Antisense oligonucleotides as a targeted therapeutic approach in model of acute myeloid leukemia

doi:10.21203/rs.3.rs-5003554/v1

Download PDF

Short Report

Antisense oligonucleotides as a targeted therapeutic approach in model of acute myeloid leukemia

https://doi.org/10.21203/rs.3.rs-5003554/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

The genetic and epigenetic alterations observed in acute myeloid leukemia (AML) contribute to its heterogeneity, influencing disease progression, response to therapy, and patient outcomes. The use of antisense oligonucleotide (AONs) technology allows the design of oligonucleotide inhibitors based on gene sequence information alone, enabling precise targeting of key molecular pathways or specific genes implicated in AML.

Methods and Results

Midostaurin, an FLT3-specific inhibitor and AONs targeting specific genes, exons, or mutations were evaluated using AML models. This AON treatment was designed to bind to exon 7 of the muscleblind-like (MBNL1) gene. Another target was the FLT3 gene, focusing on two aspects: (a) FLT3-ITD (internal tandem duplication), to inhibit the expression of this aberrant gene and (b) the FLT3 in general. Treated and untreated cells were analyzed using quantitative PCR, dot blotting, and Raman spectroscopy. This study compared midostaurin with AONs, which inhibit FLT3 protein production or its isoforms via mRNA degradation. Increased FLT3 expression was observed in midostaurin-treated cells, whereas AON-treated cells showed decreased expression; however, these changes were not statistically significant.

Conclusions

In AML, exon 7 of MBNL1 is involved in several cellular processes. In this study, exon 7 of MBNL1 was targeted for method optimization, with the highest block of the exon 7 gene variant observed 48 h post-transfection. Midostaurin, a multi-targeted kinase inhibitor, acts against the receptor tyrosine kinase FLT3, a critical molecule in AML pathogenesis. While midostaurin blocks the FLT3 signaling pathway, it paradoxically increases FLT3 expression.

acute myeloid leukemia

antisense oligonucleotides

FLT3

MBNL1

target specific therapy

The genetic code for protein synthesis is encoded within the DNA. During cellular processes, genetic information is transcribed to produce mRNA, which serves as the blueprint for protein synthesis. The ribosomal machinery then translates this mRNA and assembles amino acids into functional polypeptides. By designing antisense oligonucleotides (AONs) that specifically bind to mRNA, these processes can be modulated to inhibit the production of proteins critical for AML progression [1–2].

Chemotherapeutic modalities, such as cytarabine and daunorubicin, represent an established therapeutic approach for early stage AML, achieving a complete remission rate ranging from 60 to 80%. Alternatively, patients exhibiting adverse prognostic indicators may undergo allogeneic stem cell transplantation, which is contingent on their cytogenetic profiles and donor availability. Despite their foundation in early clinical trial findings, these treatment protocols fail to fully account for disease heterogeneity, often fostering the emergence of therapy-resistant leukemic clones and resulting in an overall cure rate of 30–40% [3–4]. A substantial proportion of patients who demonstrate resistance to conventional chemotherapy succumb to progressive disease or experience chemotherapy-related toxicities owing to repeated interventions. Moreover, recent findings indicate that the dysregulated expression of specific enzymes and RNA-modifying proteins, influences various cellular processes, including cell survival, proliferation, self-renewal, differentiation, invasion, stress response, DNA damage response, and therapy resistance [5].

