Nitric oxide responsive NAD(P)-binding Rossman-fold superfamily protein NONBR negatively regulates the growth and immunity of Arabidopsis thaliana

doi:10.21203/rs.3.rs-4994957/v1

Download PDF

Research Article

Nitric oxide responsive NAD(P)-binding Rossman-fold superfamily protein NONBR negatively regulates the growth and immunity of Arabidopsis thaliana

https://doi.org/10.21203/rs.3.rs-4994957/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Nitric oxide plays a pivotal role in governing various biological and physiological processes in plants, including growth, development, hormone signaling, and defense responses against both biotic and abiotic stresses. Here we investigate the role of the NO-responsive ATNONBR gene in influencing the growth and immunity of Arabidopsis thaliana atnonbr mutant plants in comparison to WT and other relevant control lines under oxidative (induced by H₂O₂ and methyl viologen), and nitro-oxidative (induced by the NO donors CySNO and GNSO) stress conditions.

Results

Our findings revealed that, under these conditions, the atnonbr plants exhibited longer roots and shoot lengths compared to WT plants. In addition, to elucidate the role of ATNONBR in basal defense, R-gene mediated resistance and SAR, plants were inoculated with the virulent strain of hemi-biotrophic bacterial pathogen Pseudomonas syringae pv. tomato PstDC3000 as well as virulent strain (PstDC3000avrB). The atnonbr knockout mutant line exhibited a significantly resistant phenotype, elevated expression of AtPR1, AtPR2, AtG3dph, and AtAZI along with enhanced SA accumulation and reduced electrolyte leakage indicating that At1G07450 negatively regulates the basal defense, R-gene-mediated resistance, and SAR in A. thaliana. Further data mining was employed to determine the basal expression of ATNONBR in various plant parts which also indicated significant reduction in its expression in response to multiple biotic and abiotic factors. Furthermore, computational analysis predicted physical interaction of ATNONBR with two other proteins of the same family and several other proteins with high confidence. Besides, two cysteine molecules were detected with high confidence scores as potential targets of S-Nitrosylation by NO, closer to the NADP binding site as well as the substrate and active sites.

Conclusion

Our study indicates that ATNONBR negatively regulates root and shoot lengths in Arabidopsis thaliana under redox stress conditions, while also exerting a negative influence on its immunity. Additionally, computational analysis predicted its interaction with other proteins and has two cysteine residues as potential targets for S-Nitrosylation.

Nitric oxide

Plant growth and immune responses

NAD(P)-binding Rossmann-fold superfamily gene

Arabidopsis thaliana

Plants are consistently exposed to biotic and abiotic stresses but they lack the adaptive immune systems found in animals. Plants rely on their innate immune system for defense against different types of stress. As part of the plant's innate immune system, mechanisms such as pathogen-triggered immunity (PTI), effector-triggered immunity (ETI), and systemic acquired resistance (SAR) are well-known [1]. Additionally, plants induce programmed cell death (PCD) and an oxidative burst as crucial components of their defense response, triggering localized cell death known as the hypersensitive response (HR) upon pathogen infection [2, 3]. Under biotic and abiotic stress conditions, plants rapidly generate signaling molecules including reactive oxygen species (ROS), reactive nitrogen species (RNS), and phytohormones to activate the corresponding response machinery [4]. While these molecules act as signaling agents under optimal conditions, their excessive production can lead to oxidative or nitro-oxidative damage in plant cells. The dual role of ROS and RNS emphasizes the necessity for finely tuned regulatory mechanisms to maintain a balanced response to environmental cues [5, 6].

Nitric oxide (NO) is a "universal messenger molecule" in plants, contributing to growth, development, and adaptive responses under stress conditions. NO's multifaceted functions make it a key player in plant physiology, orchestrating various physiological and stress-related responses. Previous research has highlighted NO-induced genes such as AtCLV1, AtCLV3, AtAO3, and AtNIGR1, showcasing their differential impact on plant growth and defense responses under biotic and abiotic stress conditions [7, 8]. The Arabidopsis atgsnor1-3 loss of function mutant serves as a sensitive control for both oxidative and biotic stress related studies. The Class-III alcohol dehydrogenase enzyme GSNOR plays a crucial role in various plant developmental programs and plant immunity [9, 10]. As such, it serves as a representative model for evaluating the Arabidopsis response under diverse nitro-oxidative stress conditions. The atcat2 mutant line serves as a sensitive control for assessing oxidative stress conditions. Within Arabidopsis, the catalase isoform CAT2 stands out as a class I catalase expressed in leaves, roots, and seeds, exhibiting substantially higher transcript abundance compared to other catalases. Its expression contributes to circadian and photosynthetic-type rhythms [11, 12]. Notably, CAT2 is the primary contributor to catalase activity in Arabidopsis, as evidenced in cat1 and cat3 loss of function mutant plants displaying a smaller reduction in leaf catalase activity than cat2 plants [11]. Consequently, cat2 mutant lines are commonly utilized as a model to simulate oxidative stress conditions in research studies. In exploring the salicylic acid (SA) dependent plant defense, the SA-deficient atsid2 knockout mutant, as detailed by [13, 14], is commonly employed. The atisid2 mutant exhibits a notable deficiency in accumulating SA and, consequently, displays impaired SA-dependent defense responses [8].

