The role of soil chemical properties and microbial communities on Dendrocalamus brandisii bamboo shoot quality, Yunnan Province, China

doi:10.21203/rs.3.rs-4991299/v1

Download PDF

Research Article

The role of soil chemical properties and microbial communities on Dendrocalamus brandisii bamboo shoot quality, Yunnan Province, China

https://doi.org/10.21203/rs.3.rs-4991299/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The relationship between soil and plants is close and complex, playing a key role in plant growth and quality. However, the intrinsic relationship between soil microorganisms, soil properties and bamboo shoot quality under different geographic seed sources has not been clearly demonstrated. By using 16srRNA and ITS techniques, seven main production areas of Dendrocalamus brandisii in Yunnan province were studied. The results showed that soil chemical properties and microbial communities have a direct positive impact on bamboo shoot quality. Among the bacterial communities, Actinobacteriota, Chloroflexi, Patescibacteria, GAL15, and Cyanobacteria have the most significant influence, with an impact coefficient of 0.865. These bacteria affect the nutritional value of bamboo shoots, including water content, soluble sugar, ash content, protein, and lignin. Regarding soil chemical properties, SOM, pH, AP, and TN values impact the bamboo shoot quality, particularly in terms of water content, soluble sugar, and crude fat. Additionally, among the fungal communities, Basidiomycota, Kickxellomycota, Mucoromycota, unclassified-k-Fungi, and Glomeromycota primarily affect the texture of bamboo shoots, specifically water content and tannin. In summary, soil properties and soil microorganisms are interconnected and work together to bamboo shoot quality, and the bamboo shoot quality could be enhanced by increasing microbial activity through the regulation of soil environmental factors in the efficient cultivation of D.brandisii.

Dendrocalamus brandisii

soil properties

soil microorganisms

bamboo shoot quality

Soil properties and shoot quality of D. brandisii from different provenances were determined.
Soil pH and AK simultaneously affect the soil microbial community structure.
Bacterial communities changed the water, soluble sugar, ash, and protein and ligand contents.
Fungal communities affected the water and tannin contents.
Synergistic interactions are present between soil properties and microorganisms in bamboo shoots.

Dendrocalamus brandisii, commonly known as sweet dragon bamboo, is a large cluster of bamboo species in the genus Dendrocalamus belonging to the subfamily, Bambusoideae. It has four major characteristics: fresh, sweet, tender, and crisp. It can be directly consumed as fresh food or fried in stews, can also be processed into fresh shoots and flavored shoot products (Hui et al., 2019). D. brandisii is widely cultivated in the southeastern subtropical regions of China, with production occurring in Yunnan Province. It is primarily distributed in the western and southern parts of Yunnan such as Baoshan, Dehong Dai, and Jingpo Autonomous Prefecture, Lincang, Pu'er City, Xishuangbanna, Red River, and Yuxi (Hui et al., 2022). The yield and quality of D. brandisii bamboo shoots are influenced by a variety of factors such as soil, climate, altitude, and fertilization measures.

A population of microorganisms within soil are typically referred to as microbial communities, and these play a vital role in the assimilation of nitrogen and phosphorus by plants (Dini-Andreote et al., 2016). Furthermore, mycorrhizal within these communities further transform soil phosphorus, thereby increasing its absorption ability by plants (Zhu et al., 2018). Soil microbes can affect soil fertility and plant growth in various ways, including soil nutrient status, biomass, and health, which in turn affect the structure and function of soil microbial communities (Chen et al., 2021, Liu et al., 2020). Therefore, in addition to soil chemical properties, plant species characteristics and vitality have a considerable impact on the soil microbial community within the rhizosphere (Xu et al., 2022). The influence of soil pH dissolved organic carbon (DOC), available P (AP), available K (AK), fungi, and bacteria have demonstrated a positive effect on cucumber yield and quality, whereas soil electrical conductivity (EC) has a negative effect. These properties also interact with each other, and there is a strong correlation that indirectly affects cucumber yield and quality (Wang et al., 2021). Geographic variables of soil bacterial communities in apple orchards vary according to spatial scales, and environmental factors indirectly affect apple fruit quality by shaping soil bacterial communities (Chai et al., 2021). Climatic conditions, such as temperature and precipitation, can affect fruit quality by influencing the soil environment and shaping the community and metabolic activity of soil microorganisms (Chai et al., 2021, Pasternak et al., 2013, Jin et al., 2017). Similar findings have been observed in bamboo, as bamboo quality was determined to be dependent on the composition of the surrounding soil (Shi., 2019). Furthermore, soil texture, type, and fertility were important factors in determining the quality of bamboo shoots that were grown under similar climatic conditions, and changes in soil pH, total nitrogen (TN), and organic matter content of green bamboo (Dendrocalamopsis oldhami) of different origins affected reducing sugar, moisture, and total water-soluble sugar in fresh shoots (Zheng., 2012). A positive correlation between starch content of bamboo shoots and soil quick nitrogen content was found in a study of bamboo shoot quality of Dendrocalamus latiflorus shootin different landraces (Yu et al., 2020). Furthermore, bamboo shoot ash was significantly positively correlated with the total available phosphorus and hydrolyzed nitrogen and significantly negatively correlated with TN and magnesium (Yang et al., 2021).

Different geographical provenances are affected by different environmental factors; therefore, it is important to study soil fertility to maintain the yield and quality of D. brandisii shoots. However, the characteristics of soil microorganisms in different geographical environments remain unclear, and the relationship between soil microbes, environmental factors, and D. brandisii bamboo shoot quality has not been confirmed. In this study, the chemical properties and microbial communities of soils from different geographic seed sources of D. brandisii in Yunnan Province were investigated. The objectives of this study were to: (1) explore the relationship between soil microbial communities and the composition of D. brandisii forests in different geographical provenances, and (2) determine the relationships among soil microorganisms, environmental factors, and nutritional quality of bamboo shoots. This study aims to provide a scientific and theoretical reference for the cultivation and management of D. brandisii, microenvironmental regulation, and soil condition assessment. As a full understanding of the interactions among plant characteristics, soil chemical properties, and soil microorganisms is important for the scientific guidance of agricultural management and fertilization practices.

Study area profile

The sampling sites were selected as follows: Changning County, Baoshan City (CN), Cangyuan County, Lincang City (CY), Mang County, Dehong Prefecture (MS), Matai Township, Linxiang District, Lincang City (MT), Simao District, Pu'er City (SM), Shiping County, Honghe Prefecture (SP), and Xinping County, Yuxi City (XP). The basic characteristics of each sampling site are detailed in Table 1. All seven sampling sites comprised purely artificial forest communities managed using extensive methods. Samples were collected from bamboo shoots and the soil beneath bamboo forests between August 16 and September 8, 2022.

