Aerobic exercise attenuates high-fat diet-induced glycometabolism abnormalities in skeletal muscle of rats via EGR-1/PTP1B signaling pathway

doi:10.21203/rs.3.rs-5007813/v1

Download PDF

Research Article

Aerobic exercise attenuates high-fat diet-induced glycometabolism abnormalities in skeletal muscle of rats via EGR-1/PTP1B signaling pathway

https://doi.org/10.21203/rs.3.rs-5007813/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Objective

Defects in glycogen anabolism led to the development of insulin resistance (IR). Aerobic exercise ameliorates IR by augmenting insulin signaling, yet, the precise mechanism behind this improvement remains unclear. This study explored whether 6 weeks aerobic exercise enhances glycogen anabolism and insulin sensitivity via EGR-1/PTP1B signaling pathway in skeletal muscle.

Methods

Sprague-Dawley rats fed a high-fat diet (HFD) performed treadmill exercise, and were examined for an oral glucose tolerance test and IR. PAS staining and anthrone colorimetry were used to assess the skeletal muscle glycogen content. RT-qPCR, western blot and immunofluorescence were used to detect EGR-1/PTP1B pathway and associated signaling molecules.

Results

Results showed that exercise reduced blood glucose levels and HOMA-IR, increased muscle glycogen content, inhibited EGR-1, PTP1B, and GSK-3β mRNA and protein levels, and promoted IRS-1, AKT, and GLUT4 protein and mRNA expression.

Conclusion

In summary, aerobic exercise facilitates skeletal muscle glycogen anabolism and improves insulin sensitivity in HFD rats through the EGR-1/PTP1B pathway, with significant implications for preventing IR.

Glycometabolism

Insulin sensitivity

Aerobic exercise

Glycogen anabolism

EGR-1

PTP1B

Long-term consumption of a high-fat diet can lead to obesity and insulin resistance (IR) ^[1], subsequently triggering metabolic diseases such as Type 2 Diabetes Mellitus (T2DM) ^[2]. The skeletal muscle, as the body's largest energy-metabolizing organ, plays a crucial role in preventing or alleviating IR through its ability to uptake and utilize glucose, regulation of insulin signaling pathways, and glycogen synthesis capacity ^[3–5].

Early Growth Response Factor-1 (EGR-1) is a pivotal zinc-finger transcription factor activated by various cell factors, growth factors, and hormones, participating in the regulation of cell proliferation, apoptosis, and cellular metabolism ^[6–8]. Loss of EGR-1 function has been demonstrated to improve IR in adipose tissue and liver ^{[9, 10]}. A recent study indicates that elevated EGR-1 inhibits postprandial insulin signaling and glucose uptake in skeletal muscle, thereby reducing insulin sensitivity ^[11]. Therefore, EGR-1 is considered an ideal target protein for reducing IR. Additionally, inhibiting EGR-1/Protein tyrosine phosphatase 1B (PTP1B) activity enhances skeletal muscle insulin sensitivity and postprandial blood glucose stability ^[11]. The potential mechanism underlying these beneficial effects may involve the downregulation of PTP1B activity promoting insulin receptor substrate (IRS) phosphorylation, inhibiting glycogen synthase kinase 3β (GSK-3β) activity, enhancing glycogen synthesis, and improving insulin sensitivity ^[11–13]. The insulin signaling pathway plays a crucial role in regulating glucose homeostasis and metabolism. Upon insulin binding to its receptor, IRS is activated, initiating two major pathways: AKT-mediated translocation of GLUT4 and inhibition of GSK-3β ^{[14, 15]}. In the first pathway, activated IRS promotes the phosphorylation of phosphatidylinositol-3-kinase (PI3K), leading to the activation of protein kinase B (PKB/AKT) ^[16]. Activated AKT promotes the translocation of glucose transporter type 4 (GLUT4) to the cell membrane, thereby increasing glucose uptake by the cell ^[17]. In the second pathway, AKT phosphorylates and inhibits GSK-3β, a negative regulator of glycogen synthesis. The inhibition of GSK-3β allows glycogen synthase to remain active, thereby enhancing glycogen storage ^[18]. These coordinated actions of the IRS-AKT pathway are essential for maintaining blood glucose levels and ensuring efficient energy storage and utilization. Therefore, the potential mechanism underlying these beneficial effects may involve the downregulation of PTP1B activity promoting IRS phosphorylation, inhibiting GSK-3β activity, enhancing glycogen synthesis, and improving insulin sensitivity.

