Bacteriocin is a kind of natural substance that can effectively inhibit bacteria, but its production usually limited by environment. Co-culture is a strategy to stimulate bacteriocin production. Bifidocin A produced by Bifidobacterium animalis BB04, is a novel bacteriocin with a broad-spectrum antimicrobial active of foodborne bacteria. In order to enhance bifidocin A production, bacteriocin-inducing strains were screened firstly in co-cultivation. Then, the molecular mechanism of co-cultural induction was investigated by transcriptomic and proteomic analysis. Finally, the key inducing metabolites were identified by using targeted metabolomic technology. The results showed that Wickerhamomyces anomalus Y-5 in co-cultivation could significantly enhance bifidocin A production with 3-fold increase compared with mono-culture. The induction may not depend on direct contact with cells, but on continuous stimulation of inducing substances in a certain concentration. In co-cultivation, W. anomalus Y-5 up-regulated Hxk2 and Tap42 to activate glucose-cAMP and Tor and HOG-MAPK pathway, stimulated the expression of the retrograde gene, produced glutamine and glycerol to maintain activity. During this process, glutamine, inosine, guanosine, adenine, uracil, fumaric acid and pyruvic acid produced by W. anomalus Y-5 could induce the synthesis of bifidocin A. In conclusion, W. anomalus Y-5 in co-cultivation induced the synthesis of bifidocin A by regulating various signaling pathways to produce inducing substances. These findings lay a foundation for bifidocin A high-efficient synthesis and provide a new perspectives on the industrial production of bacteriocin.
Research Article
Multi-omics profiling reveals the molecular mechanism of Bifidobacterium animalis BB04 in co-culture with Wickerhamomyces anomalus Y-5 to induce bifidocin A synthesis
https://doi.org/10.21203/rs.3.rs-4994410/v1
This work is licensed under a CC BY 4.0 License
Journal Publication
published 26 Oct, 2024
Read the published version in World Journal of Microbiology and Biotechnology →
You are reading this latest preprint version
Bifidocin A
co-culture
inducing mechanism
inducing substances
bacteriocin synthesis
Bacteriocin produced by lactic acid bacteria (LAB) is considered to be a natural antibacterial substance, offering a viable effective alternative substitute for chemical preservatives. These bacteriocins hold promising potential for several applications, including meat preservation, brewing, and grain processing (Perez et al. 2022). Generally, the ability of LAB to produce bacteriocin is influenced by the environment, resulting in a restriction of bacteriocin production (Antoshina et al. 2022). Numerous strategies can be employed to enhance bacteriocin production, including screening for high-producing strains, optimizing production conditions, using physical and chemical mutagenesis, and employing heterologous expression (Zhao et al. 2021). However, the aforementioned methods are plagued by inadequate specificity, genetic instability, and limited safety (Man and Xiang 2023). Recent studies have demonstrated that the co-culture method can significantly enhance the bacteriocin production. Co-culturing with other microorganisms is a strategic approach to stimulate LAB to produce bacteriocin. Limosilactobacillus reuteri could significantly enhance the production of bacteriostat-like substances from Enterococcus faecium 135, resulting in a considerable increase in antibacterial activity from 12,800 AU/mL to 2,5600 AU/mL (Piazentin et al. 2022). The production of Paracin 1.7 derived from Lacticaseibacillus paracasei HD1.7, was increased by 87.14% through co-culturing with Bacillus subtilis. Additionally, the expressions levels of the related bacteriocin synthesizing genes prcK and prcR were up-regulated by 1.75-fold and 1.39-fold, respectively (Sun et al. 2024). These findings indicate that co-culture has the potential to enhance bacteriocin production, and this effect occurs at the transcriptional level.
Typically, the strains that could induce the production of bacteriocin synthesis (bacteriocin-inducing strain) during co-cultivation were specific, and there seemed to be no correlation between the classification of strains and their ability to induce the bacteriocin. Wu et al. (2021) researched the inducing effects of various strains (E. hirae, L. fermentum, Lactiplantibacillus plantarum, Lactobacillus acidophilus, L. bulgaricus, et al.) on the synthesis of bactericin in L. plantarum RUB1. Out of the three E. hirae strains and the six L. plantarum strains, only one of them could induce the synthesis of bacteriocin. However, the L. acidophilus strains were unable to do so. In addition, out of the 300 strains of LAB from the genera Lactococcus, Lactobacillus, Streptococcus, Leuconostoc, and Enterococcus, five specific strains including L. reuteri NMD-86, L. helveticus NMD-137, Lactococcus lactis NMD-152, E. faecalis NMD-178, and E. faecium NMD-219 were found to significantly induce the plantaricin MX synthesis (Man and Xiang 2021). The aforementioned results demonstrated that the induction of bacteriocin-inducing strains was not directly associated with genetic relationships, highlighting a significant level of specificity. Nevertheless, the precise molecular mechanism underlying this specificity remains uncertain and requires additional investigation.
The inducing effect may be associated with the cell composition and contact mode. The study demonstrated that direct contact between living cells can significantly induce the synthesis of bacteriocin in a co-culture system (Chanos and Mygind 2016). One study demonstrated that co-culturing the inducing strain Yarrowia lipolytica with nisin-producing bacteria L. lactis for a specific duration resulted in a significant increase in the synthesis of nisin (Ariana and Hamedi 2017). However, studies have demonstrated that the indirect co-culture of bacteriocin-producing strain L. plantarum DC400 and specific inducing strains has no significant difference in the induced effect compared with direct co-culture (Di-Cagno et al. 2009). These findings indicate that both direct and indirect contact could induce the synthesis of bacteriocin in co-cultivation. In addition, different components of bacteriocin-inducing strains can induce the synthesis of bacteriocin, not just limited to living cells. The capacity of the supernatant from L. lactis MG1363, L. hilgardii J81, and Pediococcus pentosaceus FBB63 maintained their ability to induce an effect when they were co-cultured with bacteriocin-producing bacteria L. plantarum J23 (Han et al. 2023). It has been verified that L. plantarum RUB1 can be induced to synthesize bacteriocin by co-culturing it with the cell-free supernatant of certain bacteria (Wu et al. 2021). These findings indicate that the induction of an effect is not just reliant on the direct contact of living cells but rather on the delivery of certain substances. Presently, the ongoing research also fails to include the process of screening and verification of substances that can induce the synthesis of bacteriocin.
Bifidocin A, synthesized by Bifidobacterium animalis BB04, is a newly discovered bacteriocin that exhibits antibacterial activity against a wide range of foodborne bacteria. Initially, the study evaluated bacteriocin‑inducing strains in co-cultivation to enhance the synthesis of bifidocin A. Subsequently, the molecular mechanism of induction of bacteriocin‑inducing strains in co-cultivation was investigated by transcriptomic and proteomic analysis. Furthermore, the specific metabolites responsible for eliciting the desired effect were identified via targeted metabolomic analysis and confirmed by verification experiments. This study has the potential to provide a theoretical foundation for the effective synthesis of bifidocin A and offer a new perspective on the industrial production of bacteriocin.