Table 1

Basic situation table of sampling sites
Sampling location	Longitude	Latitude	Altitude	Slope	Slope direction
CN	99°39′48″	24°31′32″	1229 m	10°	Western Slope
CY	99°14′43″	23°11′47″	1425 m	13°	Southwest Slope
MS	98°23′17″	24°26′37″	1022 m	13°	South Slope
MT	100°16′35″	23°45′57″	1051 m	15°	western Slope
SM	101°8′5″	22°44′17″	1236 m	17°	southwest Slope
SP	102°26′49″	23°44′22″	1457 m	10°	western Slope
XP	101°35′21″	24°0′28″	726 m	11°	Southwest Slope

Test method

Collection of soil samples

In each sampling area, five clumps of D. brandisii were selected as samples using the "Five-point method". The soil surface mulch was removed, and soil samples were collected from the 0–20 cm soil layer. These soil samples were thoroughly mixed to ensure homogeneity. The mixed soil sample was then divided into two parts. One part was packed into a 5 ml sterile centrifuge tube and promptly transferred to the laboratory (-80℃) under dry ice preservation. Upon arrival, it was stored in an ultra-low temperature refrigerator at -80°C. The remaining portion of the samples was stored in sterile sealed bags and transported back to the laboratory in a 4°C refrigerator for subsequent chemical property testing. All sampling procedures were conducted under aseptic conditions.

Bamboo shoot sample collection and processing

Bamboo shoots sampling selection of soil sampling point next to the bamboo clumps out of the soil 30cm, size based on uniformity, no pests and diseases affect the shoots, shoots without obvious hollow, no deformity, not dry shrinkage of D. brandisii bamboo shoots, bamboo shoots dug out intact, each sample of the ground to take 3 bamboo shoots, a total of 21 shoots samples.

The weight (g), length (cm) and base diameter (cm) of each shoot were measured immediately after sampling. Remove the shell of the bamboo shoot and weigh it, calculate the edible rate (%) of the shoot; The bamboo shoots were sliced lengthwise, placed on the prepared tin foil, and put into the oven. The bamboo shoots were killed at 120℃ for 30 minutes, then turned to 75℃ at constant temperature and baked to constant weight for the determination of nutritional indexes.

Determination of soil chemical properties

Soil pH was measured using a pH meter (FE20K, Mettler-Toledo, Switzerland) at a ratio of 2.5:1(water: soil) (zhang et al., 2023). Soil organic matter (SOM) was determined by the hydrothermal potassium dichromate oxidation colori-metric method (zhang et al., 2023). Soil total nitrogen (TN) was determined using the Kjeldahl distillation method (Jones and Willett., 2006). Soil total phosphorus (TP)was determined by NaOH fusion, Mo–Sb colorimetry, andultraviolet spectrophotometry (UV2600, Shimadzu, Japan) (Miranda et al., 2001). Soil available (AP) was analyzed by sodium bicarbonate extrac-tion molybdenum antimony resistance colorimetry (zhang et al., 2023). Soil total potassium (TK) was determined with a flamephotometer (FP6410, China) (zhang et al., 2023). Available potassium (AK) was measured by NH4CH3CO2extraction and atomic absorption spectrometry (zhang et al., 2023).

Soil DNA Extraction, Sequencing, and Amplification

Total genomic DNA was extracted from DNA samples using the MagAttract PowerSoil Pro DNA Kit (Qiagen), with subsequent assessment of DNA quality via agarose gel electrophoresis, and determination of DNA concentration and purity using NanoDrop2000. For the amplification of the V3-V4 variable region of the 16S rRNA gene, upstream Primer 338F (5'-Actcctacgggaggcagcag-3') and downstream primer 806R (5'-Ggactachvgggtwtctaat-3') (Liu et al., 2016) were utilized. The ITS1F region (ITS1F, CTTGGTCATTTAGGAAGTAA; ITS2R, GCTGCGTTCTTCATCGATGC) of the rRNA gene was amplified using ITS1F/ITS2R primers. The PCR reaction system (20 µL) comprised 10×Buffer (2 µL), 2.5 mM dNTPs (2 µL), Forward Primer (5 µM) (0.8 µL), Reverse Primer (5 µM) (0.8 µL), rTaq Polymerase (0.2 µL), BSA (0.2 µL), Template DNA (10 ng), with ddH2O added to make up the total volume to 20 µL. Amplification involved an initial predenaturation step at 95°C for 3 min, followed by 30 cycles (95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 45 s), with a final extension at 72°C for 10 min, and storage of the products at 4°C. Each sample underwent 3 replicates. A library of purified PCR products was constructed using the NEXTFLEX Rapid DNA-Seq Kit, with 3 replicates per sample. PCR products from the same samples were pooled and recovered on a 2% agarose gel, followed by purification using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA). The purified products were then subjected to electrophoresis on a 2% agarose gel and quantified using the Quantus™ Fluorometer (Promega, USA). Sequencing was performed using Illumina's Miseq PE300/NovaSeq PE250 platform (Shanghai Meiji Biomedical Technology Co., Ltd.), and the raw data were uploaded to the NCBI SRA database (serial number: PRJNA1060609).

Statistics and analysis of data

Raw sequencing data underwent quality control and sequence merging using Fastp (0.19.6) (Chen et al., 2018) and Flash (1.2.11) (Magoč and Salzberg, 2011). Subsequently, sequences were filtered and chimeras removed utilizing UPARSE (7.1) (Edgar, 2013; Stackebrandt and Goebel, 1994), with OTU clustering performed at 97% similarity. Annotation was conducted using RDP (2.11) (Wang et al., 2007) against the Silva 16S rRNA gene database (V138) and Unit database (V7.2), employing a confidence threshold of 70%. Mothur software (Schloss et al., 2009) (http://www.mothur.org/wiki/calculators) was employed to calculate Chao 1, Shannon, and other biodiversity indices, with between-group differences in Alpha diversity analyzed using the Wilxocon rank-sum test. Principal coordinate analysis (PCoA) based on the Bray-Curtis distance algorithm was utilized to assess the structural similarity of microbial communities among samples. Additionally, the Permanova nonparametric test was employed to analyze significant differences in microbial community structure among samples. The LEfSe analysis (Linear discriminant analysis Effect Size) (Segata et al., 2011) (http://huttenhower.sph.harvard.edu/LEfSe) was utilized to identify significant differences between samples, with the LDA set at 4. Distance-based redundancy analysis (db-RDA) was conducted to investigate the relationship between microbial communities and soil chemical properties, as well as the nutritional quality of bamboo shoots. The db-RDA analysis, based on the Bray distance algorithm, aimed to explore the correlation between microbial communities and soil chemical properties and bamboo shoot nutritional quality. The PLSPM software package of R (26.0) was employed to analyze the relationships among soil chemical properties, bacterial community structure, fungal community composition, and the nutritional quality of bamboo shoots. In partial least squares path modeling (PLS-PM) (Hulland, 1999; Chin, 2010), GOF was considered a measure of the overall explanatory power of the entire model, with higher values indicating better explanatory power. For statistical analysis, SPSS (26.0) was utilized, with the independent sample t-test employed to analyze significant differences in soil chemical properties and bamboo shoot nutritional quality among the seven provenances (P < 0.05).

Chemical properties of the soil

There is a wide variation in soil chemical properties among the different geographic seed sources of D. brandisii, as shown in Table 2. The seven main chemical indices differed significantly (P < 0.05) between the different regions. The pH value of soil in SP was significantly higher than that in CY (P < 0.05), and significantly higher than that in the CN, MS, MT, and SM (P < 0.01), SM soil was observed to be the most acidic. In addition to CN, MS and SM, the other four areas had higher soil nutrients, and the organic matter content in CY was significantly higher than that in MS, MT, and SM (P < 0.01). The content of soil AP in MT was the highest, and the difference was very significant (P < 0.01); the content of soil AP in the SP area was significantly higher than that in CN, MS, CY, and SM (P < 0.01). The TN content in XP was significantly higher than that in MS, MT, and SM (P < 0.05), and the lowest was observed in the MS. The content of total phosphorus in MT was the highest, followed by that in CY (P < 0.01), and was significantly higher than that in CN, MS, SM, SP and XP. The soil total potassium content in XP was the highest, and the difference was significantly higher than that in the other six regions.

