in cognitive function before and/or after surgery, characterized by memory loss, depression, anxiety, and personality changes.^[1] It occurs mostly in elderly patients over 65 years of age and can significantly increase hospitalization, costs, social burden, and even mortality. The underlying mechanism of PND has not been completely elucidated although various mechanisms for PND, such as neuroinflammation, oxidative stress, mitochondrial dysfunction, neurotransmitter dysfunction, and impaired synaptic function have been proposed.^[2–6]

Among them, the rat tibia fracture reset again as a widely accepted model experiment. At present, the underlying mechanisms of PND are related to hippocampal neuronal damage, inflammatory response, and oxidative stress.^[7] The hippocampus is one of the main target organs of cognitive dysfunction, and the apoptosis of hippocampal neurons caused by the imbalance of BCL-2 and BAX may be one of the reasons.

Transient receptor potential melastatin 4(TRPM4)is a non-selective cation channel that is mainly permeable to Na+, activated by intracellular calcium, and modulated by ATP; Dysregulation of TRPM4 contributes to many pathological processes, including stroke, cerebral edema after traumatic, spinal cord injury and neurodegenerative diseases。 The mechanism may be related to the depolarization of neurons by TRPM4-like currents, and the overexpression of TRPM4-like currents may increase apoptosis of hippocampal neurons, destroy the blood-brain barrier, and excessive sodium influx. Some studies have shown that blocking TRPM4 channels can correct the above pathological processes。 However, whether TRPM4 also plays a mechanistic role in POCD remains unclear. Preoperative intraperitoneal injection of ulinastatin has a protective effect on postoperative cognitive impairment in rats. ^[8–11] This research USES the drug to set up the preoperative prevention group, with no clear comparison of the ways of the treatment effects.

Based on the above, we aimed to verify the role of TRPM4 pathways in a PND rat model, which could provide a new target for clinical prevention of PND.

2.1 animals

Eighteen-month-old male SD rats weighing 450–500g were obtained from the Jinan Pengyue Animal Company. The rats were housed in an air-conditioned room kept at 19–23°C with a relative humidity of 40–50% and a 12-h light/dark cycle. The study protocol was approved by the Ethics Committee of Weifang Medical University and all animal experiments adhere to the ARRIVE guidelines.

2.2 animal model

The PND model was built by performing internal fixation of tibial fractures in rats. Briefly, aged rats were anesthetized by 1.5–2% sevoflurane and 100% oxygen using a rat anesthesia mask. A 1.0-1.5cm longitudinal incision was made from the left hind limb knee joint downward. The fibula and the muscles around the tibia were isolated, and the osteotomy was performed with a tear at the junction of from the knee to the middle third of the tibia. Subsequently, a 1 mm stainless steel rod was then inserted into the canal to the distal third of the tibial, After producing the fracture, the skin was sutured with nylon and 2% lidocaine was applied to the wound to relieve pain. ^[12–13]

2.3Y-maze

Spontaneous alternation behavior was assessed through a single session of Y-maze. The Y-maze used in the present study was made from black Plexiglas. It has three arms with the following dimensions: 25 cm high, 50cm long, and 10 cm wide at angles of 120 degrees, which were marked for A, B, and C, respectively. 24 hours post-surgery, each animal was placed at the end of an arm and allowed to explore the maze for 8 min. Successive entry in each arm was defined as spontaneous alternation behavior. A blinded observer registered the visited arms sequence corresponding to each animal. The spontaneous alternation percentage was calculated as (number of alternations/total entries − 2) × 100. Between trials, the Y-maze was washed with a 75% ethanol solution. Additionally, the total number of arm entries was also considered as an index of locomotor activity, and the rats that performed less than 6 arm entries in 8 min were omitted from the analysis.^[14–15]