Microorganisms and growth conditions
B. animalis BB04, a bacteriocin-producing bacterium, was isolated from the feces of healthy centenarians residing in the Layisu longevity villages in the fourth macrobian district in Xinjiang, Uygur, an autonomous region of China. The fourteen strains were utilized to evaluate their ability to induce the production of bacteriocin as co-cultural strains. These strains belong to Bifidobacterium, Lactobacillus, Saccharomyces, and Wickerhamomyces. The Bifidobacterium strains were cultured under aerobic conditions in MRS broth with 0.05% (w/v) L-cysteine hydrochloride (MRS-C) at 37℃. The Lactobacillus strains were cultured under aerobic conditions in MRS broth at 37℃. The Saccharomyces and Wickerhamomyces strains were cultured under aerobic conditions in YPD at 30℃. The source information of the co-cultural strains that were examined is shown in Table 1. Listeria monocytogenes ATCC 35152 was employed as the indicator strain to assess the antibacterial effectiveness of the bacteriocin. The bacterium was cultured under aerobic conditions in a TSB medium at 37℃.
|
Number |
Species |
Storage number |
|---|---|---|
|
BF-1 |
Bifidobacterium animalis |
CGMCC 1.2891 |
|
BF-2 |
Bifidobacterium animalis |
CGMCC 1.1852 |
|
BF-3 |
Bifidobacterium animalis |
CGMCC 1.15623 |
|
BB-1 |
Bifidobacterium adolescentis |
CGMCC 1.2190 |
|
BB-2 |
Bifidobacterium adolescentis |
CICC 24573 |
|
BB-3 |
Bifidobacterium adolescentis |
CICC 6179 |
|
BL-1 |
Lactobacillus rhamnosus |
CGMCC 1.8882 |
|
BL-2 |
Lactobacillus rhamnosus |
CGMCC 1.577 |
|
BL-3 |
Lactobacillus rhamnosus |
CGMCC 1.26 |
|
Y-1 |
Saccharomyces cerevisiae |
CGMCC 2.3973 |
|
Y-2 |
Saccharomyces cerevisiae |
CGMCC 2.3889 |
|
Y-3 |
Saccharomyces cerevisiae |
CGMCC 2.3854 |
|
Y-4 |
Wickerhamomyces anomalus |
CGMCC 2.1029 |
|
Y-5 |
Wickerhamomyces anomalus |
CGMCC 2.971 |
Analysis of Bacteriocin production
The B. animalis BB04 was activated and co-cultured with tested strains and inoculated simultaneously at 1:1 (v/v) in MRS-C. The co-culture sample was then cultured anaerobically at 37℃ for 24 h. The B. animalis BB04 was inoculated in MRS-C medium and cultured anaerobically at 37℃ for 24 h as a mono-culture sample. The suspension was subjected to centrifugate at 10,000 rpm for 10 min at 4℃ to extract the supernatant. Bifidocin A was purified from the supernatant by a four-step purification process involving adsorption and desorption, SP-Sepharose fast flow cation exchange, Sephadex G10 gel filtration chromatography, and reverse phase high-performance liquid chromatography (Liu et al. 2015).
Bifidocin A, which had been purified and diluted in a stepwise manner by a factor of two using sterile deionized water. Then, 100 µL of each dilution was added to the wells. The bacteriocin activity was quantified in arbitrary units (AU) per milliliter. The measurement was obtained by using the following equation: n which represents the reciprocal of the highest dilution at which a clear zone of growth inhibition of L. monocytogenes 35152 was observed. It was employed to facilitate bacteriocin production in co-cultivation.
Screening of bacteriocin-inducing strains in co-cultivation
The activated B. animalis BB04 and the tested co-cultural strains were concurrently inoculated at a 1:1 (v/v) in MRS-C medium. The co-culture was then incubated anaerobically at 37℃ for 24 h. The control consists of B. animalis BB04, which is inoculated individually in MRS-C medium. The culture is then incubated anaerobically at a temperature of 37℃ for 24 h. The cell suspension was centrifuged at 10,000 rpm for 10 min at 4℃ to obtain supernatant and cells. The supernatant was utilized to determine the production of bifidocin A, while the cells were analyzed to assess the number of expression levels of the bifidocin A structural gene (bifA).
The expression level of bifA was measured using RT-qPCR to verify the presence of bifidocin A. The RNA from B. animalis BB04 was extracted using the RNA prep Pure Cell kit and then converted into cDNA by using the FastQuant RT kit. The RT-qPCR experiments were conducted using the SYBR Green PCR master mix, and the results were obtained using the CFX96 Real-Time PCR Detection System.
Optimization of co-cultural condition
The optimal timing for inoculation for co-cultivation was determined by assessing the production of bifidocin A when W. anomalus Y-5 was inoculated at 0 h, 4 h, 8 h, 12 h, 16 h, and 20 h. To identify the best inoculation ratio, B. animalis BB04 and W. anomalus Y-5 were co-cultured at different ratios of 3:1, 2:1, 1:1, 1:2, and 1:3 (v/v), to determine bifidocin A production. The B. animalis BB04 and W. anomalus Y-5 were adjusted to 104 to 107 CFU and both were inoculated simultaneously to determine the optimal inoculation size of the bifidocin A production.
Investigation of mode of induction in co-cultivation
The various components of the W. anomalus Y-5 cell suspension were collected to determine the production of bifidocin A to explore the method of induction during co-cultivation. The strain was inoculated into MRS-C medium and cultured aerobically for 24 h to produce a suspension. The live cells and supernatant were collected by centrifuging at 8,000 rpm for 2 min at 4℃. The heat-killed cells were collected by boiling live cells for 30 min. Afterward, the supernatant was filtered through a 0.22 µm pore size filter and then concentrated at three and six-fold. The B. animalis BB04 was co-cultured in an anaerobic environment with the supernatant, heat-killed cells, and live cells respectively in MRS-C at 37℃ for 24 h. The purpose of this experiment was to determine the production of bifidocin A.
The B. animalis BB04 was inoculated into a 100 mL MRS-C medium, which was placed on the left side of the non-contact co-culture device. On the right side of the device, the same medium was used, but it included W. anomalus Y-5. The device contained two chambers, one on the left and one on the right, which were separated by a 0.22 µm filter. This filter allowed substances to flow through while preventing the cells from doing so. The production of bifidocin A was determined following a 24 h co-culturing period. The control consisted of B. animalis BB04 grown in a monoculture (Di-Cagno et al. 2009; Liu et al. 2022).