Table 2

Soil chemical properties in different *D. brandisii* geographical provenances
Soil Factor	CN	CY	MS	MT	SM	SP	XP
pH**	5.13 ± 0.13bc	5.56 ± 0.20bc	4.92 ± 0.15bc	4.74 ± 0.01cd	4.33 ± 0.09d	6.50 ± 0.67a	5.80 ± 0.05ab
SOM*(g·kg^− 1)	49.24 ± 4.47ab	64.83 ± 8.99a	32.08 ± 3.89bc	30.78 ± 1.49bc	23.64 ± 2.44c	43.19 ± 2.55abc	53.10 ± 16.26ab
AP**(mg·kg^− 1)	14.43 ± 6.01b	5.88 ± 0.65b	3.24 ± 0.33b	57.85 ± 12.07a	13.80 ± 2.82b	3.67 ± 0.40b	5.71 ± 3.55b
AK**(mg·kg^− 1)	59.58 ± 15.21c	205.83 ± 54.95bc	68.33 ± 9.82c	361.67 ± 127.33ab	172.50 ± 62.37bc	498.33 ± 60.85a	372.08 ± 74.74ab
TN**(g·kg-¹)	2.13 ± 0.55ab	3.41 ± 0.63a	1.76 ± 0.27c	1.79 ± 0.10c	1.78 ± 0.29c	2.75 ± 0.15ab	3.45 ± 0.74a
TP**(g·kg^− 1)	0.56 ± 0.03bc	0.90 ± 0.05a	0.41 ± 0.02bc	0.97 ± 0.12a	0.38 ± 003c	0.46 ± 0.01bc	0.62 ± 0.12b
TK**(g·kg^− 1)	10.09 ± 0.74d	17.59 ± 2.81bc	19.09 ± 1.15b	14.20 ± 0.54cd	21.99 ± 0.98b	5.67 ± 0.31e	28.96 ± 1.58a

Values are mean ± SE; different letters in the same column indicate significant differences (P < 0.05), * and ** indicate significant differences at the 0.05 and 0.01 level, respectively. CN: Changning County, Baoshan City; CY: Cangyuan County, Lincang City; MS: Mang County, Dehong Prefecture; MT: Matai Township, Linxiang District, Lincang City; SM: Simao District, Pu'er City; SP: Shiping County, Honghe Prefecture; and XP: Xinping County, Yuxi City. SOM: soil organic matter; AP: available phosphorus; AK: available potassium; TN: total nitrogen; TP: total phosphorus; TK: total potassium.

Nutritional quality of bamboo shoots

Four appearance (individual weight, basal diameter, length, and edible rate) and eight nutritional quality indices (water content, soluble sugar, ash, crude fat, protein, lignin, cellulose, and tannin) were selected to measure the quality of D. brandisii bamboo shoots, and the results are shown in Fig. 2A–L. The appearance quality showed that the individual weight of the bamboo shoots was highest in CY, followed by MS and CN, which were significantly (P < 0.05) higher than those of bamboo shoots from MT, SM, and XP. The basal diameter of bamboo shoots in MS was highly significant (P < 0.01) in CN, CY and SP; the length of bamboo shoots in CN was the largest and highly significant (P < 0.01) and was higher than that of MT, SM, SP, and XP, and was not significantly different from CY and MS. The edible rate of bamboo shoots was highly significant (P < 0.01) in SP. There were significant differences in the appearance and morphology of D. brandisii bamboo shoots grown in natural environments of different geographies, and there were no significant correlations between shoot length, weight, basal diameter, and palatability.

Nutritional quality of D. brandisii bamboo shoots in SP and XP had significantly (P < 0.05) lower water content than CN, MS, CY and MT. The soluble sugar content was significantly higher in MS (P < 0.01) and CY (P < 0.05) than compared to CN, MT, SM, and XP. The ash content of MS (P < 0.01) bamboo shoots was significantly lower than that of CN, MT, SM, SP, and XP, whereas CY (P < 0.05) was significantly lower than that of MT and SM. The crude fat content of MT bamboo shoots was significantly (P < 0.05) higher than that of CY, SM and XP; SM bamboo shoots had the highest protein content, which was not significantly different from that of MT, SP, and XP, and MS had significantly (P < 0.05) lower content than CN, MT, SM, SP, and XP, lignin was highly significant (P < 0.01) in SM bamboo shoots than in MS and SP, and significantly higher (P < 0.05) than in CY, MT, and XP; XP bamboo shoots had the highest cellulose content, which was significantly different from CN, SM and XP. The tannin content of CN bamboo shoots was significantly (P < 0.05) higher than that of MS, MT, SM, and SP. Overall, the nutrient composition of D. brandisii bamboo shoots from different geographic seed sources varied considerably, with different degrees of variation in different nutrient components, with the nutritional quality of D. brandisii bamboo shoots in CN being better on the whole. The CN regional seed source has been approved by the Forestry and Grassland Bureau of the State Forestry and Grassland Bureau of the Forestry and Tree Species Validation Committee on January 25, 2022, "Yun Sweet No. 1" Sweet Longzhu as a national grade good seed, good seed number: State S-SV-DB-016-2021 (with Fig. 1).

Diversity of soil microbial community

A total of 910389 bacterial sequences were obtained from 21 soil samples collected from seven provenances, which were effectively classified into 6885 operational taxonomic units (OTUs) with 97% similarity, comprising of 2096 species belonging to 1001 genera, 511 families, 308 orders, 127 classes, and 40 phyla. The total number of available sequences of soil fungi was 903506, which can be divided into 7021 OTUs, including 1627 species, 901 genera, 375 families, 156 orders, 16 phyla, and 63 classes. A one-way analysis of variance (ANOVA) was performed for bacterial and fungal communities in the soil samples.

The soil microbial community diversity index of different geographical provenances showed a significant difference (P < 0.05) when comparing the α diversity of a microbial community (Fig. 3A–F), in the bacterial community, the Shannon index was significantly different between SM and CN (P < 0.05), the ACE index of fungi community was significantly different from that of SP and XP (P < 0.05), CY in Sobs index was significantly different from CN and XP (P < 0.05) and highly significantly different from SP (P < 0.01). Principal coordinate analysis (PCoA) of the bacterial and fungal communities showed that the microbial communities in the soil samples from different geographical D. brandisii provenances were significantly different. Specifically, fungal PCoA (Fig. 3H) exhibited more pronounced clustering between samples compared with bacterial PCoA (Fig. 3G), and the soil fungal communities in the CN region were more distant and different from those in the other 6 regions. Both SP and XP bacteria and fungi showed clusters, and the species composition of the microbes in the two samples was similar. In addition, analysis of similarities (ANOSIM) showed that different geographic provenances had significant effects on the structure of soil bacteria (r2 = 0.8342, P = 0.001) and fungal communities (r2 = 0.7939, P = 0.001) (Fig. 3G, H).