Within the realm of AML research and heterogeneity of this disease, AONs, with their mirror-like structural resemblance to selected mRNA segments, are potent molecular tools that bind to and inhibit mRNA, thereby impeding the production of proteins. They have substantial potential in personalized (patient-specific) treatment [6–7], using AONs for modulating mRNA splicing, with a narrower focus on their potential therapeutic applications in AML. AML is the predominant type of blood cancer among adults and, as previously mentioned, presents considerable heterogeneity. Within this diversity lies the potential for promising prognostic advancements in patients through the utilization of advanced therapeutic options known as target-specific AONs. Molecular processes involving DNA-encoded genetic information, transcription, translation, and post-translational modifications have also been elucidated. Furthermore, the impact of AONs on the splicing process was explored in the context of generating therapeutic outcomes, including the restoration of normal splicing patterns and exon skipping for the muscleblind-like 1 (MBNL1) gene variant with exon 7, as several studies have underscored the significance of MBNL1 as a crucial regulator of alternative splicing [8–9]. We then attempted to decrease the fms-like tyrosine kinase 3 (FLT3) expression levels. The mutated and elevated expression of FLT3 is problematic in AML [10]; therefore, another tested approach was to integrate AONs into internal tandem duplication to achieve regular protein variant production.

2.1. Cell culture

The acute myeloid leukemia cell line THP-1 ATCC (cat. no. TIB-202 ™) and MOLM-13 DSMZ (DSMZ no.: ACC 554) were grown/cultured in RPMI1640 medium (Thermo Fisher Scientific, USA) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, USA) and 1% penicillin/streptomycin (Thermo Fisher Scientific, USA) at 37°C with 5% CO₂ in a tissue culture incubator. These cells were treated with midostaurin, a specific inhibitor of internal tandem duplication, and AONs designed to bind to FLT3, FLT3-ITD (MOLM-13), and MBNL exon 7 (THP-1).

The THP-1 cell line derived from the peripheral blood of a 1-year-old male with acute monocytic leukemia exhibited complex karyotypic abnormalities typical for AML. THP-1 cells have been used extensively in immunology and leukemia research. This cell line is commonly used for screening antileukemic drugs and testing compounds that affect monocyte differentiation and macrophage function [11]. The MOLM-13 cell line, derived from the peripheral blood of patients with AML, specifically the M5 subtype, carries the MLL-AF9 (KMT2A-MLLT3) fusion gene resulting from t(9;11)(p22;q23) translocation, which is a hallmark of certain AML subtypes. Furthermore, this cell line carries FLT3-ITD. The co-occurrence of these two mutations is associated with more aggressive disease and poor prognosis. These cells are often used to assess the efficacy of various chemotherapeutic agents and novel drugs, particularly to study the molecular mechanisms underlying MLL-rearranged leukemia [12].

2.2. THP-1 cell line transfection for optimization and effect duration investigation

Transfection optimization was conducted using Cy3-labeled random-sequence CCTTCCCTGAAGGTTCCTCC scramble AON (concentrations 10–500 nM) in combination with 300 nM cationic polymer polyethylenimine (Thermo Fisher Scientific, USA). no.: BMS1003-A). Optimization was performed in a 96-well plate with 15 000 cells per well, and cells were imaged in real-time using IncuCyte SX3 for 72 h to determine transfection efficiency. Positive cells were detected at all concentrations of AON scramble. For subsequent experiments, a concentration of 300 nM was selected, at which point we achieved > 90% transfection efficiency and maintained 60% cell viability. After optimizing the transfection conditions, we investigated the onset and duration of the functional effects of AONs. To achieve this, we utilized MBNL1 exon 7-specific AONs: A*T*G*C*A*C*A*A*T*A*T*T*G*A*G*C*C*T*G*C*C*C*A*T*C*A*T*G, and qPCR primers for the whole MBNL1 gene F:CTGCCGAACATCTGACTAGC, R:GCAACAGTGTGCAGTGGATT; and MBNL1 exon 7-specific primers F:CAACAGGCTCTAGCCAACAT, R:CACAGTGGCTGGCGTAG. The workflow for MBNL1 exon 7 silencing is shown in Fig. 1. Quantitative PCR analysis revealed that MBNL1 exon 7-specific AONs achieved maximal efficacy at 48 h post-transfection. By 72 h post-transfection, expression levels began to revert to baseline, resembling the pre-transfection levels.