Analysis of transcriptomics
The Magen HiPure Universal RNA Kit was used to extract total RNA from W. anomalus Y-5 in both monoculture and co-culture. The quality of the RNA was evaluated using the Qubit 3.0 (OD260/280 > 1.5 and RIN ≥ 6.5). The construction of the sequencing library exclusively utilized RNA samples of superior quality.
After obtaining the RNA sample of W. anomalus Y-5, mRNA was enriched by magnetic beads coated with Oligo. Next, random hexamers were utilized to synthesize cDNA utilizing mRNA as the template. The library underwent sequencing utilizing the Illumina high-throughput sequencing platform in conjunction with nanopore technology. The results were stored in the FASTQ (fq) file format. Finally, the sequencing results from the complete genome sequencing of W. anomalus Y-5 will serve as a reference genome for subsequent transcriptomic analysis.
A short sequence comparison was performed using the Hisat2 software. The screening criteria were established with a false discovery rate (FDR) of 5% and genes change over 2-fold between samples (Hu et al. 2023). In addition, the identified differential genes were analyzed for functional enrichment using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG). A statistically significant result was determined using Bonferroni correction with a level of P < 0.05 (Zhang et al. 2024).
Analysis of proteomics
The complete process of extracting total protein from cellular samples of W. anomalus Y-5 has to be carried out under refrigeration. The protein samples were extracted using a lysis buffer that included the necessary protease inhibitor. The protein quality was assessed using a BCA Protein Assay kit.
The protein samples of W. anomalus Y-5 were subjected to digestion by reacting them with dithiothreitol (DTT) solution. This was followed by alkylation using iodoacetamide solution. The precipitated material was rinsed three times with ice-cold acetone in a light-proof environment. It was then placed in a solution containing ammonium bicarbonate and treated with trypsin. Following the process of digestion, the peptide samples were transferred to the TMT Reagent vial and incubated for a duration. Next, hydroxylamine solution was added to the mixture and allowed to incubate to stop the reaction. Finally, the sample underwent desalination using a Strata X Shield C18 solid phase extraction column and was subsequently dried under a vacuum.
The combined samples were separated using Acquity ultra-high performance liquid chromatography and XBridge Shield C18 RP columns. The previously separated peptide samples were eluted using a gradient at a flow rate of 300 µL/min for a duration of 57 min. A total of 15 fractions were collected from each sample and combined into the LC20AD HPLC system for analysis.
Using Buffer A (0.1% formic acid in water) and Buffer B (0.1% formic acid in acetonitrile) to elute the samples onto an Acclaim PepMap RSLC C18 analytical column at a flow rate of 300 nL/min. The mass analysis was performed using NSI-MS and Q-Exactive HF MS. The scan range was configured to span from 250 to 1,500 m/z. The automated gain control (AGC) target was set to 3E6. The resolution was set at 70,000. The maximum injection time (IT) was limited to 250 ms. Lastly, the dynamic exclusion time was set to 15 s. The isolated peptides identified were analyzed using 28% nitrogen for secondary mass spectrometry detection. Secondary ion fragmentation information was detected in an Orbitrap. The parameters were set to a resolution of 17,500, AGC was 1E5, and a maximum IT of 100 ms.
The RNA-Seq data was utilized to construct a specific reference protein database through the utilization of DIAMOND (Zhang et al. 2021). The mass error for precursor ions was set to 10 ppm, whereas the mass error for fragment ions was set to 0.02 Da, respectively. The threshold for the FDR for peptide targets was set at 1.3%. In addition, the proteins that were identified were subjected to functional enrichment analysis using the GO and KEGG databases. A statistically significant level of P < 0.05 was used to determine the significance of the findings.
Verification of key different genes
In order to verify the accuracy of transcriptomic and proteomic results of W. anomalus Y-5 during co-cultivation, RT-qPCR was employed to assess the expression of selected genes in mRNA. The method employed was identical to that used in section 2.3. The β-actin genes were used as reference genes. The relative gene expression levels were calculated using the △△Ct method. The primers were designed based on the genomic sequence of W. anomalus Y-5 (Table 2).
|
Primers |
Sequence (5′-3′) |
|---|---|
|
RT-β-actin-F |
GCTTACAGAGGCACCACTCAACC |
|
RT-β-actin-R |
CCGGAATCCAGCACAATACCAG |
|
RT-GLT1-F |
TCAGCACCCAACAAAACTGC |
|
RT-GLT1-R |
GTCATGATGGTGGTACGGGT |
|
RT-Tor2-F |
CGTACATTACTGCCAGCCAC |
|
RT-Tor2-R |
GGCTTTGGAGTTGCAGTTGA |
|
RT-gdhA-F |
TTTCAAATGCAGGGATCGGG |
|
RT-gdhA-R |
TCCAGTATTAACGATGACTCCG |
|
RT-gln1-F |
GTAGCAAGTGTTAGTGGTGATGC |
|
RT-gln1-R |
CGTGATGTGAACTGTTTGTACCC |
|
RT-Ypd1-F |
ATCGCTCAGAGTGTTGACCA |
|
RT-Ypd1-R |
ATCGACCAGGCACAAACAAC |
|
RT-hta1-F |
GTCCGGTGGTAAAGGTGGTA |
|
RT-hta1-R |
TCCCTAGCAGCATTACCAGC |
Analysis of targeted metabolomics
The fermentation supernatant from the co-cultivation of W. anomalus Y-5 was combined with a solution containing 20% acetonitrile methanol. Thereafter centrifuged at a speed of 12,000 rpm at 4℃ for 10 min. The collected supernatant was filtered using a 0.22um filter and transferred into an LC tube for analysis using LC-MS (Wang et al. 2023).
The samples collected above were analyzed using an LC-ESI-MS/MS system. The specified analytical parameters were as follows: Column, ACQUITY UPLC BEH Amide (1×100 mm, 1.7 µm); solvent system, water with 10mM Ammonium acetate and 0.3% Ammonium hydroxide (A), as well as 90% acetonitrile/water (v/v) (B). The flow rate was adjusted to 0.4 mL/min, while the injection volume was set to 2 µL.
The MS analysis is performed using a QTRAP. The instrument is controlled by Analyst 1.6.3 software. The operation parameters for the ESI source were as follows: the ion source was set to ESI+/-; source temperature was maintained at 550℃; ion spray voltage was set to 5500 V (Positive), -4500 V (Negative); and the curtain gas pressure was set to 35 psi. Metabolites were analyzed through the utilization of scheduled multiple reaction monitoring (MRM). Data acquisition and metabolite identification were performed using Analyst 1.6.3 and Multiquant 3.0.3 software.
Verification of potential inducing substances
Based on the results of targeted metabolomics, specific metabolites were selected as potential inducing substances and added at 0, 4, 8, 12, 16, and 20 h throughout the growth of B. animalis BB04. The control consisted of a monoculture of B. animalis BB04 without any other substances. The methodology used to determine the production of bifidocin A was identical to that described in section 2.2.