2.4 Novel object recognition (NOR) test

The NOR test was performed in a black Plexiglas box (length: 72 cm, width: 72 cm, height: 50 cm). In the first trial, a rat was placed in the box (with two identical objects positioned) to explore for 5 min then returned to its home cage. After 24 24-hour intervals (testing session), the rat went through the second trial in which one of the two (familiar) objects was replaced by a new one. Interaction is defined as looking, licking, sniffing, or touching the object while sniffing. The discrimination ratio for each rat was calculated as ETN/(ETF + ETN), where ETN = the exploration time (s) spent by the rat interacting with the novel object and ETF = the exploration time (s) spent by the rat interacting with the familiar object.^[16–17]

2.5WB

Total proteins isolated from rat hippocampus tissues using RIPA lysis buffer (Beyotime, Shanghai, China). Protein concentration was determined using an Enhanced BCA Protein Assay Kit (Solarbio, Beijing, China), and 25–40 µg protein was resolved by10–12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto Polyvinylidene difluoride (PVDF) membranes (Millipore). Subsequently, the membranes were blocked with 5% skim dried milk in TBST for 2 h and then incubated overnight at 4°C with the primary antibodies for the detection of TRPM4(1:1000,sigma),BAX,BCL-2,caspase3,cleaved-caspase3,β-actin(all 1:500,abclonal, china), The membranes were then incubated with HRP-conjugated secondary detection antibodies (Proteintech, Wuhan, China). Immunoreactive proteins were subsequently detected with ECL Plus Reagent (Beyotime, Shanghai, China). The value of each band was normalized to that of β-actin. Quantification of immunoblots was performed using ImageJ software.^[18]

2.6 qPCR

Total RNA was extracted from hippocampus tissues using TRIzol. The RNA was then converted to cDNA using a ReverTra Ace qPCR RT kit (Vazyme). Gene expression was analyzed by RT-qPCR using the SYBR Green PCR Master Mix (Vazyme); β-actin was used as an internal control. The TRPM4 forward primer sequences is CTTCGAGCACTTCCGTGTCT, the TRPM4 Reverse primer sequences is CACAGACTCCAAGTCAGCA. All tests were performed in triplicate and gene expression was normalized against the expression of β-actin. Relative gene expression was then calculated as fold changes in the 2-∆∆CT method. ^[19]

2.7 TUNEL

TUNEL staining Te brain tissue specimens were quickly removed and postfxed with 4% paraformaldehyde embedded in paraffin at 4°C left overnight, and sectioned into 10 µm thickness slices. Apoptotic cells were visualized by in situ detection of DNA fragmentation (terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling, TUNEL) according to the manufacturer’s instructions (Elabscience Biotechnology Co.; Ltd Wuhan, China). Three slices were selected randomly in each group and analyzed with a LEICA DM2500 microscope. The Apoptosis Index (AI) was calculated by Image J software. The number of apoptotic cells / total number of cells×100%. Slices of brain tissues were further analyzed by Hoechst 33258 (Beyotime Biotechnology) and visualized under a fluorescence microscope to determine nuclei fragmentation of apoptotic cells.^[20]

2.8 TEM

4% paraformaldehyde-fixed hippocampus samples (3 mm× 3 mm) of Control, Surgery, UTI, and 9-PHE groups were collected and fixed in 2% glutaraldehyde in 0.1 mol/L sodium phosphate buffer (pH 7.4) overnight at 4°C. After dehydration with a graded ethanol series, the sample was embedded in Epon812 and sectioned using a Leica EM UC6 ultramicrotome (Leica Co., Vienna, Austria). Samples were viewed and photographed using Transmission Electron Microscopy (TEM) (JEM-2000EX, JEDL, Japan).^[21]

2.9IF

Half of the brain tissue of three randomly selected rats from each group was fixed overnight in 4% paraformaldehyde. The tissue blocks were dehydrated with sucrose, embedded with oct, and then cut into 10-micron coronal sections at -20℃。 After sealing with 5%BSA for half an hour, the slices were incubated with TRPM4 primary antibody at 4℃ overnight. After cleaning with PBS buffer the next day, the sections were incubated with fluorescein at 37 ° C for 40 min and then stained with DAPI. The images were imaged by fluorescence microscope and the results were analyzed by ImageJ software.^[22]

The animal was intracardiac perfused with normal saline followed by 4% paraformaldehyde (Solarbio, China) under anesthesia. Following fixation with 4% paraformaldehyde and dehydration with sucrose, the brain was cut into 10 µm thick coronal slices at − 20°C. Image-J software (National Institutes of Health, Bethesda, Maryland, USA) was used to count the number of TH-positive neurons in six parallel sections containing the SN of each animal.