2.3. Targeted treatment of MOLM-13 FLT3 mutated cell line with inhibitor and AONs

The MOLM-13 cell line, representing patients with AML and positive for FLT3-ITD, was treated in cell culture for 48 h with: 1) A 100 nM specific FLT3 inhibitor – midostaurin, which blocks the transport pathway and can induce increased expression of FLT3. Midostaurin is a specific inhibitor of the gene encoding FLT3, a type III receptor tyrosine kinase that regulates the normal growth and differentiation of CD34 + hematopoietic cells via signaling through multiple pathways, including PI3 kinase-Akt, MAPK, and STAT5a [13–14]; 2) The 300 nM AONs specifically designed to bind to internal tandem duplication of FLT3 should slightly reduce the amount of FLT3. A 21-nucleotide (nt) AON was designed with specificity to target FLT3-ITD C*T*T*T*G*T*T*T*C*T*T*C*C*T*T**C*T*T*C*T*T (Fig. 2A), with the aim of reducing the translation of protein variants harboring this duplication. Given the reports from current studies on elevated FLT3 gene expression in AML [15–16], this led to its performance; 3) The 300 nM AONs specifically designed treatment for blocking FLT3 should reduce the amount of G*T*G*C*T*A*A*A*G*A*C*C*A*G*A*G*A*C (Fig. 2B). These treatments were conducted using three biological replicates along with the cultivation of untreated controls for comparison. Both sequences were fully modified using phosphorothioate chemistry throughout the backbone; the synthesis was provided by Generi Biotech.

2.4. qPCR and dot blot analysis

Viable cells (2 million per sample) were harvested and subjected to two washes with phosphate-buffered saline (PBS), followed by centrifugation. RNA was isolated using the Trizol Reagent (Invitrogen, #15596026). Subsequently, 500 ng of RNA was transcribed into complementary DNA using a RevertAid kit (Thermo Fisher Scientific, #K162) and DNase I (Thermo Fisher Scientific, #EN0521). The FLT3 gene transcriptional activity was quantified utilizing the Biorad CFX96 platform, using SsoFast™ EvaGreen® Supermix (BioRad). GAPDH was used as a reference gene with primers F:AGCCACATCGCTCAGACAC, R:GCCCAATACGACCAAATCC. The FLT3 gene, F:CCGCCAGGAACGTGCTTG, R:ATGCCAGGGTAAGGATTCACACC, was used. Delta analysis was used to interpret the relative expression data. The same samples were used for protein isolation. Samples were washed twice with PBS and homogenized during pipetting directly into 20 µL radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris HCl, 150 mM NaCl, 1.0% NP-40, 0.5% sodium deoxycholate, 1.0 mM EDTA, 0.1% SDS, and 0.01% sodium azide). The protein concentration was measured using a BCA assay (Thermo Fisher Scientific).

Samples were applied in triplicates to Amersham Protran Premium 0.45-µm nitrocellulose membrane (GE Healthcare, #10600008), which was cut into 9 × 7 cm rectangular pieces and gridded to sixty-three 1 × 1 cm squares using a soft pencil. To each square, 1 µL of sample in the RIPA buffer was pipetted and left to dry. The membrane was washed twice (2 × 1 min) with 0.1% Tween-20 Tris-buffered saline (TTBS) and blocked with a 3% solution of Blotting-Grade Blocker (Bio-Rad, #1706404) in TTBS for 1 h. After blocking, the membrane was washed thrice with TTBS (3 × 1 min) and incubated overnight at 4°C with FLT3 antibody diluted 1:500 with TTBS. Subsequently, the membrane was washed three times with TTBS (3 × 1 min) and incubated for 2 h at room temperature (22°C) with the secondary antibody, Goat Anti-Mouse IgG H&L (HRP) (Abcam, #ab205719), diluted 1:10,000 with TTBS. The membrane was then washed five times with TTBS (5 × 1 min) and imaged by incubation with Clarity Western ECL substrate (Bio-Rad, #1705060) following the manufacturer's recommendations. Image visualization was performed using a ChemiDoc Imaging System (Bio-Rad) with ImageLab 4.1 software, utilizing Chemi-Hi Sense settings.