Analysis of statistics
All the experiments were performed in triplicates. Representative data and images are presented in this paper. The data analysis utilized a one-way ANOVA with the Duncan test, employing SPSS Statistical program Version 16.0. The statistical significance was evaluated at a P < 0.05, and the results were presented as the mean ± SD.
Induction evaluation of bacteriocin-inducing strains in co-cultivation
The ability of the co-cultured strains that were evaluated to induce bifidocin A was evaluated by the production of bifidocin A and the level of expression of bifA. Figure 1 demonstrated that the induction of B. animalis BF-2, L. rhamnosus BL-1, Saccharomyces cerevisiae Y-1, and W. anomalus Y-5 in co-cultivation resulted in a significant increase compared to the control (P < 0.05). Of all the inductions, the most significant was W. anomalus Y-5 in co-cultivation with a three-fold increase of bifidocin A production and 3.38-fold up-regulation of the expression level. There was no apparent link observed between the classification of bacteriocin-inducing strains and their ability to induce bifidocin A. The study indicated that the induction of the bacteriocin-inducing strain was highly specific.
Co-cultural condition optimization between B. animalis BB04 and W. anomalus Y-5
The synthesis of bifidocin A can be influenced by the inoculation time, ratio, and inoculum size could affect the co-cultivation. Co-cultivation was mainly observed during the early growth phase (0–8 h), of the culture period, but ceased after 8 h (Fig. 2A). Different inoculation ratios could also impact the inducing effect. The co-culture system demonstrated the strongest induction when inoculated at 1:1(v/v) ratio. When compared to the control, the inoculation ratio was higher than 1:2 or lower than 2:1, resulting in a weakened or completely absent inducing effect of W. anomalus Y-5 (Fig. 2B). The impact of W. anomalus Y-5 on bacteriocin induction was significant when the live cells were within the range of 105-107 CFU/mL, with the most favorable outcome observed at 106 CFU/mL (Fig. 2C). The optimal culture condition for the co-culture system was found to be the simultaneous inoculation of 106 CFU/mL with 1:1 (v/v) ratio.
Mode of induction investigation of W. anomalus Y-5 in co-cultivation
In order to ascertain the mode of induction, B. animalis BB04 was co-cultured separately with different components, including live cells, heat-killed cells, and supernatant from W. anomalus Y-5. The results showed that the presence of live cells and a six-fold concentrated supernatant resulted in a significant induced bifidocin A production (Fig. 3A). This indicated that not only live cells but also certain concentrations of metabolites could promote the production of bifidocin A. Further, in order to determine if the inducing effect was dependent on cell-to-cell direct contact between W. anomalus Y-5 and B. animalis BB04, two strains were inoculated into MRS-C medium using a non-contact co-culture device. It was found that there was no significant distinction between contact co-culture and non-contact co-culture. However, both of these methods exhibited much higher results compared to mono-culture (Fig. 3B). This implies that the induction mat does not require cell-to-cell contact, but rather continuous stimulation through inducing substances with a specific concentration. Therefore, it is plausible to hypothesize that one or more metabolites produced by W. anomalus Y-5 could induce an efficient synthesis of bifidocin A from B. animalis BB04 during co-cultivation.
Transcriptomic and proteomic analysis of W. anomalus Y-5 in co-cultivation
W. anomalus Y-5 was cultivated under anaerobic conditions for 24 h in both mono-culture and co-culture. This was done to identify the differentially expressed genes (DEGs) and differentially expressed proteins (DEPs) for transcriptomic and proteomic analysis. Considering the extensive transcriptomic data, the threshold for considering genes as differentially expressed was established to fold change ≥ 2 and P < 0.05. A total of 1968 DEGs were identified (shown in Table S1), including 994 genes that were up-regulated and 974 genes that were down-regulated (Fig. 4A). In addition, TMT-based quantitative proteomics was further conducted to identify the DEPs with fold change ≥ 1.3 and P < 0.05. A total of 645 DEPs were identified (shown in Table S2) in the mono-culture group, including 418 up-regulated proteins and 227 down-regulated proteins (Fig. 4B). The correlation analysis between transcriptomic and proteomic data is shown in Fig. 4C and Fig. 4D. According to KEGG analysis revealed that DEGs and DEPs involved in nitrogen metabolism and alanine, aspartate, and glutamate metabolism pathways were significantly up-regulated. Conversely, the MAPK signaling pathway, fatty acid metabolism, and biosynthesis of unsaturated fatty acids were significantly down-regulated (Fig. 5).
Gene and protein level validation
Based on the results of transcriptomic and proteomic analysis data, oppA、agrA、pstS、glnA、argH and purD (four genes showing upregulation and two downregulation) were selected for further validation using RT-qPCR. Although the value of the obtained fold-change was different between RT-qPCR and transcriptomic and proteomic data, the expressions of the tested genes were entirely consistent and regulated in the same way (Fig. 6). The agreement between RT-qPCR and transcriptomic and proteomic data indicates a high level of reliability in the transcriptomic and proteomic data.
Targeted metabolomics analysis of W. anomalus Y-5 in co-cultivation
Based on the transcriptomic and proteomic results, we have identified that the main focus of the possible key-inducing metabolites lies in the amino acids and central carbon metabolism (CCM). Subsequently, the concentrations of amino acids and compounds in CCM derived from the supernatant of B. animalis BB04 (B), W. anomalus Y-5 (Y), and their co-culture (BY) were quantified at 24 h using targeted metabolomics to identify the specific metabolites that were exchanged. Metabolites that had P < 0.05 and VIP > 1 were considered differentially expressed metabolites (DEMs). A total of 68 DEMs were identified, including 37 DEMs found between B and BY, and 47 DEMs found between Y and BY (shown in Table S3). The mass spectrometry approach revealed the change of metabolites between B, Y, and BY. Metabolites that accumulate with the growth of W. anomalus Y-5 and decrease during the production of bifidocin A of B. animalis BB04, were selected as potential inducing substances in co-cultivation (red cluster in Fig. 6). The metabolites included glutamine, L-aspartate, uracil, guanosine, inosine, fumaric acid, adenine, and pyruvic acid.