Soil microbial composition

The soil bacteria in the seven regions belonged to 998 genera, 509 families, 307 orders, 127 classes, and 40 phyla, as shown in Fig. 4A–D. Proteobacteria (19.78–29.06%), Actinobacteria (13.53–30.01%), Chloroflexi (8.03–31.47%), and Acidobacteria (7.12–19.17%) were the dominant Chloroflexi in the soil bacterial community and together accounted for more than 70% of the total bacterial community in each soil sample (Fig. 4A, Table S1). The relative abundance of Proteobacteria was the highest in SP (29.06%) and lowest in CN (19.78%); the relative abundance of Actinobacteria was the highest in XP (37%) and lowest in CN (13.53%); and the relative abundance of Campylobacter was the highest in CN (31%) and lowest in MT (8.03%). The dominant bacterial genera in all soil samples were Xanthobacteraceae (2.83–7.29%), AD3 (0.35–13.68%), Acidothermus (0.62–8.06%), and Gaiellales (0.94–8.64%), respectively (Fig. 4C, Table S2).

Soil fungi in the seven regions belong to 901 genera, 375 families, 156 orders, 63 classes, and 16 phyla, and the dominant fungal phyla were Ascomycota (41.72–62.44%) and Basidiomycota (18.72–45.23%), which accounted for more than 79% of the total fungal community in each soil sample (Fig. 4B, Table S3). The MT (65.01%) and CY (62.44%) regions had the highest relative abundances of ascomycetes, whereas SP had the lowest (41.72%). However, SP had the highest relative abundance of Ascomycota (45.23%), and CY had the lowest (18.72%). The dominant fungal genera of the seven geographic soil samples varied, with unclassified_p_Ascomycota and Archaeorhizomyces in CN, Mortierella and Exophiala in CY, unclassified_c_Agaricomycetes and Trechispora in MS, Penicillium and unclassified_c_Sordariomycetes with the highest abundance in MT, Saitozyma and Apiotrichum in SM, and Agaricus in SP and XP (Fig. 4D, Table S4). This result suggests that the microbial community structure varies significantly under natural conditions in different geographies and that fungal communities are more influenced by the environment.

Analysis of soil microbial abundance

Using the linear discriminant analysis effect size (LEfSe), the 21 most abundant microbial taxa with significant differences in abundance between genera were identified in the soil samples (Fig. 5A, B). This analysis revealed 21 taxonomic branches exhibiting different abundances of bacterial biomarkers (Fig. 5A, Table S5). The CY and MS samples had the least number of bacterial taxa, with significant differences in one genus each (Methyloligellaceae and 1921-2, respectively), followed by MT and SP, with significant differences between the two genera. In contrast, soil samples from site CN showed the highest number of bacterial taxa, including AD3, Acidobacteriae, Subgroup_2, Elsterales, HSB_OF53-F07, WPS-2, and FCPS473. Meanwhile, a total of 15 evolutionary clades of fungi with significant differences in abundance were identified in this study (Fig. 5B, Table S6). Among them, soil samples from MT, XP, and CY had the least number of fungal taxa, with only one genus demonstrating notable variation, namely Psathyrella, Trechisporales, and Mortierella, followed by CN and SP, with two genera. In contrast, soil samples from MS contained the highest number of fungal taxa, including five genera: Trechispora, Agaricomycetes, Pyrenochaeta, Agaricales, and Cordana.

Relationship between soil chemical properties, microbial communities, and bamboo shoot quality

Partial least squares path modeling (PLS-PM) analysis

The PLS-PM analysis of the soil chemical properties, microbial community structure, and bamboo shoot quality was performed, and the results are shown in Fig. 6A, B. Both soil chemical properties and microbial community structure had direct positive effects on bamboo shoot quality. The direct effect coefficient of the soil bacterial community on D. brandisii bamboo shoot quality was 0.865. As shown in Fig. 6, the total effect of soil bacterial community (0.865) and soil chemical properties (0.856) on bamboo shoot quality, including direct and indirect effects, was significant; the total effect of fungal community structure on bamboo shoot quality was 0.69, which was less than that of bacterial community structure and soil chemical properties, and the indirect effects of bacterial community and soil chemical properties on bamboo shoot quality was less than that of the fungal community structure.

To further explore the relationship among the three, db-RDA analysis was performed on soil microorganisms of D. brandisii bamboo from different geographical seed sources to investigate the relationship between soil factors, bamboo shoot quality, and microbial communities. Seven nutrient indicators of bamboo shoots were selected as water content, soluble sugar, ash content, crude fat, protein, lignin, cellulose, and tannin, the results showed that pH, AP, and AK were the main soil properties affecting the bacterial community structure (r2 = 0.35, P = 0.019 for pH, r2 = 0.325, P = 0.022 for AP and r2 = 0.43, P = 0.008 for AK) (Fig. 7A, Table S7). Soil pH, SOM, AK, and TN were the main factors affecting the fungal community structure (r2 = 0.669, P = 0.001 for pH; r2 = 0.46, P = 0.012 for SOM; r2 = 0.47, P = 0.003 for AK; and r2 = 0.367, P = 0.021 for TN) (Fig. 7B, Table S8). In particular, soil pH and fast-acting potassium levels affect the structure of both bacterial and fungal communities. Bamboo shoot water content, soluble sugar, ash content, protein, and lignin content were strongly influenced by the bacterial community, whereas bamboo shoot water content and tannin were strongly influenced by the fungal community.

The top 20 species in terms of relative abundance at the bacterial and fungal phyla levels were selected for Pearson correlation analysis, as shown in the heatmap (Fig. 7C, D). The major effects on the nutrition of D. brandisii bamboo shoots were Actinobacteriota, Chloroflexi, Patescibacteria, GAL15, and Cyanobacteria (Fig. 7C). At the level of fungal phyla, those that have a greater impact on the nutrition of bamboo shoots include Basidiomycota, Kickxellomycota, Mucoromycota, unclassified-k-Fungi, and Glomeromycota (Fig. 7D). Among them, crude fat, cyanobacteria, and Chytridiomycota, demonstrated a significant positive correlation (P < 0.05). Protein was significantly and positively correlated with Patescibacteria and Actinobacteriota, (P < 0.05). Water content was significantly and positively correlated with Chloroflexi (P < 0.05) and significantly and negatively correlated with Actinobacteriota, (P < 0.05); tannin was significantly positively correlated (P < 0.05) with GAL15 and Kickxellomycota, Mucoromycota, and unclassified-k-Fungi; lignin and Basidiomycota demonstrated a significant positive correlation (P < 0.05). Protein and Glomeromycota showed a significant negative correlation (P < 0.05). The soluble rate and Glomeromycota showed significant positive correlation (P < 0.05).