2.4.1. Image processing and statistical analyses

Image processing and spot intensity detection were conducted using ImageLab 4.1 software. Each spot was selected with a round volume tool with local subtraction of background. Constant area and intensity values were transferred to Excel for further statistical evaluation. Intensity values were normalized using the sum of all spot intensities across the membrane, and triplicates were tested with the Grubbs test for outliers. Tested values were averaged and divided by BCA protein concentration for normalization. Differences between treatments were tested for statistical significance using one-way ANOVA in STATISTICA data analysis software system (version 12 Cz, StatSoft, Inc., 2013).

2.5. Raman spectroscopy

The cells were washed thrice with RPMI 1640 medium before purification. All cell samples were > 95% viable. This was verified using a trypan blue dye exclusion assay. Immediately before Raman spectral analysis, the cells were centrifuged and resuspended in PBS. The samples were transferred onto quartz glass slides. The processing time between the centrifugation and specimen measurement was less than 20 min (including 8 min of centrifugation). The experimental setup combined a Raman microscope (Olympus, Japan) with a single 532 nm wavelength diode-pumped, solid-state laser. The 2 mm-diameter laser beam was directed into a 100× oil immersion objective (Olympus) and to view cells, with objective lens at to 7 mW. Using this laser power, no cellular damage was observed during or after the measurement. Raman signals generated from the trapped cells were focused through a 50-µm pinhole and directed toward a spectrometer (DXR1, Thermo Fisher Scientific) equipped with a CCD detector and holographic notch filter for filtration of backscattered light from the sample. The integration time for acquiring the Raman spectrum of a cell is usually 2–3 min. Each cell in the sample was purposefully selected based on the visual control of the sample using a Raman microscope, and at least 25 cells were measured in each sample.

2.5.1. Raman data processing

Raman spectra were processed using the Omnic™ Specta Software (Thermo Fisher Scientific). The background signal (particularly the immersion oil spectrum) was measured and subtracted from each spectrum, and a multipoint baseline was corrected in the complete spectral region. The positions of the strongest Raman peaks were determined using a polynomial fit at the local maxima and the fluorescence was normalized. Peaks were assigned based on literature. We profiled four groups of MOLM-13 cells. The first group consisted of cells cultured according to standard conventions. In the other three groups, the cells were treated with midostaurin and the two AONs described above.

The qPCR and dot blot analyses revealed a discernible pattern, indicating that midostaurin induced an increase in both FLT3 expression at the transcriptional level and protein abundance. Additionally, the administration of specific AONs targeting FLT3-ITD demonstrated a reduction in FLT3-ITD isoform expression, whereas FLT3-specific AONs led to a decrease in overall FLT3 gene expression (Fig. 3). The Raman bands indicative of molecular composition within the averaged Raman spectra were scrutinized, revealing distinct alterations subsequent to the midostaurin and AON treatments. Notably, each of these changes demonstrated specificity in response to the respective treatments.

Specific Raman bands describing the molecular compositions are shown in Fig. 4. These spectra were created as an average of 25 single measurements, which were then normalized and the background was subtracted (Fig. 5). The molecular interpretations are presented in Table 1. The Raman spectra of the cells exhibited good reproducibility. The common bands identified in the spectra of all four groups were those of carotenoids (888 cm^− 1), proteins (1267 cm^− 1, 1719 cm^− 1), lipids (2943 cm^− 1), nucleic acids (1474 cm^− 1), and cytochrome C (1598 cm^− 1).