Potential inducing substances verification of W. anomalus Y-5 in co-cultivation
Based on the result using targeted metabolomic, B. animalis BB04 was co-cultured with specific metabolites at measured concentrations. These metabolites included glutamine (773.09 ng/mL), L-aspartate (112113.90 ng/mL), uracil (2709.45 ng/mL), guanosine (189.23 ng/mL), inosine (10.85 ng/mL), fumaric acid (445.66 ng/mL), adenine (3371.95 ng/mL), and pyruvic acid (3628.98 ng/mL). The synthesis of bifidocin A production in the aforementioned samples at 24 h is shown in Fig. 7. In addition to L-aspartic acid, several metabolites have the potential to induce bifidocin A production at the appropriate times. These metabolites showed inducing effects when administered between 8 to 12 h during co-cultivation, but did not exhibit inducing effects when administered at 0 h. The addition of glutamine between 8 and 20 h resulted in a significantly enhanced production of bifidocin A compared to monoculture. However, the addition of pyruvic acid at 8 h could enhance the synthesis of bifidocin. The addition of guanosine and inosine could enhance bifidocin A production after 4 h incubation of B. animalis BB04. When inducing substances were introduced before 4 h there was no increase in bifidocin A production. Consequently, the direct addition of the supernatant from W. anomalus Y-5 at 0 h failed to induce bifidocin A synthesis.
Due to the growth of B. animalis BB04, W. anomalus Y-5 was exposed to acid stress, high osmotic pressure and nutrient deficiency. These stress factors promoted W. anomalus Y-5 to regulate Glucose-cAMP, Tor and HOG-MAPK pathway to maintain strain activity and cell number. The metabolic substances produced during co-culture induced the efficient synthesis of bifidocin A.
The protein kinase A (PKA) pathway in yeast regulates cell death in an acid environment (Lastauskienė et al. 2014). The PKA pathway in yeast was rapidly triggered by glucose or other essential nutrients through cAMP when the yeast was adequately deprived (Schepers et al. 2012). The production of cAMP was facilitated by adenylate cyclase (AC), an enzyme encoded by the Cyr1 gene (Hong et al. 2018). Pde2 a cAMP phosphodiesterase, hydrolyzed the cAMP. The activity of AC was regulated by two glucose-sensing systems (Cardarelli et al. 2019). The G-protein-coupled receptor (GPCR) system, which includes the Gpr1 and Gpa2 proteins, is responsible for sensing extracellular glucose and activating cAMP synthesis (Li et al. 2022). Glucose attached to the Gpr1 receptor, which activated cAMP synthesis through the Gpa2 protein (Cao et al. 2024). In contrast, AC was dependent on Ras proteins in yeast cells, with the activity of the Ras proteins being controlled by Cdc25, Sdc25, Ira1, and Ira2. The Ira proteins have the ability to hinder the functioning of the Ras proteins, therefore preventing cells from undergoing apoptotic death through ROS-producing mitochondria which is triggered by acid stress (Conrad et al. 2014; Leadsham and Gourla 2010). The up-regulation of gene Ira1 suggested that the Ira1 protein negatively regulated Ras-PKA signaling pathway, hence enhancing the ability of yeast to withstand acidic environments. Meanwhile, PKA directly phosphorylates cytosolic enzyme against adverse conditions. Trehalose acts as a carbohydrate that is utilized for the purpose of storing and protecting against stress in yeast and other fungi (Conrad et al. 2014). The study found that the up-regulation of hexokinase II (encoded by Hxk2) and trehalose-6-phosphate phosphatase (encoded by Tps2) genes indicated increased glucose absorption and its conversion into trehalose in W. anomalus Y-5 during co-culture. Furthermore, the Hxk2 gene significantly impacts acid tolerance. The protein Hxk2 effectively prevented acid-induced apoptosis and cell death by blocking the entry of Ras2 in the mitochondria (Amigoni et al 2013). Consequently, the up-regulation of gene Hxk2 during co-culture enhanced the ability to survive in acid environments.
Several signals such as nitrogen, acids, and stress have to some extent been evaluated to be upstream cues for TOR activation/repression (Lu et al. 2023). Under preferred nitrogen sources, the amino acid transport activity of Gap1 is low, whereas in the presence of poor nitrogen sources Gap1 activity is high (Georis et al. 2022). Protein Gap1 is responsible for the uptake of amino acids and its activity is regulated by the available nitrogen source via nitrogen catabolite repression (NCR) (Ljungdahl and Daignan 2012). The decrease in intracellular concentrations of glutamate and glutamine would influence the expression of NCR genes and the activity of TOR protein which is closely related to inosine (Chen and Kaiser 2002). The TORC1 was no longer activated, resulting in inability to produce guanosine triphosphatases, which in turn the release of guanosine and the active Tap42 protein phosphatase complex (Fernández et al. 2015). The presence of adenine can restore TORC1 activity (Dai et al. 2022). Tap42 reduced the process of phosphorylation of Ure2, which in turn decreased the stimulation of NCR gene expression (Conrad et al. 2014). Tap42 also dephosphorylated Mks1, which then complexed with Rtg2. Rtg1,3 undergoes nuclear localization, resulting in stimulation of the expression of retrograde (RTG) genes, sustaining amino acid biosynthesis through the synthesis of glutamate and glutamine (Ruiz et al. 2012; Bu et al. 2021). Glutamine played a crucial role as a cross-feeding metabolite in the co-culture of S. cerevisiae and L. plantarum (Ponomarova et al. 2017). Glutamate dehydrogenase specifically synthesized glutamate from α-ketoglutarate and ammonia as precursors. The glutamine synthetase Gln1 catalyzes ammonia and glutamate to synthesize glutamine (Ljungdahl and Daignan 2012). The RTG signaling pathway could increase the expression of enzymes involved in the synthesis of α-ketoglutarate from oxaloacetate in the TCA cycle. Protein Rtg2 was found to stimulate the RTG signaling pathway, which in turn promotes the glutamate and glutamine synthesis (Miranda et al. 2018). In addition, L-aspartate undergoes dehydrogenation to produce fumaric acid, which in turn provides intermediates (pyruvic acid) for the TCA cycle and initiate the early onset or prolong the duration of the effective biosynthetic phase of bacteriocin Lac-B23 (Harlé et al. 2020; Yi 2013).
In addition to acid stress and nutritional deficiency, the co-cultivation of W. anomalus Y-5 was also exposed to osmotic pressure. Osmotic stress resulted in transient inhibition of uracil uptake of W. anomalus Y-5, which in turn led to varying degrees of changes in numerous genes and proteins related to the mitogen-activated protein kinase (MAPK) pathway (Ha 2016). The most notable change is the high osmolarity glycerol mitogen-activated protein kinase signaling transduction pathway (HOG-MAPK). The function of the HOG-MAPK pathway in yeast was to combat external hypertonic stress by promoting the synthesis of glycerol and trehalose (Galello et al. 2024). The serine-threonine phosphatases PTC (Ptc1, Ptc2, and Ptc3) were responsible for regulating Hog1 to avoid excessive activation that might lead to cell death and to preserve essential cell activity. In addition, it has been demonstrated that the HOG-MAPK pathway increases glycerol biosynthesis in response to hypertonic and acid stress (De-Lucena et al. 2015a). Glycerol is produced through a two-step process. First, the glycerol-3-phosphate dehydrogenase (encoded by GPD) catalyzes the conversion of glycolytic dihydroxyacetone phosphate to L-glycerol 3-phosphate (G3P). Then, G3P is dephosphorylated to glycerol by the enzyme glycerol 3-phosphatase (encoded by GPP) (Klein et al. 2017). The expression of GPD and GPP was significantly influenced by the HOG-MAPK pathway (Galello et al. 2024). In the glycerol catabolic pathway, glycerol is oxidated by GDH to form dihydroxyacetone (DHA), which is subsequently phosphorylated to DHAP by the enzyme DHA kinase (DAK) (Klein et al. 2017; Galello et al. 2024). Therefore, we hypothesized that the up-regulation of glycerol biosynthesis and metabolism could generate NADPH to counteract reactive oxygen species and improve bifidocin A production.
