Ethics statement
All procedures were authorized by the academic ethics committee of Cancer Hospital Affiliated to the University of Chinese Academy of Sciences. The experiment was carried out in strict accordance with the guidelines for the management and use of laboratory animals. All the laboratory procedures were used to reduce the pain of the mice.
Isolation and cultured of CAFs and NFs
CAFs and NFs were isolated from cancer tissues and adjacent normal lung tissues of 10 patients (7 males and 3 females, mean age 69 years) with NSCLC. The inclusion criteria were patients with primary NSCLC whose tumor stage was IA to IVA. Surgery was used as the initial treatment without preoperative chemotherapy or radiotherapy. The patients with other diseases or tumors were excluded. Lung cancer and normal lung tissue were cut into 1 mm3 small pieces and cultured in DMEM (Nacalai Tesque Inc., Kyoto, Japan) containing 10% fetal bovine serum (FBS) (GIBCO, Grand Island, NY, USA), 100 U/mL penicillin and 100 µg/mL streptomycin, respectively. The medium was changed once a week until the tissue was surrounded by adherent fibroblasts. After about 3 weeks, fibroblasts were separated from epithelial cells and endothelial cells by trypsin. When the confluence reached 80%, the cells were passaged at the ratio of 1:3. The morphology of CAFs and NFs was observed under the inverted microscope (CKX41, Olympus, Tokyo, Japan).
Immunofluorescence staining
CAFs and NFs were seeded on 24-well plates. After 24 hours, they were fixed with 4% paraformaldehyde for 30 minutes, infiltrated with 0.3% Triton X-100 for 5 minutes, and incubated with antibodies against fibroblast activation protein-α (FAPα) (ab28244, Abcam, Cambridge, MA, USA) and α-smooth muscle actin (α-SMA) (ab124964, Abcam) overnight at 4℃. After 3 regimens of with phosphate-buffered saline (PBS) washing, secondary goat anti-rabbit IgG H&L (FITC) (ab6717, Abcam) was used for incubation at room temperature for 2 hours. Finally, the cover glass was mounted on the slide and examined under the inverted fluorescence microscope (TS100-F, Nikon, Tokyo, Japan).
Culture of A549 and H1299 cells
Human NSCLC cells A549 and H1299 (ATCC, Manassas, VA, USA) were cultured in RPMI 1640 (GIBCO) containing 10% fetal bovine serum, 50 U/mL penicillin and 50 U/mL streptomycin. NSCLC cells were cocultured with CAFs or NFs at a ratio of 5:1, and the total number of cells was 1 × 106.
Cell grouping
The construction and packaging of SDF-1 interference vector si-SDF-1 and control si-NC, lncRNA XIST interference vector si-XIST and control Xist NC, miR-15a-5p mimic and miR-NC were carried out by Gene Pharma (Shanghai, China). Lipofectamine 3000 (Thermo Fisher Scientific) was used for transfection according to the instructions. AMD3100 (Catalog No. CAS 155148-31-5) was purchased from Santa Cruz biotechnology, Inc. (Dallas, TX, USA) and dissolved in dimethyl sulphoxide (DMSO) at 2 µmol/L. The following experiment was carried out 48 hours later.
Cells were assigned into NFs, CAFs, CAFs-si-NC, CAFs-si-SDF-1, CAFs + DMSO, CAFs + AMD3100, CAFs + si-NC, CAFs + si-XIST, CAFs + miR-NC and CAFs + miR-15a-5p groups.
Transwell assay
All 1 × 105 cells were seeded in serum-free medium in the apical chamber of 24-well Transwell (8-µm pore size, Corning Costar) pretreated with Matrigel (BD Biosciences, Franklin Lakes, NJ, USA), and the medium containing 10% FBS was added in the basolateral layer. The cells were cultured for 24 hours, stained with 0.1% crystal violet solution, observed and counted under the microscope (Olympus).
Scratch test
When the confluence reached 90%, the cells were seeded in 6-well plates, cultured for 24 hours, and scratched vertically on the cell surface with 200 µL sterile pipette. The cells were cultured in serum-free medium and photographed with Image Pro Plus software (Media Cybernetics, Rockville, MD, USA) at different time points (0 and 24 hours).
Dual-luciferase experiment
The binding sequence and mutation sequence of lncRNA XIST and miR-15a-5p, miR-15a-5p and MMP3 were cloned into psicheck2 luciferase vector (Promega, Madison, WI, USA) to construct wild-type plasmids XIST-WT, MMP3-WT and mutant plasmids XIST-MUT and MMP3-MUT. The constructed plasmids were cotransfected with mimic NC and miR-15a-5p mimic into HEK293T cells (ATCC). Lipofectamine 2000 (Life Technologies) was used as the transfection reagent. The luciferase activity was detected 48 hours later.