Aerobic exercise, as a non-pharmacological intervention, not only improve skeletal muscle contractility in obese individuals ^[19], but also enhance insulin sensitivity ^[19]. Since glycogen anabolism and its content in skeletal muscle reflect the metabolic balance between glucose availability and insulin sensitivity, whether aerobic exercise improves IR through skeletal muscle glycogen anabolism and if the EGR-1/PTP1B signaling pathway plays a role is still unclear. Therefore, the purpose of this study was to examine the effect of six weeks aerobic exercise on skeletal muscle EGR-1/PTP1B pathway in response to high-fat diet, and further explore whether exercise improves skeletal muscle glycogen anabolism and insulin sensitivity through the EGR-1/PTP1B signaling pathway. The findings may provide new strategies for preventing the occurrence and progression of T2DM or IR.

2.1 Experimental animal

Twenty-four 6-week-old male Sprague-Dawley (SD) rats (200 ± 25 g) were placed in a specific pathogen-free (SPF) environment, two in each cage, with free water and standard food. After 1 week of adaptation, the rats were randomly divided into 3 groups: control group (CON, n = 8), high-fat diet group (HFD, n = 8) and high-fat diet + aerobic exercise group (HE, n = 8). The high-fat diet (containing 60 kcal% fat, D12492, Open-Source Diets®, Research Diets, NEW Brunswick, NJ, USA) and aerobic exercise intervention period were 6 weeks. All procedures comply with the National Research Council Guidelines for the Care and Use of laboratory animals. This study was conducted according to the animal management regulations of the Ministry of Health of China and approved by the Research Ethics Committee of Zhejiang Normal University (No. ZSDW2022027).

2.2 Treadmill running protocol

The HE group underwent a 3-day acclimatization to treadmill exercise for 30 min/day at a speed of 10–15 m/min. Then, for 5 days a week of formal exercise, the exercise load comprised of running at 15 m/min for the first 5 minutes, 20–25 m/min for the next 50 minutes, and 15 m/min for the last 5 minutes, without incline. The exercise program was scheduled between 5:00 and 7:00 p.m. The exercise intensity ranged from approximately 70–75% of VO2 max ^[21]. We adopted this exercise protocol based on the previous studies, which reported to be effective to produce physiological changes in SD rats ^[22].

2.3 Oral glucose tolerance test (OGTT) and insulin sensitivity

OGTT was performed twice in our study following 12-hours fasting. The first OGTT was prior to the intervention (pre or baseline) and the second OGTT was after the intervention (post). Following the exercise, the animals rested for 12 hours (while feeding) and then fasted for 12 hours for the OGTT. Blood sample was collected from the tail of each rat at 0, 30, 60, 90, and 120 minutes after oral administration of glucose (2g/kg body weight). The changes in blood glucose levels were measured using glucometer (Sinocare, Changsha, China) and recorded three times to calculate the average value. Glucose area under the curve (AUC) was calculated and presented as histograms ^[23].

Serum insulin levels were measured using the Rat Insulin ELISA kit (Sangon Biotech, China), according to the manufacturer's instructions. HOMA-IR was calculated as follows: HOMA-IR = ((fasting plasma insulin in µIU/mL) × (fasting plasma glucose in mg/dL))/405 ^[24]. These assessments (blood glucose, insulin and HOMA-IR) were performed after the intervention under fasting condition.