The acid environment triggered the oxidative stress response in yeast and NADPH was utilized for the detoxification of oxidized compounds (De-Lucena et al. 2015b). Multiple genes associated with oxidative stress exhibited up-regulation. The protein cytosolic catalase T (CTT1) and thioredoxin peroxidase (encoded by Prx1) could protect the yeast cells from oxidative harm caused by H2O2. The expression of gene CTT1 in S. cerevisiae was controlled by protein Ras2, AC, and cAMP-dependent protein kinases which detect essential nutrients (Kim et al. 2023). During oxidative stress, the enzymes Gre2 and Gre3 relied on the protein Hog1 to encode NADPH-dependent aldose reductases. These enzymes helped neutralize the detoxification of the harmful oxidizing compound methylglyoxal (Chen et al. 2023; Weber et al. 2021). In the same manner, the expression of GRE3 of S. cerevisiae JP1 was up-regulated and forced to transition into the quiescent (G0) phase under conditions of glucose, nitrogen, or phosphorous deprivation (De-Melo et al. 2010; Jimenez et al. 2015). The genes Trx1 and Trx2, which encode cytoplasmic thioredoxins, may result in a prolonged synthesis (S) phase and a shortened first gap (G1) phase in the cell cycle (De-Lucena et al. 2015a). The up-regulation of Trx1 in the co-cultivation promoted W. anomalus Y-5 to enter the G0 phase to reduce energy consumption and prevent DNA replication or chromosomal segregation errors. Having adequate time for proper adaptation and successful passage to the next phase was beneficial (Jimenez et al. 2015).
This study found that the presence of W. anomalus Y-5 during co-cultivation could significantly induce the synthesis of bifidocin A from B. animalis BB04. The induction process does not necessarily require direct contact with cells but rather relies on continuous stimulation provided by specific inducing substances at a certain concentration. Through co-cultivation, the strain W. anomalus Y-5 induced the synthesis of bifidocin A by altering multiple signaling pathways. The up-regulation of Hxk2 and Tps2 in the glucose-cAMP pathway enhances the absorption of glucose and its conversion to trehalose hence regulating glucose metabolism. The activation of cAMP and Tap42 in the Tor pathway stimulated the expression of the retrograde (RTG) gene leading to the production of precursor substance 2-oxoglutarate. This, in turn, enhances the synthesis of glutamate and glutamine, partially alleviating nitrogen stress. The HOG-MAPK pathway promotes the production of glycerol biosynthesis and activates downstream genes to enhance resistance to osmotic stress and preserve cellular function. Up-regulation of Gre3 and Trx1 accelerated the transition of the cell into the G0 state, resulting in decreased energy consumption in response to nutritional stressors. Glutamine, inosine, guanosine, adenine, uracil, fumaric acid, and pyruvic acid which are produced by W. anomalus Y-5 during co-cultivation, have the ability to enhance bifidocin A production. This study highlighted the significance of co-culture with W. anomalus Y-5 in inducing the synthesis of bifidocin A. It also established a theoretical basis for the efficient synthesis of bacteriocin. However, the precise impact and mechanism by which mixed substances trigger the synthesis of bifidocin A in co-cultivation remain unclear and are currently being investigated in our laboratory.
Funding
This work was supported by the Natural Science Foundation of China (No. 31871772), and Guangdong Basic and Applied Basic Research Foundation (No.2022A1515140021).
Competing Interests
The authors have no relevant financial or non-financial interests to disclose.
Author Contributions
L.Y.S.: Conceptualization, Methodology, Validation, Writing – original draft, Investigation, Data curation. N.R.: Conceptualization, Software, Validation, Writing – review & editing, Formal analysis. S.K.S.: Formal analysis, Data curation. D.X.J.: Methodology, Data curation. L.G.R.: Supervision, Project administration, Funding acquisition.
Data availability
Data will be made available on request.
- Amigoni L, Martegani E, Colombo S (2013) Lack of HXK2 Induces Localization of Active Ras in Mitochondria and Triggers Apoptosis in the Yeast Saccharomyces cerevisiae. Oxidative Medicine and Cellular Longevity 132:1-10. https://doi.org/10.1155/2013/678473.
- Antoshina DV, Balandin SV Ovchinnikova TV (2022) Structural Features, Mechanisms of Action, and Prospects for Practical Application of Class II Bacteriocins. Biochemistry-Moscow 87:1387-1403. https://doi.org/10.1134/S0006297922110165.
- Ariana M, Hamedi J (2017) Enhanced production of nisin by co-culture of Lactococcus lactis sub sp lactis and Yarrowia lipolytica in molasses based medium. Journal of Biotechnology 256:21-26. https://doi.org/10.1016/j.jbiotec.2017.07.009.
- Bu YS, Yang H, Li JX, Liu YX, Liu TJ, Gong PM, Zhang LM, Wang SM, Yi HX (2021) Comparative Metabolomics Analyses of Plantaricin Q7 Production by Lactobacillus plantarum Q7. Journal of Agricultural and Food Chemistry 69:10741–10748. https://doi.org/10.1021/acs.jafc.1c03533.
- Cao HJ, Gong H, Yu MN, Pan XY, Song TQ, Yu JJ, Qi ZQ, Du Y, Zhang RS, Liu YF (2024) The Ras GTPase-activating protein UvGap1 orchestrates conidiogenesis and pathogenesis in the rice false smut fungus Ustilaginoidea virens. Molecular Plant Pathology 25(3):e13448. https://doi.org/10.1111/mpp.13448.
- Cardarelli S, Giorgi M, Poiana G, Biagioni S, Saliola M (2019) Metabolic role of cGMP in S. cerevisiae: the murine phosphodiesterase-5 activity affects yeast cell proliferation by altering the cAMP/cGMP equilibrium. Fems Yeast Research 19(3):foz016. https://doi.org/10.1093/femsyr/foz016.
- Chanos P, Mygind T (2016) Co-culture-inducible bacteriocin production in lactic acid bacteria. Applied Microbiology and Biotechnology 100:4297–4308. https://doi.org/10.1007/s00253-016-7486-8.