2.10 Statistical analysis

Using GraphPad Prism8.0 (GraphPad Software, La Jolla, CA, USA) to analyze data, use the Brown - Forsythe test to verify whether normal distribution, the data to average ± SEM said, Repeated measures analysis of variance (ANOVA) was used for comparison between groups, and p < 0.05 was considered significant.^[23]

3.1 Elevated TRPM4 expression in the hippocampus of PND model rats

To investigate the relationship between TRPM4 expression and the formation of PND in rats, we detected the expression of TRPM4 in the hippocampus of rats in the PND model group by using WB, qPCR, and IF, as shown in Fig. 1, the expression of TRPM4 in the hippocampus of rats in the PND group was significantly elevated. This suggests that the occurrence of neurocognitive impairment in aged rats is associated with TRPM4. The process of PND development may be related to the increased expression of TRPM4.

3.2 Inhibition of TRPM4 expression attenuates neurocognitive impairment in PND rats

To verify whether the effect of inhibiting TRPM4 expression on neurocognitive dysfunction in rats is positive, the neurocognitive function of rats was assessed by detecting the spontaneous alternation rate of y-maze and the percentage of head probing time for new objects in the new object recognition test. The results shown in Fig. 2, that the spontaneous alternation rate was decreased in the surgery group and higher in the 9-PH group compared with the sham-operated group. the discrimination ratio of NOR was decreased in the surgery group compared with the sham-operated group and higher in the 9-PH group compared with the surgery group. The results all suggest that inhibition of the TRPM4 pathway can protect the neurocognitive function of rats.

3.3 Inhibition of TRPM4 regulates the expression of hippocampal apoptosis-related proteins in PND rats

To further clarify the relationship between the inhibition of TRPM4 and apoptosis, we used WB and PCR to detect the expression of apoptosis-related proteins BCL-2 and BAX, and the results were shown in Figure. 3, the expression of BCL-2 in the PND group was decreased compared with that of the sham-operated group, and decreased in the UTI group and the 9-PH group compared with that of the surgery group. The trend of BAX was reversed, and the balance between the two was disrupted, and the apoptosis of the hippocampus of the rats was increased. The trend of apoptosis-related protein expression also suggested that inhibition of TRPM4 expression could inhibit rat hippocampal apoptosis.

3.4 Inhibition of TRPM4 suppresses hippocampal apoptosis in PND rats

In order to clarify the relationship between TRPM4 and apoptosis during the formation of PND in rats, with the use of TUNEL to detect apoptosis in rat hippocampus, the results are shown in Fig. 4, the rate of apoptosis in rat hippocampus of the PND group increased, and the rate of apoptosis in rat hippocampus of the inhibition of TRPM4 group and the prevention group of ulinastatin was reduced compared with that of the surgery group. It is suggested that inhibition of TRPM4 suppressed apoptosis in rat hippocampus. The protective effect of TRPM4 inhibition in PND rats may be related to its inhibition of hippocampal neuronal apoptosis.

3.5 Preoperative application of ulinastatin inhibits TRPM4 expression in PND rats

When comparing the protein expression of the TRPM4 inhibition group with that of the ulinastatin prophylaxis group, we found that the expression level of TRPM4 in the ulinastatin prophylaxis group was also decreased compared with that of the PND group, which suggests that our preoperative administration of ulinastatin can inhibit the expression of TRPM4.

