Experimental animals and training protocols.
All experimental protocols, including the treadmill running and tendon sample collection were approved by the animal ethics committee of Nanfang hospital, Southern Medical University.
Eighteen male Wistar rats, aged 12 weeks, weighing in the range of 200–250 g, were purchased from the Animal Experimental Center of Southern Medical University and randomly divided into three groups: (1) control [CON, n = 6], (2) moderate treadmill running [MTR, n = 6], and (3) strenuous treadmill running [STR, n = 6]. All animals were housed in the animal care facility on a 12:12-h light-dark cycle and were fed with chow and water ad libitum.
The running protocol was conducted as previously described [17]. Briefly, all animals were firstly accustomed to 1 week’s treadmill running at a speed of 10 meters per min(30 min per day, 5 days per week). Then, the mice in the MTR and STR groups ran for 60 minutes a day, 5 days a week, for 8 weeks; respectively at a speed of 19 meters per min with 5° incline (MTR) and 27 meters per min with 10° incline (STR). On the other hand, rats in CON group were set to move freely. Experimental protocols and the use of experimental animals are implemented in accordance with the standards of the institution.
After the treadmill running experiment, the experimental animals were killed by asphyxiation with carbon dioxide and cervical dislocation. Remove the plantaris tendon and other soft tissues, and dissect the gastrocnemius and soleus muscles. The two combined tendons were cut at the distal end of the gastrocnemius soleus and the stop point of the calcaneus.[10]. For each rat, one Achilles tendon was fixed in 10% buffered formalin, and then histological examination was performed; while place the contralateral Achilles tendon at -80˚C for cryopreservation and then extract mRNA.
Hematoxylin-eosin (H&E) staining.
H&E staining was conducted as previously described [18]. Formalin-fixed tendon is treated with alcohol and embedded in paraffin. Next, samples were cut into 4-µm–thick sections. After deparaffinization and rehydration, the sections were stained with hematoxylin-eosin. The morphologies of collagen fibrils were observed under the microscope (Axioskop 40 Pol) (20 × objective).
Immunohistochemistry for lubricin.
Immunohistochemistry for lubricin was performed as described previously[1]. Briefly, 4-mm thick sections were deparaffinized with xylene and alcohol, followed by incubation with 3% hydrogen peroxide for 20 min to quench the endogenous peroxidase activity. After the antigen retrieval and blocking steps, the sections were incubated for 8–12 h at 4 ˚C with specific anti-rat lubricin (sc-98454) (Santa Cruz Biotechnology INC., CA, USA). The secondary antibodies (1: 200; all from Santa Cruz Biotechnology INC., USA) were incubated for 1 h at room temperature. Then, sections were treated with 3,3’-Diaminobenzidine tetrahydrochloride (DAKO, Glostrup, Denmark) and counter-stained in haematoxylin. In the controls the primary antibody was replaced with blocking solution. All incubation conditions and times were strictly controlled for guarantee of good comparability. Observe the results under the Nikon H600L microscope (Tokyo, Japan). Images were collected using Image-Pro Plus 6.0 software (Media Cybernetics, Silver Spring, MD, USA).
Western blotting.
Achilles tendon tissues were lysed with radioimmunoprecipitation assay lysis bufferpre-mixed with 0.5% sodium deoxycholate, 0.5 mM phenylmethylsulfonyl fluoride and protease inhibitors (all from SigmaAldrich; Merck KGaA). Next, the samples were oscillated by ultrasound system and centrifuged at 12,000 x g for 15 min (4˚C). The supernatant was collected, and the protein concentration was measured with a NanoDrop 1000 spectrophotometer (Thermo Fisher scientific fc, Inc.). Subsequently, the protein samples (20 µg for each sample) were separated using 12% SDSPAGE (BioRad Laboratories, CA, USA) and electrophoretically transferred onto the polyvinylidene difluoride membranes (Thermo Fisher Scientifc, MA, USA). Next, 3% bovine serum albumin was used to block the menbranes, followed by incubation with antirat lubricin antibody (1:100; Abcam ab175404) for 12 h at 4˚C. Then the membranes were washed with 0.1% TBST buffer for three times and incubated for 1 h at room temperature with mouse antirabbit IgGHRP antibodies (1:1,000; Santa Cruz sc2357). Chemiluminescence solution (Luminata™ Crescendo Western HRP substrate; Ma, USA) and molecular imaging® ChemiDoc™ XRS system (Bio Rad Laboratory, Inc.) were used for luminescence imaging.. The relative protein expression of lubricin (normalized to GAPDH level) was assessed by densitometric quantitative analysis using ImagePro Plus software (version 6.0, Media Cybernetics, MD, USA).
Quantitative real-time polymerase chain reaction (qRT-PCR)
Trizol reagent (TaKaRa, Dalian, China) was used to extract total RNA from the Achilles tendon tissues according to the manufacturer’s protocols. The RNA was reverse transcribed into cDNA using a transcription RT kit (TaKaRa Dalian, China). Real-time quantitative PCR was performed on ABI 7500 Fast system (Applied Biosystems, Foster City, CA, USA), using the following protocol: 10 min heating at 95 ˚C, 95 ˚C for 10 sec (45 cycles), 55 ˚C for 15 sec and 72 ˚C for 30 sec. Table 1 showed the information of PCR primers (Bio Teke, Beijing, China). The expression level of the target gene was normalized to GAPDH gene level. Relative mRNA expression of lubricin in MTR or STR group standardized to CON group was calculated by 2-ΔΔCт.
Table 1
Primer sequence used in quantitative PCR
Primer
|
Forward
|
Reverse
|
GAPDH
|
5'-GGCACAGTCAAGGCTGAGAATG − 3'
|
5'-ATGGTGGTGAAGACGCCAGTA-3'
|
TGF-β1
|
5'- TGCGCCTGCAGAGATTCAAG − 3'
|
5'- TAACGCCAGGAATTGTTGCTA-3'
|
IL-1
|
5'-CTCCATGAGCTTTGTACAAGG-3'
|
5'-TGCTGATGTACCAGTTGGGG-3'
|
GAPDH, glyceraldehyde-3-phosphate dehydrogenase; TGF-β1, transforming growth factor-β1; IL-1, interleukin-1. |
Statistical methods.
Data are presented by mean ± standard deviation. One-way analysis of variance was used for group comparison and Tukey's test was used for post hoc analysis. Using SPSS 21.0 (Chicago, IL, USA) for statistical analysis, p < 0.05 was statistically significant.