Relationship between soil nutrients and soil microorganisms

The structure and diversity of soil microbial communities are not only affected by external factors such as climatic conditions, vegetation types, soil types, and human activities, but are also affected by intrinsic factors such as soil properties and nutrient content. These are closely related to soil microbial growth and are highly sensitive to change, with close relationships and interactions existing between factors (Griffiths et al., 2011, Wang et al., 2024). However, it is difficult to determine the consistent effects of land management on soil microbial ecophysiology because intensive land use and its impact on soil properties such as pH, bulk density, and water content often depend on specific sites and environments (Frey et al., 2013, Six et al., 2006). Previous studies have shown that soil chemical properties affect soil microbial communities. For example, AP, total potassium, pH, and AK are the main factors affecting bacterial communities (Zhou et al., 2022). It was observed that both pH and organic matter influenced the bacterial diversity at different taxonomic levels, and they are environmental factors driving bacterial community distribution (Cui et al., 2023). Available nitrogen, soil organic matter, AK, and pH are the main factors influencing soil fungal community composition (Guo et al., 2022). Total potassium and pH significantly affected the soil fungal community structure and abundance (Zhu et al., 2023). Soil pH and nutrients affected the microbial community diversity (Ying et al., 2017). In this study, the seven sample plots showed notable differences in soil bacterial and fungal community structure and diversity under the same D. brandisii seed source, planting years, and agricultural management. The pH of each plot sampled in this study ranged from 4.33 to 6.50, and RDA analysis revealed that soil pH had a substantial effect on the bacterial and fungal communities. The results show that soil pH is a key factor affecting microbial community structure, which is consistent with previous studies on biophysical processes of microbial diversity in soil (Tecon., 2017). A similar finding was determined with AK, indicating that soil microbial community structure was closely related to potassium nutrition, it is also demonstrated that AK is an important factor affecting the change of microbial community structure, which is consistent with studies by Tian and Zhao (Tian et al., 2016, Zhao et al., 2022). The content and proportion of AK in the soil may be the key to maintaining the stability of soil microbial communities. The sample sites were mainly pure forests of D. brandisii with a relatively homogeneous vegetation distribution, and soil-limiting resources had a notable effect on the relative abundance of soil bacteria and fungi (Ding et al., 2021, Wei et al., 2020). Therefore, N, P, and K should be reasonably distributed during the cultivation of D. brandisii, and attention should be paid to the application of potash fertilizer.

Effects of soil properties on bamboo shoot quality

Shoot quality is an important research topic in bamboo biology, ecology, and silviculture. Soil plays an important role in bamboo shoot quality in terms of their appearance and nutritional quality, therefore, the factors affecting the quality of bamboo shoots are complex and numerous (Bao et al., 2018, Zheng et al., 2019). The results showed that the effects of different soil nutrient factors on the nutritional quality of bamboo shoots were different; there was a negative correlation between SOM and crude fiber content, whereas a positive correlation between soil pH and soluble sugar content of D. oldhami shoots were observed (Zheng., 2012). In this study, the contents of the chemical elements and bamboo shoot quality in the soils of different geographic seed sources of D. brandisii were substantially different in the seven regions, and correlation analyses demonstrated that soil nutrients had an effect on the formation of bamboo shoot quality, especially soil pH, AK, and TN. Soil AK was significantly negatively correlated with Water content, Individual weight, and highly significantly negatively correlated with the length of D. brandisii bamboo shoots. Soil TN and bamboo shoot water content were significantly negatively correlated. There was a significant negative correlation between TK in soil and the edible rate of bamboo shoot. In this regard, bamboo shoots with special nutritional qualities can be cultivated by changing the content of certain nutrient elements in the soil during the cultivation process of D. brandisii in order to improve the quality of bamboo shoots. The content of TN and organic matter in the soil mainly affects the crude fiber content of bamboo shoots, and the high content of AK and total K in the soil is beneficial for the absorption and accumulation of K and P in bamboo shoots (Li et al., 2017). The relationship between apple fruit quality and soil nutrients was studied by Beibei et al. (Zhou et al., 2016), who found that SOM, AK, available nitrogen, AP, and soil pH had different effects on fruit quality, among which soil pH had the greatest effect (Yan et al., 2020, Cao et al., 2021). Therefore, soil factors have an important influence on differences in the nutritional quality of bamboo shoots of D. brandisii in different origins. It is inferred that the difference in bamboo shoot quality is coordinated by environmental factors, and different nutrient quality indices are affected by soil nutrient factors; the same nutrient factors affect different nutrient quality indices of bamboo shoots, and there are complex and interactive effects between soil nutrients and bamboo shoot nutritional quality.

Effect of soil microorganism on bamboo shoot quality

Soil bacterial and fungal communities provide nutrients for plant growth and play important roles in soil metabolism, organic matter decomposition, nutrient cycling and transformation, and the balance of soil nutrient supply, further affecting fruit quality. In this study, there were considerable differences observed in the soil microbial structure of D. brandisii in the seven districts, including Actinobacteria, Chlorflexi, Firmicutes, Xanthobacteriaceae, and Ktedonobacteraceae, which are the bacterial taxa Mortierellomycota, Glomeromycota, Blastocladiomycota, Agaricaceae, Trimorphomycetaceae, and other fungal groups. The dominant soil microbial taxa in the seven districts were Proteobacteria, Actinobacteria, Chloroflexi, Acidobacteria, Ascomycota, and Basidiomycota. Among them, the highest relative abundance of Proteobacteria was found in SP, where the typical oligotrophic bacteria were Acidobacteria and the eutrophic bacteria were Ascomycetes, adapted to soil environments with high nutrient content (Fierer et al., 2012). Therefore, the relative abundances of Aspergillus and Acidobacterium phyla can be used for soil quality assessments (Shao et al., 2019). The relative abundance of Acidobacteria was highest in CN, suggesting that this taxon may be sensitive to soil carbon accessibility or soil pH. It has been shown that this taxon is mainly driven by soil pH and negatively correlated with soil pH (Lauber et al., 2008). Chioroflexi was the dominant species in D. brandisii forests and had the highest relative abundance in CN. It can simply utilize organic matter for Chloroflexi heterotrophic growth in a nutrient-rich environment, promote the use of C, N, S, and other elements in the soil cycle, further improving the nutrient content in the soil, but also through dissolved phosphorus to promote the transformation of phosphorus elements and use efficiency, provide phosphorus nutrients for the soil, promote nutrient absorption in the root system, and maintain its balance with the microenvironment (Xian et al., 2020, Guo et al., 2023). Xinping County, Yuxi City (XP) had the highest relative abundance of actinomycetes, indicating it’s low water tolerance (Pointing et al., 2009, Fierer et al., 2012). In this study, Acidobacteria, Proteobacteria, and Actinobacteria were the dominant soil communities in the seven regions, which was consistent with the wide ecological range of Acidobacteria, Proteobacteria, and Actinobacteria. The distribution of characteristics less affected by the environment and changes in environmental characteristics less affected by all three were characterized as dominant communities in soils from different regions (Teng et al., 2017, Xue et al., 2016). Basidiomycetes degrade lignin, which can be used as an indicator of soil microbial biomass and soil quality (Yao et al., 2023). Basidiomycetes are abundant in environments with a good soil quality. Bacillus and Clostridium, belonging to the phylum Firmicutes, play important roles in carbohydrate metabolism (Zhang et al., 2016). The family Ktedonobacteraceae is a subfamily of Chloroflexi that plays an important role in maintaining the structure and function of rhizosphere soil bacterial communities (Wang et al., 2018). These enriched bacterial and fungal taxa have some capacity for nutrient cycling or the production of secondary metabolites and play important roles in soil nutrient cycling (Sharrar et al., 2020, Gavriilidou et al., 2022). In this study, bamboo shoot quality was directly and indirectly affected by the production of soil bacterial and fungal communities, which may be due to the formation of a stable relationship between microbial communities and a variety of physical and chemical factors over a long period of time, they play a role in the process of soil substance circulation, and the difference of species in different regions leads to the difference of bamboo shoot quality. The plant-soil-microbe benign interaction can be controlled by fertilization and other measures, such as supplying plant nutrients, changing soil properties, promoting soil microbes to play their roles, and regulating soil microbes; however, further research is needed to improve the quality of bamboo shoots.