3.6 Preoperative application of ulinastatin attenuates hippocampal apoptosis in PND rats

When exploring the apoptosis rate of rat hippocampus in each group, we found that the rate of apoptosis in the ulinastatin group was lower than that in the surgery group, suggesting that ulinastatin prophylaxis could alleviate apoptosis in rat hippocampus.

3.7 Inhibition of TRPM4 improves mitochondrial structural changes in PND rats

To further explore the possible mechanisms of apoptosis in the hippocampus of rats in the surgery group, we initially explored the mitochondrial morphology of each group, and the results(Fig. 5) showed that mitochondria in the hippocampal cells of rats in the PND group, and mitochondrial morphology of mitochondria in the inhibition of TRPM4 group were altered, which suggests that inhibition of TRPM4 expression has a certain protective effect on the mitochondria of rats in the PND group.

Our results indicate that inhibition of TRPM4 expression could significantly reduce hippocampal neuron apoptosis and improve neurocognitive function in PND rats. We observed that pre-modeling TRPM4 inhibition reduced neuroapoptosis in the hippocampus and improved learning and memory function in this rat model, consistent with what Charlene P. Poore reported (Poore, CP, Hazalin, NAMN, Wei, S, et al).

Transient receptor potential melastatin 4 is a member of the TRPM protein family, is sensitive to Ca²⁺, only penetrates monovalent cations, is an impermeable bivalent cation, is expressed in many organs, through adjusting the membrane potential changes, and is able to participate in a variety of pathological processes. Physiologically, TRPM 4 is mainly related to cardiac physiology and vascular tone regulation in the circulatory system, kidney physiology in the urinary system, nervous system and neuronal activity, various neurohumoral regulation, and immunity. "It is pathologically associated with arrhythmia, myocardial ischemia-reperfusion injury, stroke, cerebral ischemia-reperfusion injury, subarachnoid hemorrhage, and cancer of some organs." The results of many existing studies show the potential of TRPM4 inhibition for the treatment of patients with various central nervous system disorders. TRPM4 may also become a therapeutic entry point for other system-related diseases in the future. 9-phenanthol, a specific inhibitor of transient receptor potential melastatin (TRPM) 4 channel, can regulate a variety of physiological processes through TRPM4 current inhibition, thereby exerting beneficial effects in a variety of pathological conditions. 9 - PH inhibits TRPM4 expression, and reduces apoptosis-related molecules and inflammatory cytokines, such as the expression of BAX and IL-6. (Ma, P, Huang, N, Tang, J, et al. ) Inhibition of TRPM4 has a protective effect on Chronic cerebral hypoperfusion (Hazalin, NAMN, et al. 2020). TRPM4 contributes to the death of Mossy cells after status epilepticus (Mundrucz, L, et al. 2023). Inhibition of TRPM4 can reduce the apoptosis of neurons in the hippocampus. Improved learning and memory (Poore, CP, Hazalin, NAMN, Wei, S, et al.2024). Given the role of inhibition of TRPM4 in the treatment of various neurological diseases, we believe that inhibition of the TRPM4 pathway may have a beneficial effect on PND. Therefore, we investigated whether inhibition of TRPM4 improved cognitive dysfunction in a rat model of PND induced by tibial fracture reduction and internal fixation, and further explored the possible mechanisms. Our current study shows that surgery leads to cognitive dysfunction in older rats, resulting in increased apoptosis of hippocampal neurons. Inhibition of the TRPM4 pathway may significantly improve the cognitive function of rats by inhibiting the apoptosis of hippocampal neurons. Our results suggest that inhibition of the TRPM4 pathway has a significant brain protective effect in PND rats.