Transcriptomic analyses employing RNA-seq have been particularly useful in elucidating the role of NO in the transcriptional control of biological systems. After only 6 hours of infiltration with the NO donor S-nitroso cysteine (CySNO), robust changes in the expression of an armada of genes have been recorded. These genes were found to be involved in a plethora of physiological processes ranging from plant defense, abiotic stress response, and hormone signaling, to overall plant development [15]. Among the differentially expressed genes (DEGs) At1G07450 (ATNONBR), stands out as one of the most significantly down-regulated genes, displaying a substantial 9-fold reduction in its expression. The gene is categorized within the NAD(P) Rossmann-fold superfamily proteins and is associated with oxidoreductase activity, catalytic activity, and metabolic processes (The Arabidopsis Information Resource, https://www.arabidopsis.org/). The gene encodes 260 amino acids, secreted extracellular Tropinone reductase protein (UniProt: Q8RX32) with NADP⁺ (14–38), substrate (147) binding sites and a proton receptor active site (159). The primary objective of this study was to further explore the role of this NO-responsive NAD(P) Rossmann-fold superfamily gene (hereafter referred to as NONBR) gene in the growth, development and immunity of Arabidopsis thaliana. To accomplish this, the plants underwent exposure to both oxidative and nitro-oxidative stress conditions. Furthermore, to delve deeper into its role in plant basal defense, R-gene-mediated resistance, and SAR, experiments were conducted using virulent and avirulent bacterial pathogen.

2.1. Plant Material and Growth Conditions

The seeds of A. thaliana ecotype Col-0 wild-type (WT) and loss of function mutant lines including atnonbr, atgsnor1-3 (NO-related mutant), atcat2 (oxidative stress-related mutant), and atsid2 (defense-related mutant), were acquired from the Nottingham Arabidopsis Stock Center. Seeds were sterilized in sodium hypochlorite and chilled at 4^oC for 24 hrs to break the dormancy and ensure uniform germination. Seeds were sown in standard horticultural soil and transplanted. Plants were genotyped and grown until homozygous plants were obtained as described earlier [16].

2.2. Oxidative and nitro-oxidative stress induction

Oxidative stress was induced by growing the plants separately on MS media supplemented with 2mM hydrogen peroxide (H₂O₂) and on media supplemented with 1 µM methyl viologen (MV). Nitro-oxidative stress was induced by growing plants on media containing 0.75 mM of the nitric oxide donor CySNO and on media containing 0.75 mM of the NO donor GSNO as described earlier [17]. Seeds were surface sterilized and chilled as described above and germinated on triplicate ½ MS plates each containing at least 05 plants of each genotype. After two weeks of growth, data on root length, shoot length and cotyledon development frequency were recorded.

2.3. Pathogen inoculation.

Surface sterilized and pre-chilled seeds of all the genotypes were germinated and transplanted to pots containing horticultural soil under growth room conditions of 22+ 2^oC and 16/8 hrs of light and dark cycle. Pseudomonas syringae pv. tomato (Pst) DC3000 virulent bacteria and those expressing the avirulent (avrB) effector were grown in Luria-Bertani (LB) broth at 28^oC for 12 hrs in the presence of appropriate antibiotics. Bacteria were harvested by centrifugation at 12000 rpm for 2min at 4^oC and re-suspended in 10mM MgCl₂. For investigations into the basal defense, R-gene mediated resistance and systemic acquired resistance (SAR), plants were infiltrated with PstDC300 and PstDC3000 (avrB) were infiltrated into the abaxial surface of plants at the rosette stage as described previously [18]. Control plants of every genotype were infiltrated with MgCl₂ only. At least 10 plants and three leave/plant were inoculated for every genotype. Leaf samples were collected after 0, 6, 12, and 24 hrs of infiltration for gene expression analyses. Samples were also collected after 0, 1, 2, 3- and 4-days post infection (DPI) for bacterial recovery. For SAR related experiments distal leaves (not infiltrated) were collected after 0, 6, 12 and 24 hrs of inoculation. Leaf samples for bacterial recovery were processed immediately whereas the other samples were collected in liquid nitrogen and stored in -80^oC and used later.

2.3. Electrolyte leakage measurements

At the cellular level infection often results in the disruption of cellular organisms. This in part may occur due to the various enzymes and toxins released by the pathogens or due to the rapid oxidative burst that results in the production of reactive oxygen species (ROS) that in turn cause oxidative damage of cellular membranes thereby disrupting cellular integrity and protoplast leakage. We measured the possible leakage of electrolytes from the cells after 0, 1, 2, 4, 6, 8, 10, 12 and 24 hrs of infection. Electrolyte leakage was measured by using the Twin-Cond B-173 portable conductivity meter (Huriba, Japan). For this purpose, three leaf discs of 1 cm diameter from three plants (three samples/plant) from each treatment were collected and washed vigorously with distilled water. Later, the disks were placed in a glass test tube with 10 mL of deionized water and the electrical conductivity of the solution was recorded over time after 0, 1, 2, 4, 6, 8, 10, 12 and 24 hrs.

2.4. Quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from leaf samples using Trizol. Next, 1 µg of RNA was used for cDNA synthesis using the BioFACT™ RT-Kit (BioFACT™, Daejeon, Korea) and the manufacturer’s standard methodology. Real-time PCR was performed in the Eco™ real-time PCR machine (Illumina, USA). The reaction mixture included 2X Real-time PCR Master Mix (including SYBR Green 1 BioFACT™, Daejeon, Korea), 100 ng of template DNA, and 10 nM of each primer, reaching a final volume of 20 µL. A no template control (NTC), containing distilled water instead of template DNA, was included as a negative control. PCR was performed in a 2-step reaction, involving polymerase activation at 95 °C for 15 min, denaturation at 95 °C for 5 s, and concurrent annealing and extension at 65 °C for 30 s for 40 cycles. Data were standardized using the relative expression of Arabidopsis Actin2. List of primers and sequences is provided in supplementary Table 1.