The soil properties and shoot quality of D. brandisii from different provenances were determined by PCR and sequencing, and significant differences were observed in soil nutrient properties, soil microbial community diversity, and species composition on the spatial scale. Soil microbes played a bridging role in soil and plants, and can transform the nutrients provided by soil into forms that can be absorbed and utilized by plants. They can also react to soil through changes in community structure and function to maintain the dynamic equilibrium of the soil microenvironment. Soil pH and AK simultaneously affect the soil microbial community structure. In addition, the changes in soil properties and soil microbes in different provenances can be used to explain the significant changes in bamboo shoot quality. The soil bacterial community mainly affected the water, soluble sugar, ash, and protein and ligand contents of bamboo shoots, and the fungal community mainly affected the water and tannin contents of bamboo shoots. This study not only identified the core microbial species of D. brandisii forest land from different geographical provenances, but also emphasized the important role of soil factors in plant quality. It is necessary to consider not only the source of seeds, but also the synergistic interaction between soil properties and soil microorganisms to enhance the quality of bamboo shoots.

AK: available K; ANOSIM: analysis of similarities; ANOVA: analysis of variance ; AP: available P; CN: Changning County, Baoshan City ; CY: Cangyuan County, Lincang City; DOC: dissolved organic carbon; EC: electrical conductivity; MS: Mang County, Dehong Prefecture; MT: Matai Township, Linxiang District, Lincang City; OUT: operational taxonomic units; PCoA: principal coordinate analysis; PLS-PM: partial least squares path modelling; RDA: redundancy analyses; SM: Simao District, Pu'er City; SOM: soil organic matter; SP: Shiping County, Honghe Prefecture; TK: total potassium; TN: total nitrogen; TP: total phosphorus; XP: Xinping County, Yuxi City

Acknowledgements

We would like to thank the staff of Southwest Forestry University for providing the research platform and logistics services.

Declaration of Competing Interes

No conflicts of interest are declared by any author.

Funding

This study was funded by the National Key Research and Development Project of China (2021YFD2200501), Basic Research Project in Yunnan Province, China (202201AT070053), Agriculture Joint Special Project of Yunnan Province (202301BD070001-123). Monitoring Project of Bamboo Forest Ecosystem Positioning Observation and Research Station in South Yunnan, China (2022–YN–15).

Author contributions

Qian Chen and Jianjie Cao: Visualization, Investigation, Writing-original draft. Manyun Zhang: Conceptualization Writing-review & editing. Lei Guo: Conceptualization, Writing-review & editing. Negar Omidvar: Conceptualization, Writing-review & editing. Zhihong Xu: Conceptualization, Writing-review & editing. Chaomao Hui: Supervision, Funding acquisition, Investigation, Resources, Writing-original draft, Writing-review & editing. Weiyi Liu: Funding acquisition, Investigation, Resources, Writing-original draft, Writing-review & editing. All authors contributed to the article and approved the submitted version.