A new study finds that in the rat model with chronic hypoxia, TRPM4 treatment can reduce the blocking antibody M4P hippocampal neurons apoptosis, relieve long cheng enhanced damage, and improve the learning and memory function of the rat model. (Poore, CP, Hazalin, NAMN, Wei, S, et al.2024) The inhibitor of TRPM4, 9-PH, significantly reduced brain water content, blood-brain barrier disruption, neuronal apoptosis, and neurobehavioral deficits in a cerebral edema model. (Ma, P, Huang, N, Tang, J, et al.2023) Trpm4 deficiency in a mouse model of status epilepticus significantly attenuated neuronal loss, cell necrosis, and apoptosis, as well as astrocytosis and microgliosis in the hippocampus and piriform cortex. (Chen, X, Liu, K, Lin, Z, et al.,2020) We found that the expression of TRPM4 was increased in aged PND rats by WB, PCR, IF, and other experimental methods. Y-maze and novel object recognition experiments were used to explore the protective effect on cognitive function in aged PND rats.

Ulinastatin is a serine protease inhibitor, which exists in human blood and urine. It has a strong inhibitory effect on a variety of serine proteases such as trypsin and thrombin. Ulinastatin can inhibit inflammation, restrain apoptosis, improve immune function, and protect tissues and organs. It has been used to treat pancreatitis, sepsis, and so on. In addition, recent studies have shown that ulinastatin can significantly reduce the occurrence of POCD in elderly patients after general anesthesia, inhibit the inflammatory response, and reduce cell and tissue damage. []Ulinastatin can prevent general anesthesia before giving ulinastatin can prevent neuronal damage and cognitive decline after general anesthesia. The protective effect of ulinastatin was associated with the inhibition of microglial activation. Its target in the activation of microglia is the M1 phenotype. (Cho, EH, In, CB, Lee, GW, et al., 2024), our research found that preoperative giving ulinastatin can inhibit TRPM4 expression, and protect elderly PND unit cognitive function in rats.

Clinically, PND mainly occurs in elderly patients, and age is an independent risk factor. In addition, some studies have shown that inhaled general anesthesia is also a risk factor for PND. To better simulate clinical situations, in this study, we use inhaled general anesthesia and orthopedic surgery in the senile rats PND unit model was set up, and we found that the general anesthesia and surgery cause cognitive impairment in the elderly rats, inhibit TRPM4 significantly improve the cognitive behavior of PND.

To sum up, ulinastatin can inhibit the TRPM4 pathway, improve operation caused by cognitive dysfunction, inhibition of hippocampal neuron apoptosis. TRPM4 may be an effective prevention of PND unit targets.

PND

Perioperative neurocognitive dysfunction

TRPM4

Transient receptor potential melastatin 4

UTI

Ulinastatin

9-PHe

9-phenanthrol.

Acknowledgements

Not applicable.

Authors’ contributions

XXH and LJY wrote the manuscript text and completed the figures; LKL and HHR prepared the funding, reviewed and checked the article, ZCY completed the methodology and part of the figures, and ZMM completed part of the data analysis and proofreading..

Funding

This study was supported by Mechanism of BRD4 regulating mitochondrial calcium homeostasis to protect glomerular endothelial cells from acute kidney injury, Shandong Provincial Fund, ZR2022MH134, 202301-202512

Availability of data and materials

Raw data are deposited in the Supplementary Files. The datasets generated and/or analyzed during the current study are not publicly available due to data protection but are available from the corresponding author on reasonable request.

Ethics approval and consent to participate

The study was carried out in compliance with the ARRIVE guidelines. All methods are reported in accordance with ARRIVE guidelines (https://arriveguidelines.org) for the reporting of animal experiments. All the animal experiments were carried out according to the National Institutes of Health Guidelines for Care and Use of Laboratory Animals and were approved by the Animal EthicsCommittee of theShandong Second Medical University(Approval No.2023SDL359).

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Author details

Not applicable.