Other bands varied between the groups with negligible differences, usually 1–4 cm^− 1. Other described bands with different positions are bands for carotenoids (918–919 cm^− 1 and 997–1000 cm^− 1), proteins (446–447 cm^− 1, 613–614 cm^− 1, 1057–1058 cm^− 1, and 1078–1079 cm^− 1), lipids (2857–2859 cm^− 1 and 2875 cm^− 1 – present only in the first group of standard MOLM-13 cells), nucleic acids (699–700 cm^− 1, 788–790 cm^− 1, 1330–1332 cm^− 1 and 1445–1447 cm^− 1), and cytochrome C (1119–1120 cm^− 1) [17–21]. These differences are listed in Table 1. Although cytochrome C and carotenoids may be present at lower concentrations than other components, the signal is enhanced owing to pre-resonance conditions when the absorption bands are close to the 532 nm laser excitation.

Table 1

Assignment of selected Raman bands in spectra of the MOLM-13 cell lines to vibrations of potential biomarkers. All results are in cm^− 1.
Model	Carotenoids	Proteins	Lipids	Nucleic acids	Cytochrome C
MOLM-13 cell line	888, 919,1000	447, 614, 1058, 1079, 1267, 1719	2859, 2875, 2943	700, 790, 1332, 1447, 1474	1121, 1598
MOLM-13 with midostaurin	888, 919, 999	447, 614, 1058, 1078, 1267, 1719	2858, 2943	700, 789,1331, 1446, 1474	1120, 1598
MOLM-13 with AONs FLT3-ITD	888, 918, 998	446, 613, 1057, 1078, 1267, 1719	2858, 2943	700, 789,1331, 1446, 1474	1120, 1598
MOLM-13 with AONs FLT3	888, 918, 997	446, 613, 1057, 1078, 1267, 1719	2857, 2943	699, 788, 1330, 1445, 1474	1119, 1598

The results obtained from the qPCR and dot blot analyses provided insights into the molecular effects of midostaurin and AONs on FLT3 expression and protein abundance. Notably, midostaurin treatment led to a notable increase in FLT3 expression at both transcriptional and protein levels. This finding suggests a regulatory role for midostaurin in enhancing FLT3 activity, which could have implications for cellular signaling pathways. The administration of specific AONs targeting FLT3-ITD resulted in a distinct reduction in FLT3-ITD isoform expression. This targeted suppression of FLT3-ITD isoform expression is particularly promising because FLT3-ITD mutations are associated with aggressive forms of leukemia. The observed decrease in FLT3-ITD expression following AON treatment indicates a potential therapeutic strategy for mitigating aberrant FLT3 signaling in patients with leukemia harboring FLT3-ITD mutations. FLT3-specific AON treatment decreased FLT3 gene expression. This broad suppression of FLT3 expression suggests a potential therapeutic approach for modulating FLT3 activity in various cellular contexts. The specificity of these changes underscores the precision and efficacy of AON-mediated gene regulation, highlighting the potential of AONs as therapeutic agents targeting specific gene isoforms and transcripts.

In addition, the Raman spectra of MOLM-13 cells were characterized. Band analysis indicated that the spectra of these cells were dominated by molecular vibrations of carotenoids, proteins, lipids, nucleic acids, and cytochrome C.

Although we obtained a substantial proportion of cells from each experimental group, our study has some limitations. The number of measurements per sample was constrained by the limited lifespan of the cells, which resulted in relatively small sample sizes. Additionally, the variability in the observed spectra may be attributed to the cellular state, ranging from younger to older cells, which poses challenges in their differentiation using standard microscopy techniques. Despite these limitations, the combined findings from our analyses offer valuable insights into the molecular mechanisms that modulate FLT3 expression and cellular composition in response to midostaurin and AON treatments. Further elucidation of these mechanisms holds promise for the development of targeted therapeutic interventions aimed at addressing dysregulated FLT3 signaling in leukemia and other associated disorders.

Collectively, these results not only enhance our understanding of FLT3 regulation, but also pave the way for the development of targeted therapeutic interventions to address dysregulated FLT3 signaling in leukemia and related disorders. The specific treatment approach is becoming increasingly compelling in light of current research. The promising outcomes of this study hold the potential for significant advancements in AML treatment strategies.

Ethics statement

Not applicable.

Data availability statement

The datasets generated and analyzed in the current study are available from the corresponding author upon request.