Bao LR, Jia ZM, Li Y, Wang JB (2018) Evaluation of nutritional and safe quality of Chimonobambusa utilis bamboo shoots and the surrounding soil in Nanchuan, Chongqing. Geophysical and Geochemical Exploration 42:1089-1094. https://doi.org/10.11720/wtyht.2018.0013
Cao S, Zhou WJ, Liu P, Tan J, Song B (2021) Multivariate Analysis and Optimization of Relationship Between Soil Nutrients and Fruit Quality in C. sinensis (L.) Osbeck Orchard. Soils 53: 97–104. https://doi.org/10.13758/j.cnki.tr.2021.01.013
Chai X, Yang Y, Wang X, Hao P, Wang L, Wu T, Zhang X, Xu X, Han Z, Wang Y (2021) Spatial variation of the soil bacterial community in major apple producing regions of China. Journal of applied microbiology 130:1294–1306. https://doi.org/10.1111/jam.14878
Chen LL, Xu HB, Wu SY, Baoyin T (2021) Plant and soil properties mediate the response of soil microbial communities to moderate grazing in a semiarid grassland of northern China. Journal of environmental management 284:112005. https://doi.org/10.1016/j.jenvman.2021.112005
Chen SF, Zhou YQ, Chen YR, Gu J (2018) fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics (Oxford, England) 34(:i884–i890. https://doi.org/10.1093/bioinformatics/bty560
Chin, WW (2010) How to write up and report PLS Analyses. Handbook of partial least squares: Concepts, methods and applications. Esposito Vinzi, V, 645-689.
Cui FX, Yang LB, Pan H, Jiang YB, Wei D, Zhou T (2023) Responses of soil bacterial composition and diversity to snow cover in cold temperate larch forests. Journal of Central South University of Forestry & Technology 43:132-143. https://doi.org/10.14067/j.cnki.1673-923x.2023.01.014
Ding YP, Du YJ, Gao GL, Zhang Y, Cao HY, Zhu BB, Yang SY, Zhang JX, Qiu Y, Liu HL (2021) Soil bacterial community structure and functional prediction of Pinus sylvestris var. mongolica plantations in the Hulun Buir Sandy Land. Acta Ecologica Sinica 41:4131-4139. https://doi.org/10.5846/stxb202005251335
Dini-Andreote F, Brossi MJDL, Elsas JDV, Salles JF (2016) Reconstructing the Genetic Potential of the Microbially-Mediated Nitrogen Cycle in a Salt Marsh Ecosystem. Frontiers in microbiology 7:902. https://doi.org/10.3389/fmicb.2016.00902
Edgar RC (2013) UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nature methods 10:996–998. https://doi.org/10.1038/nmeth.2604
Fierer N, Lauber CL, Ramirez KS, Zaneveld J, Bradford M A, & Knight R (2012) Comparative metagenomic, phylogenetic and physiological analyses of soil microbial communities across nitrogen gradients. The ISME journal 6:1007-1017. https://doi.org/10.1038/ismej.2011.159
Fierer N, Leff JW, Adams BJ, Nielsen UN, Bates ST, Lauber CL, & Caporaso JG (2012) Cross-biome metagenomic analyses of soil microbial communities and their functional attributes. Proceedings of the National Academy of Sciences 109:21390-21395. https://doi.org/10.1073/pnas.1215210110
Frey SD, Lee J, Melillo JM, Six J (2013) The temperature response of soil microbial efficiency and its feedback to climate. Nature Climate Change 3:395-398. https://doi.org/10.1038/NCLIMATE1796
Gavriilidou A, Kautsar SA, Zaburannyi N, Krug D, Müller R, Medema MH, & Ziemert N (2022) Compendium of specialized metabolite biosynthetic diversity encoded in bacterial genomes. Nature microbiology 7:726-735. https://doi.org/10.5281/zenodo.6365726
Griffiths RI, Thomson BC, James P, Bell T, Bailey M, Whiteley AS (2011) The bacterial biogeography of British soils. Environmental microbiology 13:1642–1654. https://doi.org/10.1111/j.1462-2920.2011.02480.x
Guo P, Xing PJ, Song J, Wu LL, Li BQ, Si YJ, Li Y, Ji EQ (2022) Fungal Community in Roots and the Root Zone of Quercus mongolica and the Correlations with the Environmental Factors. Journal of Fungal Research 20:173-182. https://doi.org/10.13341/j.jfr.2022.1489
Guo XW, Xiang GQ, Zhang FZ, Jiang S, Min W (2023) Effects of Biochar and Straw Return on Soil Microbial Community Characteristics and Functional Differences in Saline Water Drip Irrigation Cotton Fields. Environmental Science 1-18[2024-03-07]. https://doi.org/10.13227/j.hjkx.202308051
Hui CM, He XH, Liu WY, Shi ZJ, Sun MS (2022) Promoting the Development of Dendrocalamus brandisii Industry for Rural Vitalization. World Bamboo and Rattan 20:66-69. https://doi.org/ 10.12168 /sjzttx.2022.01.013
Hui CM, Liu WY, Zhang GX, Shi M, Lu DW, Zou XM (2019) Exploitation and Breeding of Excellent Germplasm Resources of Dendrocalamus brandisii. Journal of Bamboo Research 38:26-30. https://doi.org/10.19560/j.cnki.issn1000-6567.2019.04.006
Hulland J (1999) Use of partial least squares (PLS) in strategic management research: A review of four recent studies. Strategic management journal 20:195-204. https://doi.org/10.1002/(SICI)1097-0266(199902)20:2<195::AID-SMJ13>3.0.CO;2-7
Jones DL, Willett VB (2006) Experimental evaluation of methods to quantify dissolved organic nitrogen (DON) and dissolved organic carbon (DOC) in soil. Soil Biology and biochemistry 38:991-999. https://doi.org/10.1016/j.soilbio.2005.08.012
Jin T, Wang Y, Huang YY, Xu J, Zhang PF, Wang N, Liu X, Chu HY, Liu G, Jiang HG, Li YZ, Xu J, Kristiansen K, Xiao L, Zhang YZ, Zhang GY, Du GH, Zhang HB, Zou HF, Zhang HF, Jie ZY, Liang SS, Jia HJ, Wan JW, Lin DC, Li JY, Fan GY, Yang HM, Wang J, Bai Y, Xu X (2017) Taxonomic structure and functional association of foxtail millet root microbiome. GigaScience 6:1–12. https://doi.org/10.1093/gigascience/gix089
Lauber CL, Strickland MS, Bradford MA, & Fierer N (2008) The influence of soil properties on the structure of bacterial and fungal communities across land-use types. Soil Biology and Biochemistry 40:2407-2415. https://doi.org/10.1016/j.soilbio.2008.05.021
Li Y, Zhang LL, Zhang Y, Zhang YY, Zhang L, Sun YD (2017) Nutrition components and soil nutrients response characterisitcs of Phyllostachys edulis ‘Pachyloen’ shoots from different habitats. Nonwood Forest Research 35:147-154. https://doi.org/10.14067/j.cnki.1003-8981.2017.04.022
Liu CS, Zhao DF, Ma WJ, Guo YD, Wang AJ, Wang QL, Lee D J (2016) Denitrifying sulfide removal process on high-salinity wastewaters in the presence of Halomonas sp. Applied microbiology and biotechnology 100:1421–1426. https://doi.org/10.1007/s00253-015-7039-6
Liu LL, Huang XQ, Zhang JB, Cai ZC, Jiang K, Chang YY (2020) Deciphering the relative importance of soil and plant traits on the development of rhizosphere microbial communities. Soil Biology and Biochemistry 148:107909. https://doi.org/10.1016/j.soilbio.2020.107909
Miranda KM, Espey MG, Wink DA (2001) A rapid, simple spectrophotometric method for simultaneous detection of nitrate and nitrite. Nitric oxide 5:62-71. https://doi.org/10.1006/niox.2000.0319
Magoč T, Salzberg SL (2011) FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatics (Oxford, England) 27:2957–2963. https://doi.org/10.1093/bioinformatics/btr507
Pasternak Z, Al-Ashhab A, Gatica J, Gafny R, Avraham S, Minz D, Gillor O, & Jurkevitch E (2013) Spatial and temporal biogeography of soil microbial communities in arid and semiarid regions. PloS one 8:e69705. https://doi.org/10.1371/journal.pone.0069705
Pointing SB, Chan Y, Lacap DC, Lau MC, Jurgens JA, & Farrell RL (2009) Highly specialized microbial diversity in hyper-arid polar desert. Proceedings of the National Academy of Sciences 106:19964-19969. https://doi.org/10.1073/pnas.0908274106
Schloss PD, Westcott SL, RyabinT, Hall JR, Hartmann M, Hollister EB, Lesniewski RA, Oakley BB, Parks DH, Robinson CJ, Sahl JW, Stres B, Thallinger GG, Van Horn DJ, Weber CF (2009) Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Applied and environmental microbiology 75:7537–7541. https://doi.org/10.1128/AEM.01541-09
Segata N, Izard J, Waldron L, Gevers D, Miropolsky L, Garrett WS, Huttenhower C (2011) Metagenomic biomarker discovery and explanation. Genome biology 12:R60. https://doi.org/10.1186/gb-2011-12-6-r60
Shao Y, Cao SP, Liu CH, Luo MJ (2019) Bacterial diversity in soils of Nanniwan wetland based on high-throughput sequencing. Journal of Arid Land Resources and Environment 33:158-163. https://doi.org/10.13448/j.cnki.jalre.2019.057
Sharrar AM, Crits-Christoph A, Méheust R, Diamond S, Starr EP, & Banfield JF (2020) Bacterial secondary metabolite biosynthetic potential in soil varies with phylum, depth, and vegetation type. MBio 11:10-1128. https://doi.org/10.1128/mbio.00416-20