Evered, L, Silbert, B, Knopman, DS, Scott, DA, DeKosky, ST, Rasmussen, LS, Oh, ES, Crosby, G, Berger, M, Eckenhoff, RG, (2018). Recommendations for the Nomenclature of Cognitive Change Associated with Anaesthesia and Surgery-20181. J ALZHEIMERS DIS, 66 J ALZHEIMERS DIS. https://doi.org/10.3233/JAD-189004
Wu, W, Zhang, X, Zhou, J, Yang, H, Chen, J, Zhao, L, Zhong, J, Lin, WJ, Wang, Z, (2021). Clemastine Ameliorates Perioperative Neurocognitive Disorder in Aged Mice Caused by Anesthesia and Surgery. Front Pharmacol, 12 Front Pharmacol. https://doi.org/10.3389/fphar.2021.738590
Muscat, SM, Deems, NP, Butler, MJ, Scaria, EA, Bettes, MN, Cleary, SP, Bockbrader, RH, Maier, SF, Barrientos, RM, (2023). Selective TLR4 Antagonism Prevents and Reverses Morphine-Induced Persistent Postoperative Cognitive Dysfunction, Dysregulation of Synaptic Elements, and Impaired BDNF Signaling in Aged Male Rats. J NEUROSCI, 43 J NEUROSCI. https://doi.org/10.1523/JNEUROSCI.1151-22.2022
Netto, MB, de Oliveira Junior, AN, Goldim, M, Mathias, K, Fileti, ME, da Rosa, N, Laurentino, AO, de Farias, BX, Costa, AB, Rezin, GT, Fortunato, JJ, Giustina, AD, Barichello, T, Dal-Pizzol, F, Petronilho, F, (2018). Oxidative stress and mitochondrial dysfunction contribute to postoperative cognitive dysfunction in elderly rats. BRAIN BEHAV IMMUN, 73 BRAIN BEHAV IMMUN. https://doi.org/10.1016/j.bbi.2018.07.016
Liu, Y, Chu, JMT, Ran, Y, Zhang, Y, Chang, RCC, Wong, GTC, (2022). Prehabilitative resistance exercise reduces neuroinflammation and improves mitochondrial health in aged mice with perioperative neurocognitive disorders. J Neuroinflammation, 19 J Neuroinflammation. https://doi.org/10.1186/s12974-022-02483-1
Zhang, X, Dong, H, Li, N, Zhang, S, Sun, J, Zhang, S, Qian, Y, (2016). Activated brain mast cells contribute to postoperative cognitive dysfunction by evoking microglia activation and neuronal apoptosis. J Neuroinflammation, 13 J Neuroinflammation. https://doi.org/10.1186/s12974-016-0592-9
Wei, P, Jia, M, Kong, X, Lyu, W, Feng, H, Sun, X, Li, J, Yang, JJ, (2023). Human umbilical cord-derived mesenchymal stem cells ameliorate perioperative neurocognitive disorder by inhibiting inflammatory responses and activating the BDNF/TrkB/CREB signaling pathway in aged mice. Stem Cell Res Ther, 14 Stem Cell Res Ther. https://doi.org/10.1186/s13287-023-03499-x
Riquelme, D, Cerda, O, Leiva-Salcedo, E, (2021). TRPM4 Expression During Postnatal Developmental of Mouse CA1 Pyramidal Neurons. Front Neuroanat, 15 Front Neuroanat. https://doi.org/10.3389/fnana.2021.643287
Wei, S, Low, SW, Poore, CP, Chen, B, Gao, Y, Nilius, B, Liao, P, (2020). Comparison of Anti-oncotic Effect of TRPM4 Blocking Antibody in Neuron, Astrocyte and Vascular Endothelial Cell Under Hypoxia. Front Cell Dev Biol, 8 Front Cell Dev Biol. https://doi.org/10.3389/fcell.2020.562584
Bovet-Carmona, M, Menigoz, A, Pinto, S, Tambuyzer, T, Krautwald, K, Voets, T, Aerts, JM, Angenstein, F, Vennekens, R, Balschun, D, (2018). Disentangling the role of TRPM4 in hippocampus-dependent plasticity and learning: an electrophysiological, behavioral and FMRI approach. BRAIN STRUCT FUNCT, 223 BRAIN STRUCT FUNCT. https://doi.org/10.1007/s00429-018-1706-1