RNA immunoprecipitaion (RIP) assay
EZ Magna rip Kit (Millipore, Bedford, MA, USA) was used for RIP analysis. Cells were collected and resuspended with RIP lysate. Then, it was incubated with RIP buffer containing magnetic beads and human anti-Ago2 antibody (Millipore). The precipitates were digested with proteinase K, and then RNA was isolated and purified, and analyzed by qPCR.
Metastatic model of rat NSCLC in nude mice
A total of 12 4-week-old male BALB/C nude mice weighing 13-15g were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd [Beijing, China, license number: SYXK (Beijing) 2017-0033].
Totally 2 × 106 cells were injected into the tail vein of nude mice. Four weeks later, the mice were killed. The number of metastatic nodules on the surface of lung was calculated by hand. Hematoxylin and eosin (HE) staining was used for histological analysis. The animals were randomly divided into H1299 + NFs group and H1299 + CAFs group.
HE staining
The lung tissue was paraffin embedded, sliced at 5 µm, dewaxed with xylene and dehydrated with ethanol, dyed with hematoxylin for 5 min, and soaked with double distilled water. Next, the sections were dyed with eosin for 2 min, soaked with xylene for 2 min, sealed with neutral resin and observed under light microscope.
Reverse transcription quantitative polymerase chain reaction (RT-qPCR)
The TRIzol (Invitrogen, Carlsbad, CA, USA) was used to extract the total RNA. According to the instructions, the total mRNA was reverse transcribed using the miScript reverse transcription kit (Qiagen, Valencia, CA, USA), and then the RNA expression was detected using the MiScript SYBR Green PCR kit (Qiagen), with U6 as the internal reference. For mRNA expression, reverse transcription was performed with SuperScript III First-Strand Synthesis System (Invitrogen), and RT-qPCR was performed with Powerup SYBR Green qPCR master mix in an ABI 7500 fast real-time PCR system (Applied Biosystems, Carlsbad, CA, USA). GAPDH was used as internal reference. The relative expression was expressed by 2−ΔΔCT [20]. The primer sequences are listed in Table 1.
Table 1
Gene | Forward 5’-3’ | Reverse 5’-3’ |
FAP-α | atgaagacttgggtaaaaat | atctccaaagcatggttcta |
α-SMA | atgtgtgaagaagaggacag | agtcattgtagaaagagtgg |
SDF-1 | atgaacgccaaggtcgtggt | tcacatcttgaacctcttgt |
CXCR4 | atgtccattcctttgcctct | tcatgcttctcagtttcttc |
LncRNA XIST | TGCTGATCATTTGGTGGTGT | TGACTTCCTCTGCCTGACCT |
miR-15a-5p | TAGCAGCACATAATGG | CAGTGCGTGTCGTGGA |
MMP3 | atgaagagtcttccaatcct | atcagcctctccttcataca |
U6 | AGACCGTTCGTCAACCTAGC | GAAAGACCGCAGCAAAATTC |
GAPDH | atggtgaaggtcggtgtgaa | agttgtcattgagagcaatg |
Western blot analysis
RIPA (Beyotime, Shanghai, China) was used to extract the total protein of cells or tissues, and bicinchoninic acid method was used to detect the protein concentration. 15% SDS-PAGE electrophoresis was used. After successful membrane transfer, 3% skim milk was used to block the membranes for 2 hours, and PBST was used to clean the membranes. Then, primary antibodies SDF-1 (ab25117, Abcam), CXCR4 (ab181020, Abcam), matrix metalloproteinase 3 (MMP3) (ab52915, Abcam), E-cadherin (ab76011, Abcam) and N-cadherin (ab76319, Abcam) were added and incubated overnight at 4℃. After 90 min incubation with the secondary antibody goat anti-rabbit IgG H&L (HRP) (ab205718, Abcam), the membranes were washed with PBS, developed with chemiluminescence, and gray value was analyzed. The internal reference was GAPDH (ab9485, Abcam).
Statistical analysis
GraphPad Prism 8.01 (GraphPad Software Inc., San Diego, CA, USA) was used for data analysis and mapping. Data were in normal distribution and expressed as mean ± standard deviation. The t test was used for group pair comparison. One-way analysis of variance (ANOVA) and two-way ANOVA were used for comparison among groups. Tukey's or Sidak's multiple comparisons test was used for post hoc test. P < 0.05 indicated statistical significance.