Supplementary Table 1. List of primers used for PCR

S.NO	Name	Forward Primer	Reverse Primer
1	AtNONBR (At1g07450) Genomic DNA	GTAGCTCCTTGGGTCACTGC	GCTTGACCTCATTTATTTT
2	AtPR1 (AT2G14610)	GTGCAATGGAGTTTGTGGTC	TCACATAATTCCCACGAGGA
3	AtPR2 (AT3G57260)	CAGATTCCGGTACATCAACG	AGTGGTGGTGTCAGTGGCTA
4	AtAZI (AT4G12470)	GCAAGCCAAGTCCTAAACCA	GTCGACGTCAACCAAACCTT
5	AtG3Pdh (AT2G41540)	CGTCTTTTGGGGAAATCAGA	GACATTGTCAATCGGCACAC
6	AtActin2 (AT3G18780)	GCTGGACGTGACCTTACTGA	CCATCTCCTGCTCGTAGTCA

2.5. Mining baseline and induced expression data for ATNONBR

Data for the baseline expression of ATNONBR (AT1G07450) in different parts/organs of Arabidopsis were mined in the EMBL-EBI Expression Atlas (https://www.ebi.ac.uk/gxa/home) representing previously data sets [19].

2.6. Protein Interaction Analysis

The potential interactions of ATNONBR with other protein partners were forecasted by utilizing SMART (Simple Modular Architecture Research Tool) accessible at (http://smart.embl-heidelberg.de/ [20]. Results related to the known and predicted interactions were retrieved as SVG image files. Furthermore, evidence for physical binding associations with other interacting partners was also mined and retrieved with high and medium confidence.

2.7. Prediction of 3D structure and S-Nitrosylation targets

The predicted 3D structure of ATNONBR was downloaded from UniProt with very high confidence (pLDDT > 90) as a PDB file. The file was exported to PyMol [21] and visualized. S-nitrosylation target cysteines were predicted insilico using the GPS-SNO algorithm [22] with strong, medium, and low thresholds. The full-length 260 amino acid sequence of ATNONBR was used for this purpose.

2.8. Statistical Analysis

All the experiments were conducted in triplicates. Data were collected and analyzed using two-way ANOVA followed by Duncan’s Multiple Range test at p = 0.05 using SAS 9.1. Means and standard deviations were used to draw and visualize graphs and compile the final figures using GraphPad Prism (version 6.0, San Diego, CA, USA).

3.1. ATNONBR negatively regulates Arabidopsis growth and development.

Results of the media and pot experiments indicated that ATNONBR negatively regulates the Arabidopsis growth as the loss of function atnonbr plants grew much faster and vigorously on MS basal media as compared to the WT plants (Fig. 1A). Similarly, atnonbr plants showed a significantly tolerant response to oxidative stress induced by H₂O₂ and nitro-oxidative stress induced by CySNO and GSNO (Fig. 1A). On the other hand, the highly sensitive response of the atgsnor1-3 line to oxidative and nitro-oxidative stress is otherwise already known. These results were further depicted in panel B of Fig. 1 where under control conditions, atnonbr plants exhibited longer roots compared to Col-0. This pattern persisted when atnonbr plants were exposed to H₂O₂, CySNO, and GSNO media. Interestingly, under GSNO treatment, atnonbr and atcat2 displayed similar root growth patterns. Conversely, atgsnor1-3 plants showed reduced root elongation under all the test conditions (except MV) in comparison to Col-0. As anticipated, atgsnor1–3 failed to germinate on H₂O₂-medium and displayed significant root inhibition on MV, CySNO, and GSNO (Fig. 1B). Additionally, atcat2 and atnonbr exhibited similar root phenotypes under control, MV, and GSNO conditions, but differences were noted under H₂O₂ and CySNO. Similarly, under all growth conditions, atnonbr plants had higher shoot length (Fig. 1C) and cotyledon development frequency (Fig. 1D) compared to that observed in WT plants. These observations collectively suggest a nuanced and context-dependent role of atnonbr in modulating plant responses under normal, oxidative, and nitro-oxidative stress conditions.

The atnonbr plants showed a resistant phenotypic on ½ MS media containing H₂O₂ and MV (oxidative stress), and CySNO and GSNO (nitro-oxidative stress) compared to WT, atgsnor1-3 and atcat2 mutant lines (A). This was reflected by quantitative measurements of root length (B), shoot length (C), and cotyledon development frequency (D). All data points represent the mean of at least three replicates. Errors bars indicate standard deviation. The experiments were conducted three times with consistent results. Data were analyzed using one-way analysis of variance (ANOVA). Different letters indicate significant differences between the means calculated via Duncan’s multiple range test using SAS 9.1 at 95% confidence limits.