Shi JS (2019) Preliminary Study on the Environmental Effect and Improvement of Phyllostachys Prominens Bamboo Shoot Quality Formation. Chinese a Academy of Forestry. https://doi.org/10.27625/d.cnki.gzlky.2019.000187
Six J, Frey SD, Thiet RK, & Batten KM (2006) Bacterial and fungal contributions to carbon sequestration in agroecosystems. Soil Science Society of America Journal 70:555-569. https://doi.org/10.2136/sssaj2004.0347
Stackebrandt E, Goebel BM (1994) Taxonomic Note: A Place for DNA-DNA Reassociation and 16S rRNA Sequence Analysis in the Present Species Definition in Bacteriology. Int. j. syst. Bacteriol 44:846-849. https://doi.org/10.1099/00207713-44-4-846
Tecon R, & Or D (2017) Biophysical processes supporting the diversity of microbial life in soil. FEMS microbiology reviews 41:599-623. https://doi.org/10.1093/femsre/fux039
Teng JL, Jia RL, Zhao Y (2017) Impact of sand burial on bacterial community structure and diversity within biocrusts dominated by Bryum argenteum. Acta Ecologica Sinica 37:21390-21395. https://doi.org/10.5846/stxb201601010002
Tian J, Wang J, Dippold M, Gao Y, Blagodatskaya E, & Kuzyakov Y (2016) Biochar affects soil organic matter cycling and microbial functions but does not alter microbial community structure in a paddy soil. Science of the Total Environment 556:89-97. https://doi.org/10.1016/j.scitotenv.2016.03.010
Wang AL, Ma R, Ma YJ, Liu T, Tian YS, Dong ZH, Chai QD (2024) Effects of compound sand control measures on soil bacterial community structure and function. Acta Prataculturae Sinica 33:46-60. https://doi.org/10.11686/cyxb2023140
Wang FL, Wang XX, Song NN (2021) Biochar and vermicompost improve the soil properties and the yield and quality of cucumber (cucumis sativus l.) grown in plastic shed soil continuously cropped for different years. Agriculture Ecosystems & Environment 315:107425. https://doi.org/10.1016/j.agee.2021.107425
Wang HH, Chu HL, Dou Q, Xie QZ, Tang M, Sung CK, & Wang CY (2018) Phosphorus and nitrogen drive the seasonal dynamics of bacterial communities in Pinus forest rhizospheric soil of the Qinling Mountains. Frontiers in Microbiology 9:1930. https://doi.org/10.3389/fmicb.2018.01930
Wang Q, Garrity GM, Tiedje JM, Cole JR (2007) Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Applied and environmental microbiology 73:5261–5267. https://doi.org/10.1128/AEM.00062-07
Wei P, An SZ, Dong YQ, Sun ZJ, Bieerdawulieti X, Li C (2020) A high-throughput sequencing evaluation of bacterial diversity and community structure of the desert soil in the Junggar Basin. Acta Prataculturae Sinica 29:182-190. https://doi.org/10.11686/cyxb2019337
Xian WD, Zhang XT, Li WJ (2020) Research status and prospect on bacterial phylum Chloroflexi. Acta Microbiologica Sinica 60:1801–1820. https://doi.org/10.13343/j.cnki.wsxb.20200463
Xu SY, Peng S, Lin XG, Wang YM, Dai X, Chu YG, Huang XC (2022) Analysis of Differences in Soil Chemical Properties and Microbial Communities in Bingtang Orange Orchards ith Different Quality. Journal of Nuclear Agricultural Sciences 36:456-1465. https://doi.org/10.11869/j.issn.100-8551.2022.07.1456
Xue JZ, Xiao NY, Wang Q, Wu HX (2016) Seasonal variation of bacterial community diversity in Yangshan Port. Acta Ecologica Sinica 36:7758-7767. https://doi.org/10.5846/stxb201512102472
Yan LL, Yue K, Song LH (2020) Correlation between fruit quality and soil fertility and leaf nutrients of Zizyphus jujuba ‘Lingwuchangzao’. Journal of Zhejiang A&F University 37:631–638. https://doi.org/10.11833/j.issn.2095-0756.20190462
Yang LT, Xie YY, Yu WX, Chen SL, Gou ZW, Xu S, Gu R (2021) Effects of Long-term Mulching on Appearance, Nutrition and Taste of Bamboo Shoots of Phyllostachys violascens. Journal of Bamboo Research 40:7-12. https://doi.org/10.19560/j.cnki.issn1000-6567.2021.03.008
Yao LJ, Tian CL, Wang LH, Du J, Xiao YZ, Yuan BQ (2023) Changes of soil biochemical properties and microbial community in continuous cropping of watermelon under Greenhouse Cultivation. Soil and Fertilizer Sciences in China 1-13[2024-03-08]. https://doi.org/10.11838/sfsc.1673-6257.23205
Ying J, He J, Wang N, Li X, Bai Y, & Lan Z (2017) Contrasting effects of nitrogen forms and soil pH on ammonia oxidizing microorganisms and their responses to long-term nitrogen fertilization in a typical steppe ecosystem. Soil Biology and Biochemistry107:10-18. https://doi.org/10.1016/j.soilbio.2016.12.023
Yu ZJ, Yin B, Zhao T, Xu WD, Rong JD, He TY, Chen LG, Zheng YS (2020) Effect of different land types on the quality of Dendrocalamus latiflorus shoots. Journal of Anhui Agricultural University, 47:76-81. https://doi.org/10.13610/j.cnki.1672-352x.20200327.010
Zhang B, Wu X, Zhang G, Li S, Zhang W, Chen X, ... & Chen T (2016) The diversity and biogeography of the communities of Actinobacteria in the forelands of glaciers at a continental scale. Environmental Research Letters 11:054012. https://doi.org/10.1088/1748-9326/11/5/054012
Zhang SH, Wang Y, Hu JJ, Chen WJ, Wu JL, Seah RWX, Zhu YC, Guo ZP, Chen J (2023) Bamboo charcoal affects soil properties and bacterial community in tea plantations. Open Life Sciences 18:20220681. https://doi.org/10.1515/biol-2022-0681
Zhao Y, Yan C, Hu F, Luo Z, Zhang S, Xiao M, ... & Fan H (2022) Intercropping pinto peanut in litchi orchard effectively improved soil available potassium content, optimized soil bacterial community structure, and advanced bacterial community diversity. Frontiers in Microbiology 13:868312. https://doi.org/10.3389/fmicb.2022.868312
Zheng R, (2012) Canonical correlation and principal components analysis of different production areas of Dendrocalamopsis oldhami with quality indicators of bamboo shoots and its soil nutrients. Journal of Zhejiang A＆F University 29:710-714. https://doi.org/10.11833/j.issn.2095-0756.2012.05.012
Zheng R, Yang J, Wu CW, Wen XY, Zheng RY (2019) Effects on the Nutritional Ingreditents of Bambusa oldhamii Shoot From Three Types of Cultivated Soil. Jour of Fujian Forestry Sci and Tech 46:62-67. https://doi.org/10.13428/j.cnki.fjlk.2019.03.012
Zhou BB, Zhang Q, Sun J, Li XL, Wei QP (2016) Study and Application of Partial Least Squares Regression on Relationship between Soil Nutrient and Fruit Quality.Agricultural Science & Technology 33:106-112. https://doi.org/10.16175/j.cnki.1009-4229.2016.02.028
Zhou HM, Peng H, Cheng XR, Tong R, Li QJ (2022) Bacterial Community Structure and Diversity in Soils of Different Forest Ages in Ormosia hosiei Forest. Journal of Northeast Forestry University 50:66-70. https://doi.org/10.13759/j.cnki.dlxb.2022.07.018
Zhu J, Li M, Whelan M (2018) Phosphorus activators contribute to legacy phosphorus availability in agricultural soils: A review. The Science of the total environment 612:522–537. https://doi.org/10.1016/j.scitotenv.2017.08.095
Zhu SH, Hui CM, Zhao XT, Liu WY, Zhang ZF, Liu HH, Zhang WJ, Zhu LY, Tu DD (2023) Effects of Different Planting Years of Dendrocalamus brandisii on Soil Fungal Community. Environmental Science 44:2408-3417. https://doi.org/10.13227/j.hjkx.202206118

Download PDF

Version 1

posted

You are reading this latest preprint version

The role of soil chemical properties and microbial communities on Dendrocalamus brandisii bamboo shoot quality, Yunnan Province, China

Status:

Version 1

Abstract

Figures

Highlights

Introduction

Materials and methods

Study area profile

Test method

Collection of soil samples

Bamboo shoot sample collection and processing

Determination of soil chemical properties

Soil DNA Extraction, Sequencing, and Amplification

Results

Chemical properties of the soil

Nutritional quality of bamboo shoots

Diversity of soil microbial community

Soil microbial composition

Analysis of soil microbial abundance

Relationship between soil chemical properties, microbial communities, and bamboo shoot quality

Partial least squares path modeling (PLS-PM) analysis

Discussion

Relationship between soil nutrients and soil microorganisms

Effects of soil properties on bamboo shoot quality

Effect of soil microorganism on bamboo shoot quality

Conclusions

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1