2.4 Sample collection and biochemical assays

Forty-eight hours after the last exercise session (6 weeks), rats were anesthetized with urethane (2 g/kg, intraperitoneally) following a 12-hour fasting period. Blood samples (5 ml) were collected via venipuncture into an anticoagulant tube and centrifuged at 1,811 RCF (g) for 15 minutes. Then the portions of the quadriceps muscle were excised for different analyses: one part was embedded in optimal cutting temperature compound (OCT, Sakura, Tokyo, Japan) and frozen in isopentane, while another part was frozen in liquid nitrogen and stored at -80°C. The quadriceps muscle was selected for its balanced distribution of type I and type II muscle fibers, ease of access for reliable sampling, and its relevance to metabolic outcomes ^{[25, 26]}.

2.5 PAS staining and measurement of skeletal muscle glycogen content

Periodic acid-Schiff (PAS) staining was utilized by immersing the slides in the periodic acid solution for 10 minutes. They were then washed with distilled water three times and incubated with Schiff solution at 37°C for 45 minutes. Finally, the slides were washed with distilled water for 5 minutes and dehydrated with graded alcohols.

To measure glycogen levels in quadriceps, a Glycogen Assay Kit (solarbio, BC0345) was employed following the manufacturer's instructions. Snap-frozen quadriceps (80 mg) were homogenized and diluted with 1 ml dH₂O. The homogenate was boiled at 100 ℃ for 20 minutes, centrifuged at 8000 g for 10 minutes at 25℃ to remove insoluble material, and the supernatant was collected. Glycogen was extracted by a strong alkaline extract solution, and the glycogen content was determined in a 96-well plate using anthrone chromogen under strong acidic conditions ^[27].

2.6 Quantitative real-time polymerase chain reaction (qPCR)

The quadriceps were lysed with Trizol reagent, followed by total RNA extraction. The extracted RNA was subsequently reverse transcribed into cDNA using PrimeScript RT Master Mix (Takara, Shiga, Japan). A qPCR assay was conducted using PowerUpTM SYBRTM Green Master Mix (Thermo Fisher Scientific, Waltham, USA). The reaction conditions comprised pre-denaturation at 95°C for 5 min, denaturation at 95°C for 10 s, and annealing at 60°C for 30 s for 40 cycles. Gene expression levels were quantified using the 2^−ΔΔCt method with GAPDH as the internal reference ^[22]. The primer sequences are provided in Table 1.

Table 1

Primers for qPCR used in this study.
Gene	Forward	Reverse
Egr-1	ATTTCCTATTCAAAGTCCGAGAGTCAG	TCCATCAGTAAGAGGCAGGTGTC
Ptp1b	CGGACCACCTCAACTCAACCAATC	CAACACCACCTTGTCGTACTCGTC
Glut4	GCTGGGCGACGGACACTC	GGACACATAACTCATGGATGGAACC
Gsk-3b	CCACCATCCTTATCCCTCCTCAC	TGTCCACGGTCTCCAGCATTAG
Irs1	CAAGCCTGTCCTCTCCTACTACTC	GCAGTTGCGGTATAGCGAAGG
Akt	TGTGGCAAGATGTGTATGAGAAGAAG	AGGCGGCGTGATGGTGATC
Gapdh	AAGTTCAACGGCACAGTCAAGG	GACATACTCAGCACCAGCATCAC

2.7 Western Blotting

Total protein was extracted from rat quadriceps muscle tissue using RIPA lysate, and its protein concentration was determined using the BCA method. Equal masses of protein were subjected to electrophoresis and subsequently transferred to polyvinylidene fluoride (PVDF) membranes. The PVDF membranes were then blocked in TBST containing 5% skimmed milk at room temperature for 1 hour. Next, the membrane was incubated overnight at 4°C with primary antibodies: EGR-1 (proteintech, 22008-1-AP), PTP1B (Santa Cruz, sc-133259), GSK-3β (proteintech, 67329-1-Ig), and GLUT4 (proteintech, 66846-1-IG). After washing three times with TBST, the membrane was incubated at room temperature for 2 hours with secondary antibodies: goat anti-mouse (Proteintech, SA00001-1) or goat anti-rabbit (CST, #7074). The dilution ratio of all antibodies was 1:2000. The membrane was observed using an enhanced chemiluminescence kit (Thermo, USA) and a gel imaging system (Bio-Rad, USA). Use Fiji software to measure the optical density value of the target protein relative to the optical density of GAPDH ^[28].