3.2. ATNONBR negatively regulates basal defense in A. thaliana

Results from the pathogenicity assays involving infiltration of plants with PstDC3000 virulent bacteria demonstrated a highly resistant phenotype of the atnonbr mutant plants, as compared to WT and the susceptible controls atgsnor1-3 and atsid2 (Fig. 2A). Further confirmation through bacterial recovery from inoculated leaves after 0 and 1–4 days post-inoculation (dpi) indicated no significant difference in bacterial growth in the tissue of either of the genotypes at 0 dpi. However, at 1–4 dpi time points, the atnonbr plants exhibited a substantially lower bacterial count compared to all the other genotypes (Fig. 2B). These findings underscore the pivotal role of atnonbr in modulating the disease resistance of A. thaliana. Upon infection with pathogenic bacteria, plants typically accumulate salicylic acid (SA) as a crucial signaling molecule to initiate defense responses. This further activates the expression of downstream SA-dependent pathogenesis-related (PR) genes. Therefore, we employed real-time PCR analysis to assess changes in the transcript accumulation of key pathogenesis-related genes, AtPR1 and AtPR2, recognized as markers for the SA-dependent defense. Results showed a gradual time-dependent increase in the expression levels of AtPR1 and AtPR2 starting from 12 hrs to 48 hrs of infection with PstDC3000 virulent strain. At every time point under study, the expression of PR1 and PR2 genes was higher in atnonbr plants compared to that in the WT, atgsnor1-3, or atsid2 plants (Fig. 2C, D). Specifically, the atnonbr plants exhibited a peak expression of PR1 and PR2 genes 24 hours post-infection. Furthermore, we also measured the total SA contents after 6 hours of infection with virulent bacteria and recorded a 32% increase in SA accumulation in the atnonbr plants compared to Col-0. On the other hand, SA contents in the atgnsor1-3 and atsid2 mutant plants were significantly lower (Fig. 2E). These findings suggest a dynamic role for ATNONBR in the SA-dependent defense pathway of Arabidopsis governing variations in the expression of pathogenesis-related genes during plant-pathogen interaction.

The atnonbr plants showed a significantly resistant response to PstDC3000 virulent strain compared to the WT, atgsnor1-3, atsid2 plants (A). This was further evident from the bacterial recovery after 1, 2, 3, and 4 days of inoculation (B), the measurements of the relative expression of the pathogenesis-related PR1 (C) and PR2 (D) genes after 0, 12, 24 and 48 hours of inoculation, and salicylic acid measurements after 6 hours (E). All data points represent the mean of at least three replicates. Errors bars indicate standard deviation. Data were analyzed using one-way analysis of variance (ANOVA). Different letters indicate significant differences between the means calculated via Duncan’s multiple range test using SAS 9.1 at 95% confidence limits.

3.3. ATNONBR negatively regulates R-gene-mediated resistance in A. thaliana

The Arabidopsis thaliana resistance (R) genes can recognize the PstDC3000 strain expressing the avirulent effector avrB. To determine the potential involvement of ATNONBR R-gene mediated resistance, we inoculated the atnonbr plants along with WT and susceptible controls atgsnor1–3, and the SA induction deficient atsid2 mutant plants with PstDC3000(avrB). Results indicated a marked increase in the transcript accumulation of PR1 and PR2 genes after 6, 12, and 24 hours in all the genotypes. However, the highest expression PR1 expression was observed in atnonbr plants followed by WT plants (Fig. 3A) with the lowest but similar expression in atgsnor1-3 and sid2 plants. Similarly, maximum expression of the PR2 resistance gene was observed in atnonbr plants after 6, 12, and 24 hours of PstDC3000(avrB) inoculation followed by WT plants (Fig. 3B). Furthermore, compared to WT plants, the atnonbr plants exhibited lower electrolyte leakage when measured every 2 hours of inoculation for one day (Fig. 3C) indicating higher membrane stability and cellular integrity. Additionally, in comparison to WT, the disease-susceptible controls, atgsnor1–3 and atsid2, displayed lower transcript accumulation of AtPR1 and AtPR2 genes and higher electrolyte leakage (Fig. 3A–C). These findings collectively suggest that the ATNONBR gene plays a negative regulatory role in R-gene-mediated resistance, impacting the expression of key defense genes and physiological responses during the plant's interaction with bacterial pathogens.

The atnonbr plant were found to be significantly resistant to avirulent PstDC3000(avrB) inoculation indicated by a significantly higher transcript of the pathogenesis-related genes AtPR1 (A), AtPR2 (B), and lower electrolyte leakage (C) indicate higher cellular integrity and membrane stability. All data points represent the mean of at least three replicates. Errors bars indicate standard deviation. Data were analyzed using one-way analysis of variance (ANOVA). Different letters indicate significant differences between the means calculated via Duncan’s multiple range test using SAS 9.1 at 95% confidence limits.

3.4. ATNONBR negatively regulates systemic acquired resistance in A. thaliana

Several systemic acquired resistance (SAR)-associated signals have been identified, encompassing salicylic acid and its methylated derivative MeSA, along with azelaic acid (AZA) and glycerol-3-phosphate dehydrogenase (G3Pdh) [23–25]. To investigate the potential involvement of nitric oxide ATNONBR in SAR, we examined the expression of key genes, including AtPR1, AtPR2, AtG3Pdh, and AtAZI, in systemic leaves after every 6 hours for one day after inoculation of atnonbr plants along with Col-0 wild-type (WT), atgsnor1–3, and atsid2, with PstDC3000(avrB). After 6, 12, and 24 hours of inoculation, the transcript accumulation of AtPR1, AtPR2, AtG3Pdh, and AtAZI genes was significantly higher in the atnonbr plants as compared to that in the WT plants (Fig. 4A–D). On the other hand, the expression of these genes was significantly lower in atgsnor1-3 and atsid2 plants indicating an inactive or poor SAR in these plants.