- Chen CN, Porubleva L, Shearer G, Svrakic M, Holden LG, Dover JL, Johnston M, Chitnis PR, Kohl DH (2023) Associating protein activities with their genes: rapid identification of a gene encoding a methylglyoxal reductase in the yeast Saccharomyces cerevisiae. Yeast 20:545–554. https://doi.org/10.1002/yea.979.
- Chen EJ, Kaiser CA (2002) Amino acids regulate the intracellular trafficking of the general amino acid permease of Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences of the United States of America 99:14837–14842. https://doi.org/10.1073/pnas.232591899.
- Conrad M, Schothorst J, Kankipati HN, Van Zeebroeck G, Rubio-Texeira M, Thevelein JM (2014) Nutrient sensing and signaling in the yeast Saccharomyces cerevisiae. FEMS Microbiolgy Reviews 38:254–299. https://doi.org/10.1111/1574-6976.12065.
- Dai LF, Wang BJ, Wang T, Meyer EH, Kettel V, Hoffmann N, McFarlane HE, Li SL, Wu XN, Picard KL, Giavalisco P, Persson S, Zhang Y (2022) The TOR complex controls ATP levels to regulate actin cytoskeleton dynamics in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America 119(38):e2122969119. https://doi.org/10.1073/pnas.2122969119.
- De-Lucena RM, Elsztein C, Barros D, Souza RB, Pita WD, Paiva SDL, Morais MA (2015a) Genetic interaction between hog1 and slt2 genes in signalling the cellular stress caused by sulphuric acid in Saccharomyces cerevisiae. Journal of Molecular Microbiology and Biotechnology 25:423–427. https://doi.org/10.1159/000443309.
- De-Lucena RM, Elsztein C, Pita WB, Souza RB, Junior SLP, Junior MA (2015b) Transcriptomic response of Saccharomyces cerevisiae for its adaptation to sulphuric acid-induced stress. Antonie van Leeuwenhoek 108:1147–1160. https://doi.org/10.1007/s10482-015-0568-2.
- De-Melo HF, Bonini BM, Thevelein J, Simoes DA, Morais MA (2010) Physiological and molecular analysis of the stress response of Saccharomyces cerevisiae imposed by strong inorganic acid with implication to industrial fermentations. Journal of Applied Microbiology, 109, 116–127. https://doi.org/10.1111/j.1365-2672.2009.04633.x.
- Di-Cagno R, Angelis M, Coda R, Minervini F, Gobbetti M (2009) Molecular adaptation of sourdough Lactobacillus plantarum DC400 under co-cultivation with other Lactobacilli. Research in Microbiology 160:358–366. https://doi.org/10.1016/j.resmic.2009.04.006.
- Fernández LT, Gomez JP, Bibb MJ (2015) A rel A -dependent regulatory cascade for auto-induction of microbisporicin production in Microbispora corallina: Regulation of microbisporicin biosynthesis in M. corallina. Molecular Microbiology 97:502–514. https://doi.org/10.1111/mmi.13046.
- Galello F, Bermúdez-Moretti M, Martínez MCO, Rossi S, Portela P (2024) The cAMP-PKA signalling crosstalks with CWI and HOG-MAPK pathways in yeast cell response to osmotic and thermal stress. Microbial Cell 11(1):90-105. https://doi.org/10.15698/mic2024.03.818.
- Georis I, Fayyad M, Zaremba E (2022) Glutamine transport as a possible regulator of nitrogen catabolite repression in Saccharomyces cerevisiae. Yeast 39(9):493-507. https://doi.org/10.1002/yea.3809.
- Ha E (2016) Escherichia coli-derived uracil increases the antibacterial activity and growth rate of Lactobacillus plantarum. Journal of Microbiology and Biotechnology 26:975-987. https://doi.org/10.4014/jmb.1601.01063.
- Han TQ, Liu YS, Ren DY, Niu HY, Zhang CC, Liu DQ, Xin XT, Zhang JM (2023) Effects of exogenous induction and co-culture on the production of the bacteriocin Lac-B23 from Lactiplantibacillus plantarum J23. Journal of Food Safety and Quality 14(7): 104-112.
- Harlé O, Falentin H, Niay J, Valence F, Courselaud C, Chuat V, Maillard MB, Guédon É, Deutsch SM, Thierry A (2020) Diversity of the metabolic profiles of a broad range of lactic acid bacteria in soy juice fermentation. Food Microbiology 89:1-11. https://10. 1016/j.fm.2019.103410.
- Hong KQ, HouXY, Hao AL, Wang PF, Fu XM, Lv A, Dong J (2018) Truncation of Cyr1 promoter in industrial ethanol yeasts for improved ethanol yield in high temperature condition. Process Biochemistry 65:37-45. https://doi.org/10.1016/j.procbio.2017.10.008.
- Hu WK, Liu JG, Zhang W, Wu JL, Yang ZB, Zhang R, Zeng, XF (2023) Multi-omics analysis reveals the microbial interactions of S. cerevisiae and L. plantarum on Suanyu, Chinese traditional fermented fish. Food Reasearch International 174(1):113525. https://doi.org/10.1016/j.foodres.2023.113525.
- Jimenez J, Bru S, Ribeiro M, Clotet J (2015) Live fast, die soon: cell cycle progression and lifespan in yeast cells. Microbial Cell 2:62–67. https://doi.org/10.15698/mic2015.03.191.
- Kim J, Lee K, Bahn Y (2023) Deciphering the regulatory mechanisms of the cAMP/protein kinase A pathway and their roles in the pathogenicity of Candida auris. Microbiology Spectrum 11(5):e02152-23. https://doi.org/10.1128/spectrum.02152-23.
- Klein M, Swinnen S, Thevelein JM, Nevoigt E (2017) Glycerol metabolism and transport in yeast and fungi: established knowledge and ambiguities. Environmental Microbiology 19:878–893. https://doi.org/10.1111/1462-2920.13617.
- Lastauskienė E, Zinkevičienė A, Čitavičius D (2014) Ras/PKA signal transduction pathway participates in the regulation of Saccharomyces cerevisiae cell apoptosis in an acidic environment. Biotechnology and Applied Biochemistry 61:3-10. https://doi.org/10.1002/bab.1183.
- Leadsham JE, Gourlay CW (2010) cAMP/PKA signaling balances respiratory activity with mitochondria dependent apoptosis via transcriptional regulation. BMC Cell Biology 11:92. https://doi.org/10.1186/1471-2121-11-92.
- Li S, Li Y, Rushing BR, Harris SE, McRitchie SL, Dominguez D, Sumner SJ, Dohlman HG (2022) Multi-Omics Analysis of Multiple Glucose-Sensing Receptor Systems in Yeast. Biomolecules 12(2):175. https://doi.org/10.3390/biom12020175.