Conflict of interest statement

No financial or non-financial benefits have been received or will be received from any party directly or indirectly related to the subject of this study.

Funding information

The grant SVV no. 260 651, GAUK no. 350322, the Cooperatio program and The project National Institute for Cancer Research - NICR (Programme EXCELES, ID Project No. LX22NPO5102) - Funded by the European Union - Next Generation EU, supported the work.

CRediT authorship statement

Macečková D.: Conceptualization; Methodology; Validation; Investigation; Writing - original draft; Visualization. Vaňková L.: Methodology; Investigation; Writing - original draft. Bufka J.: Formal analysis. Moravec J.: Formal analysis; Hošek P.: Formal analysis; Pitule P.: Writing - Review & Editing; Supervision.

Nieuwkoop T, Finger-Bou M, van der Oost J, Claassens NJ (2020) The Ongoing Quest to Crack the Genetic Code for Protein Production. Mol Cell 80(2):193-209. https://doi.org/10.1016/j.molcel.2020.09.014
Simms CL, Thomas EN, Zaher HS (2017) Ribosome-based quality control of mRNA and nascent peptides. Wiley Interdiscip Rev RNA 8(1):10.1002/wrna.1366. https://doi.org/10.1002/wrna.1366
Magenau J, Couriel DR (2013) Hematopoietic stem cell transplantation for acute myeloid leukemia: to whom, when, and how. Curr Oncol Rep 15(5):436-44. https://doi.org/10.1007/s11912-013-0340-6
Daher-Reyes G, Kim T, Novitzky-Basso I, Kim KH, Smith A et al (2021) Prognostic impact of the adverse molecular-genetic profile on long-term outcomes following allogeneic hematopoietic stem cell transplantation in acute myeloid leukemia. Bone Marrow Transplant 56(8):1908-1918. https://doi.org/10.1038/s41409-021-01255-4
Orsolic I, Carrier A, Esteller M (2023) Genetic and epigenetic defects of the RNA modification machinery in cancer. Trends Genet 39(1):74-88.https://doi.org/10.1016/j.tig.2022.10.004
Dwivedi S, Purohit P, Vasudeva A, Kumar M, Agrawal R et al (2022) Gene therapy and gene editing in healthcare. In: Barh D (ed) Biotechnology in Healthcare, 1st edn. Academic Press, pp 147-175. https://doi.org/10.1016/B978-0-323-89837-9.00006-1
Chan DXH, Nama S, Sundaram G, Sampath Pl (2014) MicroRNA Therapeutics to Target Brain Tumor Stem Cells In: Rajasekhar VK (ed) Cancer Stem Cells, 1st edn, John Wiley & Sons, pp 403-415. https://doi.org/10.1002/9781118356203.ch30
Chanput W, Mes JJ, Wichers HJ (2014) THP-1 cell line: an in vitro cell model for immune modulation approach. Int Immunopharmacol 23(1):37-45. https://doi.org/10.1016/j.intimp.2014.08.002
Liu H, Lorenzini PA, Zhang F, Xu S, Wong MSM et al (2018). Alternative splicing analysis in human monocytes and macrophages reveals MBNL1 as major regulator. Nucleic Acids Res 46(12):6069-6086. https://doi.org/10.1093/nar/gky401
Jiang X, Bugno J, Hu C, Yang Y, Herold T et al (2016) Eradication of Acute Myeloid Leukemia with FLT3 Ligand-Targeted miR-150 Nanoparticles. Cancer Res 76(15):4470-80. https://doi.org/10.1158/0008-5472.CAN-15-2949
Konstantinov SM, Kostovski A, Topashka-Ancheva M, Genova M, Berger MR (2002) Cytotoxic efficacy of bendamustine in human leukemia and breast cancer cell lines. J Cancer Res Clin Oncol 128(5):271-8. https://doi.org/10.1007/s00432-002-0331-8