The WT, atnonbr, atgsnor1-3 and atsid2 plants were infiltrated with virulent P. syringae and real-time PCR was conducted to determine changes in the expression of PR1 (A), PR2 (B), G3PDH (C) and AZI (D) genes in the distal leaves after 0, 6, 12 and 24 hours of infiltration. All data points represent the mean of at least three replicates. Errors bars indicate standard deviation. Data were analyzed using one-way analysis of variance (ANOVA). Different letters indicate significant differences between the means calculated via Duncan’s multiple range test using SAS 9.1 at 95% confidence limits

3.5. Gene structure, baseline and induced expression of ATNONBR in A. thaliana

The ATNONBR has a 1411 base pair (bp) mRNA with 80 bp 5´ and 112 bp 3´ un-translated regions and four introns. The gene encodes a NAD(P)-binding Rossmann-fold superfamily Tropinone reductase homolog protein and its role in plant physiology has not been investigated before. In a previous study from our laboratory involving RNA-Seq mediated leaf transcriptomic analysis of A. thaliana, the expression of this gene was found to be down-regulated by 9 folds after 6 hours of infiltration with 1mM of the NO donor CySNO [15]. According to UniProtKB/ChEBI, PROSITE-ProRule Annotation, the gene houses an NADP + binding site (amino acids 14–38), a substrate binding site (aa 147), and a proton acceptor active site (aa a 59) (Fig. 5A). The highest basal expression of the gene is recorded in the flowers followed by that in the siliques and seeds, and with lower levels of expression in the cotyledons, rosette and cauline leaves (Fig. 5B) [19]. Maximum expression in the flowers is in the pedicel. On the other hand, ATNONBR is variably expressed during the different developmental stages of the siliques and seeds (Fig. 5B). Furthermore, the expression of the gene is induced by several external factors. For example, infestation by insects such as Pieris brassicae, infection by Pseudomonas syringae, Botrytis cinerea, Turnip Yellow Mosaic Virus, and exposure to Mannitol, CySNO, heat stress, and salicylic acid (Fig. 5C). On the other hand, the expression of ATNONBR is increased after exposure of A. thaliana plants to high light, UB-B radiation, and 4^oC temperature (Fig. 5C).

Data regarding the gene structure, including mRNA size, and intron/exon positions were collected from TAIR (https://www.arabidopsis.org/index.jsp). Information on the location and sequence of NADP⁺ binding site as well as the substrate were collected from Uniprot (https://www.uniprot.org/uniprotkb/Q8RX32/entry#expression) (A). Data for the baseline and induced expression of ATNONBR (AT1G07450) in different parts/organs of Arabidopsis were mined in the EMBL-EBI Expression Atlas (https://www.ebi.ac.uk/gxa/home) (C, D) representing previously data sets [19].

3.6. ATNONBR interactome and prediction of S-Nitrosylation targets

The Insilico analysis for the prediction of ATNONBR interacting partners identified several genes with strong signals of physical interaction with ATNONBR with high confidence. These also included several known experimentally determined and database-curated interactions besides the predicted interactions (Fig. 6A). Protein-protein interactions of ATNONBR were identified with other proteins such as SAG13 (senescence-associated gene), AT2G29310, AT2G29320 (both are NAD(P)-binding Rossman-fold superfamily proteins) with high and medium confidence (Fig. 6B) and with other proteins such including, THY-1, THY-2 (Bifunctional dihydrofolate, reductase-thymidylate synthases), AT12G21550, ACX1, ACX5 (Acyl-coenzyme A oxidases), DCL1 [Delta (3,5), delta (2,4)-dienoyl-COA isomerase 1], and AT5G17380 (Fig. 6C).

Since ATNONBR is a nitric oxide responsive gene and is down-regulated within 6 hours of CySNO application, this tempted us to further investigate if ATNONBR protein could be a target of NO-based post-translational modification via S-Nitrosylation. Interestingly, the results showed a significantly higher probability of S-Nitrosylation at Cys220 and Cys233 (Fig. 6D). Furthermore, the ATNONBR 3D structure in Fig. 6D shows that these cysteine sites are significantly closer to the NADP⁺ binding site (red ribbon) as well as the substrate binding site (yellow spheres) and the proton acceptor active site (magenta spheres) indicating a high biological significance of the potential S-Nitrosylation of both of these cysteines by NO.

Data on known and predicted interactions of ATNONBR with other protein partners were determined via SMART (Simple Modular Architecture Research Tool) accessible at (http://smart.embl-heidelberg.de/ [20] with high and medium confidence (A-C). The predicted 3D structure of ATNONBR was downloaded from UniProt with very high confidence (pLDDT > 90) as a PDB file and viewed in PyMol for educational use [21]. S-Nitrosylation target cysteines were predicted using the GPS-SNO algorithm [22] (D). Red ribbon shows NADP⁺ binding site, yellow and magenta spheres show the substrate and proton acceptor active sites whereas, the cyan spheres show the two S-Nitrosylation target cysteines.