2.8 Immunofluorescence

The slides were fixed with 4% paraformaldehyde for 10 minutes at room temperature. After three washes with PBS (5 minutes each), skeletal muscle slides were permeabilized with 0.5% Triton X-100 in PBS for 20 minutes, followed by three additional washes with PBS. Subsequently, the slides were blocked with 1% BSA in PBST (PBS + 22.52 mg/mL Glycine + 0.1% Tween 20) for 30 minutes at room temperature. Primary antibodies, EGR-1 and PTP1B, were incubated overnight at 4℃. They were rinsed three times with PBS and incubated with fluorescent secondary antibodies at a ratio of 1:500 in antibody dilution buffer for 1 hour at room temperature in the dark. The secondary antibodies used were Alexa Fluor 488-conjugated goat anti-mouse and Alexa Fluor 594-conjugated goat anti-rabbit (Abcam, ab150113; ab150080). Finally, the cell nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI) (Beyotime Institute of Biotechnology, China). The stained tissue was observed and photographed using a fluorescence microscope ^[28].

2.9 Statistical analysis

Data were statistically analyzed using IBM SPSS Statistics 20 (Chicago, USA), and image analysis and mapping were performed using Fiji software and GraphPad Prism 9 (San Diego, USA). The Pearson correlation coefficient of the selected images was analyzed using Fiji software. All data were summarized as mean ± SEM (n = 8 per group). Comparisons between multiple groups were conducted using a one-way analysis of variance (ANOVA), with post hoc analysis by Tukey’s multiple comparisons test. A significance level of P < 0.05 was considered statistically significant.

3.1 Aerobic exercise reduced body weight and fat weight in rats fed a high-fat diet

During the intervention period, we systematically recorded the weekly body weights of the experimental rats. The results showed that the HFD group had a significant increase in body weight after week 6 compared with the CON group (Fig. 1a-b). However, this increase was effectively mitigated in the HE group (Fig. 1a-b). Furthermore, our analysis revealed a significant reduction in subcutaneous fat deposition within the HE group compared to the HFD group (Fig. 1c). Conversely, no significant distinction was observed in epididymal fat between the two groups (Fig. 1d). These outcomes suggest that aerobic exercise might preferentially mobilize subcutaneous fat than visceral fat for energy.

3.2 Aerobic exercise restored insulin sensitivity in rats fed a high-fat diet

To evaluate glucose metabolism markers in rats exposed to a high-fat diet, we conducted pre- and post-intervention OGTT. There was no significant difference in pre-intervention OGTT among the groups. (Fig. 2a-b). Following the intervention, the OGTT AUC for the HFD group surpassed that of the CON and HE groups (Fig. 2c-d), suggesting a diminished glucose tolerance in rats subjected to a high-fat diet, which was ameliorated through aerobic exercise. Comparative analysis revealed that, in contrast to the CON group, the HFD group manifested elevated levels of fasting blood glucose, serum insulin, and HOMA-IR (Fig. 2e-g). In contrast, these parameters decreased significantly in the HE group (Fig. 2e-g), underscoring the beneficial impact of aerobic exercise on insulin sensitivity in rats subjected to a high-fat diet.

3.3 Aerobic exercise restored glycogen content in skeletal muscle of rats fed a high-fat diet

To evaluate the glycogen content in rat skeletal muscle, we utilized PAS staining and glycogen content detection kits. Both methodologies consistently indicated a substantial reduction in glycogen content within the HFD group compared to the CON group (Fig. 3a-c). The decrease in glycogen content indicates potential adversities of high-fat diet on glycogen anabolism in the skeletal muscle of rats. This impact may be due to the reduced insulin sensitivity, which leads to decrease glucose uptake, and consequently reduce glycogen synthase activity. However, 6 weeks of aerobic exercise restored glycogen anabolism in skeletal muscle, as evidenced by restored PAS staining and glycogen content in HE group (Fig. 3a-c).