Poore, CP, Hazalin, NAMN, Wei, S, Low, SW, Chen, B, Nilius, B, Hassan, Z, Liao, P, (2024). TRPM4 blocking antibody reduces neuronal excitotoxicity by specifically inhibiting glutamate-induced calcium influx under chronic hypoxia. NEUROBIOL DIS, 191 NEUROBIOL DIS. https://doi.org/10.1016/j.nbd.2024.106408
Netto, MB, de Oliveira Junior, AN, Goldim, M, Mathias, K, Fileti, ME, da Rosa, N, Laurentino, AO, de Farias, BX, Costa, AB, Rezin, GT, Fortunato, JJ, Giustina, AD, Barichello, T, Dal-Pizzol, F, Petronilho, F, (2018). Oxidative stress and mitochondrial dysfunction contribute to postoperative cognitive dysfunction in elderly rats. BRAIN BEHAV IMMUN, 73 BRAIN BEHAV IMMUN. https://doi.org/10.1016/j.bbi.2018.07.016
Zhou, Y, Ju, H, Hu, Y, Li, T, Chen, Z, Si, Y, Sun, X, Shi, Y, Fang, H, (2023). Tregs dysfunction aggravates postoperative cognitive impairment in aged mice. J Neuroinflammation, 20 J Neuroinflammation. https://doi.org/10.1186/s12974-023-02760-7 Poore, CP, Hazalin, NAMN, Wei, S, Low, SW, Chen, B, Nilius, B, Hassan, Z, Liao, P, (2024). TRPM4 blocking antibody reduces neuronal excitotoxicity by specifically inhibiting glutamate-induced calcium influx under chronic hypoxia. NEUROBIOL DIS, 191 NEUROBIOL DIS. https://doi.org/10.1016/j.nbd.2024.106408
Xu, ZL, Chen, G, Liu, X, Xie, D, Zhang, J, Ying, Y, (2022). Effects of ginsenosides on memory impairment in propofol-anesthetized rats. BIOENGINEERED, 13 BIOENGINEERED. https://doi.org/10.1080/21655979.2021.2012407
Postu, PA, Gorgan, DL, Cioanca, O, Russ, M, Mikkat, S, Glocker, MO, Hritcu, L, (2020). Memory-Enhancing Effects of Origanum majorana Essential Oil in an Alzheimer's Amyloid beta1-42 Rat Model: A Molecular and Behavioral Study. Antioxidants (Basel), 9 Antioxidants (Basel). https://doi.org/10.3390/antiox9100919
Gómez-Galán, M, De Bundel, D, Van Eeckhaut, A, Smolders, I, Lindskog, M, (2013). Dysfunctional astrocytic regulation of glutamate transmission in a rat model of depression. MOL PSYCHIATR, 18 MOL PSYCHIATR. https://doi.org/10.1038/mp.2012.10
Osborne, AL, Solowij, N, Babic, I, Huang, XF, Weston-Green, K, (2017). Improved Social Interaction, Recognition, and Working Memory with Cannabidiol Treatment in a Prenatal Infection (poly I: C) Rat Model. NEUROPSYCHOPHARMACOL, 42 NEUROPSYCHOPHARMACOL. https://doi.org/10.1038/npp.2017.40
Park, J, Kim, JT, Lee, SJ, Kim, JC, (2020). The Anti-Inflammatory Effects of Angiogenin in an Endotoxin Induced Uveitis in Rats. Int J Mol Sci, 21 Int J Mol Sci. https://doi.org/10.3390/ijms21020413
Attafi, IM, Bakheet, SA, Ahmad, SF, Belali, OM, Alanazi, FE, Aljarboa, SA, Al-Alallah, IA, Korashy, HM, (2022). Lead Nitrate Induces Inflammation and Apoptosis in Rat Lungs Through the Activation of NF-κB and AhR Signaling Pathways. ENVIRON SCI POLLUT R, 29 ENVIRON SCI POLLUT R. https://doi.org/10.1007/s11356-022-19980-8