NO is a pivotal player in various cellular activities and biological processes, exerting significant influence on plant growth, development, and responses to biotic stress [18, 26]. Transcriptomic analyses, including microarrays [27], RNA-seq [15, 28], and qPCR[29], have been instrumental in unraveling genome-wide changes in gene expression in response to NO. Under normal conditions, plants prioritize energy allocation for growth and development. However, during stress, plants tend to reroute resources toward activating defense mechanisms, potentially leading to delayed or reduced growth. The current investigation elucidates the functional role of the NO-induced ATNONBR gene in plant growth and development, particularly under control, oxidative, and nitro-oxidative stress conditions. The atgsnor1-3 (accumulating higher S-nitrosothiols) and atcat2 (significantly lower catalase activity) along with the Col-0 wild type were used as comparative controls. These control plants were chosen because of their well-established roles in both plant growth and defense mechanisms [30, 31] under the conditions investigated in this study. The phenotypic observations from the study indicated that the loss-of-function mutant atnonbr exhibited a significant increase in shoot length and root length compared to the WT under normal, oxidative, and nitro-oxidative stress conditions. Garcıa-Mata and Lamattina [26]Garcıa-Mata and Lamattina [26]The increase in shoot length observed under nitro-oxidative stress (GSNO) might be linked to the potential role of nitric oxide (NO) in seed germination and seedling growth [26]. Moreover, Kopyra, Gwozdz [32]Kopyra, Gwozdz [32] NO might play a role in breaking seed dormancy, serving as a mechanism to facilitate robust plant growth, potentially surpassing the effects of GA3 (gibberellic acid) [32]. To sum up, the current study revealed that the NO-downregulated ATNONBR plays a negative regulatory role in plant growth traits (shoot and root lengths) in A. thaliana under control and oxidative and nitro-oxidative stress conditions. These findings underscore the intricate interplay between NO signaling and ATNONBR in orchestrating a delicate balance between growth and stress responses in Arabidopsis.

Different genotypes encountering a specific pathogen are anticipated to display diverse phenotypic responses, reflecting the intricate interplay of defense mechanisms within the plant system [33]. The induction of various defense factors and signaling networks contributes to the plant's ability to ward off pathogens, leading to differing levels of damage between sensitive and resistant genotypes. We delved deeper into assessing the involvement of the NO-induced ATNONBR gene in plant basal defense, R-gene-mediated resistance, and SAR. The loss-of-function atnonbr mutant plants were inoculated with bacterial pathogen, alongside the WT and disease-susceptible mutant lines, atgsnor1–3, and atsid2. Upon inoculation with PstDC3000 virulent strain, the atnonbr plants exhibited enhanced resistance, as evidenced by the phenotypic responses and bacterial recovery. This suggests that the ATNONBR gene functions as a negative regulator of plant basal defense against bacterial pathogens. Further confirmation of this negative regulation was obtained through the transcript accumulation analysis of AtPR1 and AtPR2 genes. Therefore, our findings suggest a pivotal role for AT1G07450 in the negative regulation of basal defense in A. thaliana. Certainly, plants can recognize effector proteins produced by pathogens, including avirulence proteins, through the action of R genes. This recognition triggers a series of molecular events leading to R-gene-mediated resistance, a defense mechanism that aims to restrict the further spread of disease. Our results align with the findings of [34], highlighting the pivotal role of R-genes in the plant's ability to mount an effective defense response against pathogenic infection. The inoculation of PstDC3000 (avrB) indicates that similar to plant basal defense, ATNONBR also negatively regulated plant R-gene-mediated resistance. After inoculation with the pathogenic bacteria, the atnonbr plants exhibited a significant increase in AtPR1 and AtPR2 gene expression plants compared to the WT. Additionally, these plants showed significantly lower electrolyte leakage over time compared to the WT plants indicating high membrane stability and cellular integrity despite being infected. Based on these findings, it is concluded that the AT1G07450 functions as a negative regulator of R-gene-mediated resistance. In plants, much like in other multicellular organisms, there exists an intrinsic mechanism for systemic communication between different plant parts in response to wounds or external stimuli, allowing them to mount effective defenses across the entire body of the plant. During pathogen attacks, systemic signaling plays a crucial role in triggering necessary defense mechanisms to counteract the stress. One such response in plants is the production of long-term constitutive barriers including systemic acquired resistance (SAR), characterized by the activation of a broad array of host defense mechanisms at both locally infected as well as distal (systemic) plant parts. After inoculating PstDC3000(avrB), the study observed enhanced expression of AtPR1, AtPR2, AtG3Pdh, and AtAZI genes at all-time points in the distal leaves of atnonbr plants compared to WT and disease-susceptible controls suggesting that ATNONBR suppression enhances SAR in Arabidopsis in following infection by avirulent pathogens.

In addition, the ATNONBR appears to play an important role in regulating plant responses to a variety of biotic and abiotic factors including fungal, bacterial, and viral infections, and exposure to ozone, heat stress, and variable lights as has been reported previously [19]. Interestingly though, the expression of the gene only reduces in response to infection and osmotic stress (mannitol treatment). This is parallel to our previous results where NO-mediated down-regulation was observed in ATNONBR expression via transcriptomic analysis as a nitrosative burst is a common phenomenon following pathogen infection [35].

ATNONBR is a NADP⁺ binding Rossman-fold containing protein. The significantly higher probability of physical interaction between ATNONBR and two other NADP binding Rossman-fold containing proteins represents multiple aspects of biological significance such as functional redundancy between NONBR and other proteins of the same family (enabling them to compensate for each other’s role), function regulation and fine-tuning (thereby one protein enhancing or inhibiting the function of the other allowing precise functional control at the cellular level), functional diversification (physical interactions between two proteins of the same family might lead to novel functions for specialized adaptations), insights into the evolutionary history of the protein family (as gene duplication, mutations, and selection shape a protein family over time). Besides protein-protein interactions with multiple proteins were also identified indicating the role of ATNONBR in different protein complexes involved in key physiological processes.