Skopek R, Palusińska M, Kaczor-Keller K, Pingwara R et al (2023) Choosing the Right Cell Line for Acute Myeloid Leukemia (AML) Research. Int J Mol Sci 24(6):5377. https://doi.org/10.3390/ijms24065377
Almatani MF, Ali A, Onyemaechi S, Zhao Y, Gutierrez L et al (2021) Strategies targeting FLT3 beyond the kinase inhibitors. Pharmacol Ther 225:107844. https://doi.org/10.1016/j.pharmthera.2021.107844
Gallogly MM, Lazarus HM, Cooper BW (2017) Midostaurin: a novel therapeutic agent for patients with FLT3-mutated acute myeloid leukemia and systemic mastocytosis. Ther Adv Hematol 8(9):245-261. https://doi.org/10.1177/2040620717721459
Cheng J, Qu L, Wang J, Cheng L, Wang Y (2018) High expression of FLT3 is a risk factor in leukemia. Mol Med Rep 17(2):2885-2892. https://doi.org/10.3892/mmr.2017.8232
Rehman A, Akram AM, Chaudhary A, Sheikh N, Hussain Z et al (2021) RUNX1 mutation and elevated FLT3 gene expression cooperates to induce inferior prognosis in cytogenetically normal acute myeloid leukemia patients. Saudi J Biol Sci 28(9):4845-4851.https://doi.org/10.1016/j.sjbs.2021.07.012
Azemtsop Matanfack G, Rüger J, Stiebing C, Schmitt M, Popp J (2020) Imaging the invisible-Bioorthogonal Raman probes for imaging of cells and tissues. J Biophotonics 13(9):e202000129. https://doi.org/10.1002/jbio.202000129
Neugebauer U, Clement JH, Bocklitz T, Krafft C, Popp J (2010) Identification and differentiation of single cells from peripheral blood by Raman spectroscopic imaging. J Biophotonics 3(8-9):579-87. https://doi.org/10.1002/jbio.201000020
Cheng X, Liang H, Li Q, Wang J, Liu J et al (2022) Raman spectroscopy differ leukemic cells from their healthy counterparts and screen biomarkers in acute leukemia. Spectrochim Acta A Mol Biomol Spectrosc 15;281:121558. https://doi.org/10.1016/j.saa.2022.121558
Li W, Wang L, Luo C, Zhu Z, Ji J, Pang L et al (2020) Characteristic of Five Subpopulation Leukocytes in Single-Cell Levels Based on Partial Principal Component Analysis Coupled with Raman Spectroscopy. Appl Spectrosc 74(12):1463-1472. https://doi.org/10.1177/0003702820938069
Managò S, Mirabelli P, Napolitano M, Zito G, De Luca AC (2018) Raman detection and identification of normal and leukemic hematopoietic cells. J Biophotonics 11(5):e201700265. https://doi.org/10.1002/jbio.201700265

No competing interests reported.

Download PDF

Editorial decision: Revision requested
15 Oct, 2024
Reviews received at journal
14 Oct, 2024
Reviewers agreed at journal
26 Sep, 2024
Reviewers invited by journal
03 Sep, 2024
Editor assigned by journal
31 Aug, 2024
Submission checks completed at journal
31 Aug, 2024
First submitted to journal
30 Aug, 2024

You are reading this latest preprint version

Antisense oligonucleotides as a targeted therapeutic approach in model of acute myeloid leukemia

Status:

Version 1

Abstract

Background

Methods and Results

Conclusions

Figures

1. Introduction

2. Materials and methods

2.1. Cell culture

2.2. THP-1 cell line transfection for optimization and effect duration investigation

2.3. Targeted treatment of MOLM-13 FLT3 mutated cell line with inhibitor and AONs

2.4. qPCR and dot blot analysis

2.4.1. Image processing and statistical analyses

2.5. Raman spectroscopy

2.5.1. Raman data processing

3. Results

4. Discussion

5. Conclusion

Declarations

References

Additional Declarations

Status:

Version 1