- Liu GR, Ren L, Song Z, Wang CT, Sun BG (2015) Purification and characteristics of bifidocin A, a novel bacteriocin produced by Bifidobacterium animals BB04 from centenarians' intestine. Food Control 50:889-895. http://doi.org/10.1016/j.foodcont.2014.10.049.
- Liu GR, Nie R, Liu YS, Li X, Duan JJ, Hao X, Shan YM, Zhang JY (2022) Bacillus subtilis BS-15 effectively improves plantaricin production and the regulatory biosynthesis in Lactiplantibacillus plantarum RX-8. Frontiers in Microbiolgy 12:772546. https://doi.org/10.3389/fmicb.2021.772546.
- Ljungdahl PO, Daignan B (2012) Regulation of amino acid, nucleotide, and phosphate metabolism in Saccharomyces cerevisiae. Genetics 190:885–929. https://doi.org/10.1534/genetics.111.133306.
- Lu ZY, Jiang WD, Wu P, Liu Y, Ren HM, Jin XW, Kuang SY, Li SW, Tang L, Zhang L, Mi HF, Zhou XQ, Feng L (2023) Cellular antioxidant mechanism of mannan-oligosaccharides involving in enhancing flesh quality in grass carp (Ctenopharyngodon idella). Journal of the Science of Food and Agriculture 103(3):1172-1182. https://doi.org10.1002/jsfa.12211.
- Man LL, Xiang DJ (2021) LuxS-mediated quorum sensing system in Lactobacillus plantarum NMD-17 from koumiss: induction of plantaricin MX in co-cultivation with certain lactic acid bacteria. Folia Microbiologica 66:855-871. https://10.1007/s12223-021-00890-0.
- Man LL, Xiang DJ (2023) Effect of LuxS/AI-2-mediated quorum sensing system on bacteriocin production of Lactobacillus plantarum NMD-17. Folia Microbiologica 68:855-866. https://doi.org/10.1007/s12223-023-01060-0.
- Miranda RO, Campos G, Nero LA (2018) Expression of genes associated with stress conditions by Listeria monocytogenes in interaction with nisin producer Lactococcus lactis. Food Research International 105:897–904. https://doi.org/10.1016/j.foodres.2017.12.030.
- Perez RH, Zendo T, Sonomoto K (2022) Multiple bacteriocin production in lactic acid bacteria. Journal of Bioscience and Bioengineering 134:277-287. https://10.1016/j.jbiosc.2022.07.007.
- Piazentin ACM, Mendonca CMN, Vallejo M, Mussatto S, Oliveira RPD (2022) Bacteriocin-like inhibitory substances production by Enterococcus faecium 135 in co-culture with Ligilactobacillus salivarius and Limosilactobacillus reuteri. Brazilian Journal of Microbiology 53:131-141. https://doi.org/10.1007/s42770-021-00661-6.
- Ponomarova O, Gabrielli N, Sévin DC, Mülleder M, Zimgibl K, Bulyha K, Andrejev S, Kafkia E, Typas A, Sauer U, Ralser M, Patil KR (2017) Yeast creates a niche for symbiotic lactic acid bacteria through nitrogen overflow. Cell Systems 5:345-357. https://doi.org/10.1016/j.cels.2017.09.002.
- Ruiz C, Noriega N, Duch A, Posas F, Nadal E (2012) The Hog1 SAPK controls the Rtg1/Rtg3 transcriptional complex activity by multiple regulatory mechanisms. Molecular Biology of the Cell 23(21):4286–4296. https://doi.org/10.1091/mbc.e12-04-0289.
- Schepers W, Zeebroeck G, Pinkse M, Verhaert P, Thevelein JM (2012) In vivo phosphorylation of Ser21 and Ser83 during nutrient-induced activation of the yeast protein kinase A (PKA) target trehalase. Journal of Biological Chemistry 287:44130–44142. https://doi.org/10.1074/jbc.M112.421503.
- Sun R, Kang J, Sun Y (2024) Action mechanism of Bacillus subtilis driving the production of Paracin 1.7: Based on transcriptome-binding SPR analysis. LWT - Food Science and Technology 191:115617. https://doi.org/10.1016/j.lwt.2023.115617.
- Wang YS, Chen YC, Xin JK, Chen XJ, Xu TY, He JF, Pan ZX, Zhang CB (2023) Metabolomic profiles of the liquid state fermentation in co-culture of Eurotium amstelodami and Bacillus licheniformis. Frontiers in Microbiology 14:1080743. https://doi.org/10.3389/fmicb.2023.1080743.
- Weber M, Basu S, González B, Greslehner GP, Singer S, Haskova D, Hasek J, Breitenbach M, Gourlay CW, Cullen PJ, Rinnerthaler M (2021) Actin cytoskeleton regulation by the yeast NADPH oxidase Yno1p impacts processes controlled by MAPK pathways. Antioxidants 10(2):322. https://doi.org/10.3390/antiox10020322.
- Wu AJ, Fu YQ, Kong LY, Shen QY, Liu MX, Zeng XQ, Wu Z, Guo YX, Pan DD (2021). Production of a Class IIb bacteriocin with broad-spectrum antimicrobial activity in Lactiplantibacillus plantarum RUB1. Probiotics and Antimicrobial Proteins, 13, 1820-1832. https://doi.org/10.1007/s12602-021-09815-2.
- Yi H, Han X, Yang YY, Liu WL, Liu H, Zhang YC, Sun K, Zhang LW, Ma F (2013) Effect of exogenous factors on bacteriocin production from Lactobacillus paracasei J23 by using a resting cell system. International Journal of Molecular Sciences 14:24355-24365. https://10.3390/ijms141224355.
- Zhang GH, Qi QH, Sadiq FA, Wang W, He XX, Wang W (2021) Proteomic analysis explores interactions between Lactiplantibacillus plantarum and Saccharomyces cerevisiae during sourdough fermentation. Microorganisms 9:2353. https://doi.org/10.3390/microorganisms9112353.
- Zhang XY, Jiao R, Ren YW, Wang Y, Li H, Ou DX, Ling N, Ye YW (2024) Transcriptomic and biochemical analyses reveal the antifungal mechanism of cell-free supernatant from Aspergillus luchuensis YZ-1 against Aspergillus flavus. Food Bioscience 59:103961. https://doi.org/10.1016/j.fbio.2024.103961.
- Zhao DY, Meng FQ, Zhou LB, Lu FX, Bie XM, Sun J, Lu ZX, Lu YJ (2021) Maltose effective improving production and regulatory biosynthesis of plantaricin EF in Lactobacillus plantarum 163. Applied Microbiology and Biotechnology 105(7):2713-2723. http://10.1007/s00253-021-11218-w.
No competing interests reported.