3.4 Aerobic exercise restored glycogen anabolism in skeletal muscle of rats fed a high-fat diet

To elucidate the molecular mechanism underlying the improvement of glycogen anabolism through aerobic exercise, we investigated the mRNA expressions and protein levels of related proteins in rat skeletal muscle. In comparison to the CON group, the mRNA expressions (Fig. 4a-c) and protein levels (Fig. 4e-g) of IRS-1, AKT, and GLUT4 were significantly decreased in the HFD group, while GSK-3β showed a marked increase (Fig. 4d and h). However, the aerobic exercise intervention significantly restored the mRNA expressions (Fig. 4a-c) and proteins levels (Fig. 4e-g) of IRS-1, AKT, and GLUT4. In addition, the mRNA and protein levels (Fig. 4d and h) of GSK-3β was significantly inhibited in HE group. The results showed that a high-fat diet adversely affected glycogen anabolism in the skeletal muscle of rats, and aerobic exercise restored these adversities by promoting the IRS-1, AKT, GLUT4 and GSK-3β signaling molecules, indicating the recovery of glycogen anabolism in the skeletal muscle of rats.

3.5 Aerobic exercise inhibited EGR-1/PTP1B mRNA and protein in rats fed a high-fat diet and restored glycogen anabolism

To further investigate the mechanism underlying impaired glycogen anabolism, we assessed the mRNA expressions and protein levels of EGR-1 and PTP1B in quadriceps. In addition, Pearson correlation coefficient analysis was performed to assess the relationship between EGR-1 and PTP1B across the experimental groups. The Pearson correlation coefficient quantifies the strength and direction of linear association between two variables, ranging from − 1 (perfect negative correlation) to 1 (perfect positive correlation) ^[29]. Through the analyses, we observed that the mRNA (Fig. 5a and b) and protein (Fig. 5c and d) levels of EGR-1 and PTP1B, along with the extent of immunofluorescence co-localization, were significantly higher in the HFD group compared to the CON group (Fig. 5f-i). However, the increased mRNA, protein and immunofluorescence of EGR-1 and PTP1B were markedly reduced in the HE group (Fig. 5f-i). These findings suggest that aerobic exercise enhances insulin sensitivity by promoting glycogen anabolism in skeletal muscle through the inhibition of EGR-1/PTP1B signaling.

In this study, we demonstrated the beneficial effects of EGR-1/PTP1B in aerobic exercise intervention for preventing insulin resistance in rats. Our results indicate that rats fed a high-fat diet exhibit elevated expression of EGR-1/PTP1B protein and mRNA, and a 6-week aerobic exercise intervention improves insulin signaling pathways mediated by EGR-1/PTP1B, promoting glycogen anabolism and enhancing insulin sensitivity.

Pancreatic beta cells play a crucial role in glucose homeostasis by secreting insulin and facilitating the storage of approximately 20% and 30% of carbohydrate intake as glycogen in the liver and skeletal muscle, respectively ^{[30, 31]}. Notably, early studies have indicated a reduction in glycogen content in both the liver and skeletal muscle of individuals with T2DM, emphasizing the close connection between glycogen anabolism and T2DM pathogenesis ^[32–34]. Impaired skeletal muscle glycogen anabolism and glucose transport represent early metabolic abnormalities in the pathogenesis of T2DM ^[34–37]. Studies suggest that in obese or T2DM individuals, skeletal muscle glycogen anabolism coordinated by GSK-3β is impaired, ultimately leading to reduced insulin sensitivity ^[38–40]. GSK-3β, a key kinase regulating glycogen anabolism, phosphorylates GS, negatively regulating its activity and reducing glycogen storage capacity ^[41–43]. Elevated levels of GSK-3β in skeletal muscle result in imbalances in glycogen metabolism and hinder glucose tolerance ^[44]. Numerous studies have shown that long-term exercise training can enhance various skeletal muscle adaptations by modulating GSK-3β, including improving insulin sensitivity and increasing glycogen content ^[45–47]. Our study corroborates these findings, revealing that glycogen content was reduced in the skeletal muscle of rats induced by a high-fat diet, but 6 weeks of aerobic exercise increased glycogen content by inhibiting GSK-3β protein and mRNA expression.