The various domains and motifs inside a protein perform distinct functions. However, protein function is significantly influenced by post-translational modifications (PTMs). One such PTM is orchestrated by NO called S-Nitrosylation with highly important roles in plant defense and physiology [36–38]. Our results indicated that within the 3D structure of ATNONBR, the two cysteine molecules which are potential S-Nitrosylation targets are not only significantly closer to the NADP-binding site but also to the substrate and proton activator sites, which will ultimately impact ATNONBR function and could have significant biological implications at the organism level such as the resistance phenotype of the atnonbr observed in this study.

Conclusions

Plant responses to pathogenic attacks involve intricate signaling networks and metabolic pathways that orchestrate a robust defense system. Within this dynamic process, the induction or suppression of both positive and negative regulators is crucial for maintaining balanced cellular activity. In the present study, the investigation focused on unraveling the role of the NO-downregulated ATNONBR gene in plant growth, development, and its response to oxidative and nitro-oxidative stress conditions. Furthermore, the study explored the potential involvement of the gene in plant basal defense, R-gene-mediated defense, and SAR. The observed enhanced resistance in the knockout plants along with distinct transcript accumulation patterns of PR genes and SAR-related genes collectively suggest a negative regulatory role for ATNONBR in plant basal defense, R-gene-mediated resistance, and SAR against P. syringae. To deepen our understanding of ATNONBR 's role, future experiments, such as in vitro protein–protein interaction studies, promoter analysis, and biotin-switch followed by mass spectrometry and NMR could be undertaken. These additional investigations hold the potential to unveil specific mechanisms through which ATNONBR operates, and how its function is affected by PTMs, further shedding light on its potential as a target for stress adaptation in plants.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Ethics approval and consent to participate

This study did not involve humans or animals, so ethical approval was not required for the experiments conducted on plant-based research.

Funding

This research was supported by Basic Science Research Program through the National Research Foundation (NRF) of Korea funded by the Ministry of Education (RS-2023-00245922) to Prof. Byung-Wook Yun.

Author Contribution

B-WY, TNIA, and MK designed the study; TNIA performed the experiments; TNIA, MK, DL, and FU analyzed the data; SS measured salicylic acid contents; TNIA, MK, and AH drafted the manuscript; B-WY, IJL, and MK supervised and critically reviewed the manuscript; B-WY project administration and funding acquisition. All authors have read and agreed to the published version of the manuscript.

Acknowledgement

Quantitative PCR was conducted at the KNU NGS Center (Daegu, South Korea).

Data Availability

All data is available within the manuscript. Any other required information will be made available by the corresponding author upon request.