Dumbuya, JS, Li, S, Liang, L, Chen, Y, Du, J, Zeng, Q, (2022). Effects of hydrogen-rich saline in neuroinflammation and mitochondrial dysfunction in a rat model of sepsis-associated encephalopathy. J Transl Med, 20 J Transl Med. https://doi.org/10.1186/s12967-022-03746-4
Sun, Z, Zhan, L, Liang, L, Sui, H, Zheng, L, Sun, X, Xie, W, (2016). ZiBu PiYin recipe prevents diabetes-associated cognitive decline in rats: possible involvement of ameliorating mitochondrial dysfunction, insulin resistance pathway, and histopathological changes. BMC Complement Altern Med, 16 BMC Complement Altern Med. https://doi.org/10.1186/s12906-016-1177-y
Münster-Wandowski, A, Heilmann, H, Bolduan, F, Trimbuch, T, Yanagawa, Y, Vida, I, (2017). Distinct Localization of SNAP47 Protein in GABAergic and Glutamatergic Neurons in the Mouse and the Rat Hippocampus. Front Neuroanat, 11 Front Neuroanat. https://doi.org/10.3389/fnana.2017.00056
Poore, CP, Hazalin, NAMN, Wei, S, Low, SW, Chen, B, Nilius, B, Hassan, Z, Liao, P, (2024). TRPM4 blocking antibody reduces neuronal excitotoxicity by specifically inhibiting glutamate-induced calcium influx under chronic hypoxia. NEUROBIOL DIS, 191 NEUROBIOL DIS. https://doi.org/10.1016/j.nbd.2024.106408
Hazalin, NAMN, Liao, P, Hassan, Z, (2020). TRPM4 inhibition improves spatial memory impairment and hippocampal long-term potentiation deficit in chronic cerebral hypoperfused rats. BEHAV BRAIN RES, 393 BEHAV BRAIN RES. https://doi.org/10.1016/j.bbr.2020.112781
Mundrucz, L, Kecskés, A, Henn-Mike, N, Kóbor, P, Buzás, P, Vennekens, R, Kecskés, M, (2023). TRPM4 regulates hilar mossy cell loss in temporal lobe epilepsy. BMC Biol, 21 BMC Biol. https://doi.org/10.1186/s12915-023-01604-3
Ma, P, Huang, N, Tang, J, Zhou, Z, Xu, J, Chen, Y, Zhang, M, Huang, Q, Cheng, Y, (2023). The TRPM4 channel inhibitor 9-phenanthrol alleviates cerebral edema after traumatic brain injury in rats. Front Pharmacol, 14 Front Pharmacol. https://doi.org/10.3389/fphar.2023.1098228
Chen, X, Liu, K, Lin, Z, Huang, K, Pan, S, (2020). Knockout of Transient Receptor Potential Melastatin 4 Channel Mitigates Cerebral Edema and Neuronal Injury After Status Epilepticus in Mice. J NEUROPATH EXP NEUR, 79 J NEUROPATH EXP NEUR. https://doi.org/10.1093/jnen/nlaa134
Cho, EH, In, CB, Lee, GW, Hong, SW, Seo, EH, Lee, WH, Kim, SH, (2024). The Preventive Effect of Urinary Trypsin Inhibitor on Postoperative Cognitive Dysfunction, on the Aspect of Behavior, Evaluated by Y-Maze Test, via Modulation of Microglial Activity. Int J Mol Sci, 25 Int J Mol Sci. https://doi.org/10.3390/ijms25052708

No competing interests reported.

Download PDF

Editorial decision: Revision requested
02 Sep, 2024
Editor assigned by journal
30 Aug, 2024
Submission checks completed at journal
30 Aug, 2024
First submitted to journal
28 Aug, 2024

You are reading this latest preprint version

The expression of TRPM4 protein is increased in the hippocampus of aged PND rats, and ulinastatin affects TRPM4 and apoptosis to enhance cognition dysfunction

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Background

Methods

2.5WB

2.7 TUNEL

2.8 TEM

2.9IF

RESULT

Discussion

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1