GLUT4 plays a critical role in insulin-responsive glucose transport in skeletal muscle, with increased expression correlating to enhanced glucose transport and elevated skeletal muscle glycogen content ^{[48, 49]}. Therefore, GLUT4 deficiency is implicated in impairing insulin-stimulated glycogen synthesis in skeletal muscle of Type 2 Diabetes patients ^{[49, 50]}, and GLUT4 knockout mice demonstrate insulin resistance and glucose intolerance, resembling a diabetic phenotype ^{[51, 52]}. Aerobic exercise upregulates GLUT4, and contributes to reduced fasting and postprandial blood glucose levels ^[53–55]. This effect is mediated through increased insulin sensitivity and activation of key signaling pathways such as AMP-activated protein kinase (AMPK) and the PI3K/Akt cascade ^[56]. Exercise-induced muscle contractions elevate intracellular calcium levels, activating calcium/calmodulin-dependent protein kinase (CaMK) and facilitating GLUT4 translocation to the cell membrane ^[57]. Regular aerobic exercise also augments GLUT4 gene expression through transcription factors MEF2 and PGC-1α, facilitates glucose delivery, and reduces inflammatory factors, thereby improving overall glucose metabolism ^{[58, 59]}. Moreover, elevated GLUT4 activity not only augments glucose uptake but also supports glycogen synthesis, which is crucial for maintaining muscle energy reserves and function ^[60]. Our study evaluated several proteins and mRNA in the insulin signaling pathway, demonstrating increased AKT content and reduced GSK-3β activity, indicative of enhanced anabolic pathways that promote glycogen storage in skeletal muscle. AKT's role in facilitating GLUT4 translocation and glycogen synthase activity is essential for efficient glucose utilization and storage. Our findings from rats on a short-term high-fat diet underscore impaired skeletal muscle glycogen anabolism and glucose transport as key factors in reduced insulin sensitivity. Encouragingly, a 6-week aerobic exercise intervention effectively ameliorated high-fat diet-induced insulin sensitivity decline by modulating glycogen anabolism-associated proteins and mRNA. These insights underscore the intricate interplay of glycogen anabolism, GSK-3β, GLUT4, and exercise in managing insulin resistance and blood glucose control, suggesting promising therapeutic avenues for diabetes management.

Insulin receptor substrate 1 (IRS-1) is a key signaling protein in muscle that activates intracellular signaling cascades that promote the aerobic exercise response to insulin ^{[61, 62]}. Activation of IRS-1 promotes Akt and regulates various cellular processes such as glucose metabolism, apoptosis, and cell proliferation ^{[63, 64]}. Therefore, the IRS-1/Akt pathway is one of the important signaling pathways regulating glucose homeostasis, and its activation is critical for IR in skeletal muscle. EGR-1, functioning as a transcriptional suppressor, can recognize highly conserved consensus sequences rich in GC and directly activate gene transcription ^{[65, 66]}. The reduction of EGR-1 in adipose tissue can augment IRS-1 tyrosine phosphorylation, restoring insulin sensitivity through the PI3K/AKT and ERK/MAPK pathways ^[9]. In addition, PTP1B is widely expressed in the endoplasmic reticulum of insulin-targeted tissues such as liver, muscle, and adipose tissue. ^[67]. PTP1B negatively regulates insulin signaling by dephosphorylating IRS or insulin receptor (INSR) ^[68–70]. PTP1B-deficient mice demonstrate heightened insulin sensitivity, lower blood glucose levels, and resistance to obesity induced by a high-fat diet, emphasizing its pivotal regulatory role ^[71]. Conversely, overexpression of PTP1B in skeletal muscle impairs insulin signal transduction, diminishes glucose uptake, and induces IR ^[72]. Human experiments indicate a negative correlation between skeletal muscle PTP1B gene expression and insulin sensitivity ^[70]. Furthermore, the intricate interplay between EGR-1 and PTP1B has been elucidated, with EGR-1 influencing PTP1B protein expression, impacting glucose homeostasis, and playing a crucial role in insulin sensitivity and postprandial blood glucose regulation ^{[11, 12]}. Importantly, our study provides compelling evidence that aerobic exercise exerts its positive effects by reducing the expression of EGR-1/PTP1B in skeletal muscle, contributing to the restoration of insulin sensitivity.