Jones JD, Dangl JL. The plant immune system. Nature. 2006;444(7117):323–9.
Morel J-B, Dangl JL. The hypersensitive response and the induction of cell death in plants. Cell Death Differ. 1997;4(8):671–83.
Heath M. Hypersensitive response-related death. Programmed Cell Death in Higher Plants. Springer, Dordrecht: Netherlands; 2000. pp. 77–90. E. Lam, H. Fukuda, and J. Greenberg, Editors.
Khan M, et al. The key roles of ROS and RNS as a signaling molecule in plant–microbe interactions. Antioxidants. 2023;12(2):268.
Khan M, et al. The role of nitric oxide-induced ATILL6 in growth and disease resistance in Arabidopsis thaliana. Front Plant Sci. 2021;12:685156.
Turkan I. ROS and RNS: key signalling molecules in plants. J Exp Bot. 2018;69(14):3313–5.
Shahid M, et al. Comprehensive analyses of nitric oxide-induced plant stem cell-related genes in Arabidopsis thaliana. Genes. 2019;10(3):190.
Al Azzawi TN, et al. Enhanced Resistance of atnigr1 against Pseudomonas syringae pv. tomato Suggests Negative Regulation of Plant Basal Defense and Systemic Acquired Resistance by AtNIGR1 Encoding NAD (P)-Binding Rossmann-Fold in Arabidopsis thaliana. Antioxidants. 2023;12(5):989.
Kwon E, et al. AtGSNOR1 function is required for multiple developmental programs in Arabidopsis. Planta. 2012;236:887–900.
Hussain A, et al. Novel and conserved functions of S-nitrosoglutathione reductase in tomato. J Exp Bot. 2019;70(18):4877–86.
Mhamdi A, et al. Catalase function in plants: a focus on Arabidopsis mutants as stress-mimic models. J Exp Bot. 2010;61(15):4197–220.
Zhong HH, et al. Interactions between light and the circadian clock in the regulation of CAT2 expression in Arabidopsis. Plant Physiol. 1994;104(3):889–98.
Kim Y, et al. Roles of CAMTA transcription factors and salicylic acid in configuring the low-temperature transcriptome and freezing tolerance of Arabidopsis. Plant J. 2013;75(3):364–76.
Nawrath C, Métraux J-P. Salicylic Acid Induction–Deficient Mutants of Arabidopsis Express PR-2 and PR-5 and Accumulate High Levels of Camalexin after Pathogen Inoculation. Plant Cell. 1999;11(8):1393–404.
Hussain A, et al. Nitric oxide mediated transcriptome profiling reveals activation of multiple regulatory pathways in Arabidopsis thaliana. Front Plant Sci. 2016;7:975.
Al Azzawi TNI, et al. Evaluation of Iraqi rice cultivars for their tolerance to drought stress. Agronomy. 2020;10(11):1782.
Khan M, et al. Nitric oxide-induced AtAO3 differentially regulates plant defense and drought tolerance in Arabidopsis thaliana. BMC Plant Biol. 2019;19(1):1–19.
Yun B-W, et al. S-nitrosylation of NADPH oxidase regulates cell death in plant immunity. Nature. 2011;478(7368):264–8.
Mergner J, et al. Proteomic and transcriptomic profiling of aerial organ development in Arabidopsis. Sci Data. 2020;7(1):334.
Letunic I, Khedkar S, Bork P. SMART: recent updates, new developments and status in 2020. Nucleic Acids Res. 2021;49(D1):D458–60.
PyMOL 2.5.5 -, Schrödinger L. The PyMOL Molecular Graphics System, Version 2.5.5. PyMOL for Educational use only. 2024 [cited 2024; https://pymol.org/
Xue Y, et al. GPS-SNO: computational prediction of protein S-nitrosylation sites with a modified GPS algorithm. PLoS ONE. 2010;5(6):e11290.
Durrant WE, Dong X. Systemic acquired resistance. Annu Rev Phytopathol. 2004;42:185–209.
Lima Silva CCd, et al. Structure-function relationship of a citrus salicylate methylesterase and role of salicylic acid in citrus canker resistance. Sci Rep. 2019;9(1):3901.
Jung HW, et al. Priming in systemic plant immunity. Science. 2009;324(5923):89–91.
Garcıa-Mata C, Lamattina L. Nitric oxide and abscisic acid cross talk in guard cells. Plant Physiol. 2002;128(3):790–2.
Parani M et al. Erratum: Microarray analysis of nitric oxide responsive transcripts in Arabidopsis (Plant Biotechnology Journal (2004) 2 (359–366)). Plant Biotechnology Journal, 2004. 2(5): p. 467.
Begara-Morales JC, et al. Differential transcriptomic analysis by RNA-Seq of GSNO-responsive genes between Arabidopsis roots and leaves. Plant Cell Physiol. 2014;55(6):1080–95.
Huang X, von Rad U, Durner J. Nitric oxide induces transcriptional activation of the nitric oxide-tolerant alternative oxidase in Arabidopsis suspension cells. Planta. 2002;215:914–23.
Feechan A et al. A central role for S-nitrosothiols in plant disease resistance. Proceedings of the National Academy of Sciences, 2005. 102(22): pp. 8054–8059.
HU YQ, et al. Functional comparison of catalase genes in the elimination of photorespiratory H2O2 using promoter-and 3′‐untranslated region exchange experiments in the Arabidopsis cat2 photorespiratory mutant. Volume 33. Plant, Cell & Environment; 2010. pp. 1656–70. 10.
Kopyra M, Gwozdz E, Bialczak E. The role of nitric oxide in plants treated with heavy metals. Acta Physiol Plant, 2004. 26(3 suppl.).
Hughes D, Andersson DI. Environmental and genetic modulation of the phenotypic expression of antibiotic resistance. FEMS Microbiol Rev. 2017;41(3):374–91.
Glazebrook J, Rogers EE, Ausubel FM. Isolation of Arabidopsis mutants with enhanced disease susceptibility by direct screening. Genetics. 1996;143(2):973–82.
Borrowman S, Kapuganti JG, Loake GJ. Expanding roles for S-nitrosylation in the regulation of plant immunity. Free Radic Biol Med. 2023;194:357–68.
Abat JK, Deswal R. Differential modulation of S-nitrosoproteome of Brassica juncea by low temperature: Change in S-nitrosylation of Rubisco is responsible for the inactivation of its carboxylase activity. Proteomics. 2009;9(18):4368–80.
Albertos P et al. S-nitrosylation triggers ABI5 degradation to promote seed germination and seedling growth. Nat Commun, 2015. 6.
Astier J, et al. Protein S-nitrosylation: What's going on in plants? Free Radic Biol Med. 2012;53(5):1101–10.

No competing interests reported.

Download PDF

Editorial decision: Revision requested
06 Sep, 2024
Editor assigned by journal
05 Sep, 2024
Submission checks completed at journal
05 Sep, 2024
First submitted to journal
29 Aug, 2024

You are reading this latest preprint version

Nitric oxide responsive NAD(P)-binding Rossman-fold superfamily protein NONBR negatively regulates the growth and immunity of Arabidopsis thaliana

Status:

Version 1

Abstract

Background

Results

Conclusion

Figures

1. Introduction

2. Material and Methods

2.1. Plant Material and Growth Conditions

2.2. Oxidative and nitro-oxidative stress induction

2.3. Pathogen inoculation.

2.3. Electrolyte leakage measurements

2.4. Quantitative real-time PCR (qRT-PCR)

2.5. Mining baseline and induced expression data for ATNONBR

2.6. Protein Interaction Analysis

2.7. Prediction of 3D structure and S-Nitrosylation targets

2.8. Statistical Analysis

3. Results

3.1. ATNONBR negatively regulates Arabidopsis growth and development.

3.2. ATNONBR negatively regulates basal defense in A. thaliana

3.3. ATNONBR negatively regulates R-gene-mediated resistance in A. thaliana

3.4. ATNONBR negatively regulates systemic acquired resistance in A. thaliana

3.5. Gene structure, baseline and induced expression of ATNONBR in A. thaliana

3.6. ATNONBR interactome and prediction of S-Nitrosylation targets

4. Discussion

Declarations

Consent for publication

Funding

Author Contribution

Acknowledgement

Data Availability

References

Additional Declarations

Status:

Version 1