Although our findings provide valuable insights into the effects of aerobic exercise on glycometabolism and insulin sensitivity in an animal model of a high-fat diet, few limitations should be acknowledged. Initially, the absence of exercise-only group constrains our capacity to demonstrate exercise independent effects on studied biomarkers. Secondly, the six-week duration of exercise regimen may not comprehensively capture the long-term benefits or adaptations associated with prolonged aerobic exercise. Thirdly, the absence of gene knockout models precluded more definitive insights into the molecular mechanisms, particularly the roles of specific genes such as EGR-1 and PTP1B, in mediating the observed effects. Future research should encompass a broader range of experimental conditions, extended intervention periods, and advanced genetic models to further deepen the understanding of exercise and metabolic health.

In conclusion, our research indicates significant benefits in promoting glycogen anabolism and enhancing insulin sensitivity through a 6-week aerobic exercise regimen, modulating the EGR-1/PTP1B pathway in skeletal muscle. Further studies will be conducted to fully confirm the mechanism of early aerobic exercise intervention in the development of insulin resistance and T2DM.

Declaration of competing interest

The authors declare that there are no conflicts of interest.

Funding

This work was financial supported by Science and Technology Bureau of Jinhua City, grant number 2022-3-136, 2022-4-058. This study also supported by the Zhejiang Provincial Natural Science Foundation of China, grant number LY19C110002.

CRediT authorship contribution statement

Wei Li and Ting Li: Conceptualization, Methodology, Project administration and Funding acquisition. Liangzhi Zhang and Xiaojie Liu: Investigation and Visualization. Mallikarjuna Korivi, Jing Hu, and Helong Quan: Software, Formal analysis, Data Curation and Supervision. Liangzhi Zhang and Wei Li: Writing - Original Draft and Methodology. Sang Ki Lee, Lifeng Wang and Ting Li: Validation, Resources and Writing - Review & Editing. All authors read and approved the final paper.

Kubota N, Terauchi Y, Miki H, et al. PPAR gamma mediates high-fat diet-induced adipocyte hypertrophy and insulin resistance[J]. Mol Cell. 1999;4(4):597–609.
Aras M, Tchang BG, Pape J. Obesity and Diabetes[J]. Nurs Clin North Am. 2021;56(4):527–41.
DeFronzo RA, Tripathy D. Skeletal muscle insulin resistance is the primary defect in type 2 diabetes[J]. Diabetes Care. 2009;32(Suppl 2):S157–63.
Yaribeygi H, Farrokhi FR, Butler AE, et al. Insulin resistance: Review of the underlying molecular mechanisms[J]. J Cell Physiol. 2019;234(6):8152–61.
Jensen J, Rustad PI, Kolnes AJ, et al. The role of skeletal muscle glycogen breakdown for regulation of insulin sensitivity by exercise[J]. Front Physiol. 2011;2:112.
Silverman ES, Collins T. Pathways of Egr-1-mediated gene transcription in vascular biology[J]. Am J Pathol. 1999;154(3):665–70.
Chavrier P, Zerial M, Lemaire P, et al. A gene encoding a protein with zinc fingers is activated during G0/G1 transition in cultured cells[J]. EMBO J. 1988;7(1):29–35.
Huang RP, Liu C, Fan Y, et al. Egr-1 negatively regulates human tumor cell growth via the DNA-binding domain[J]. Cancer Res. 1995;55(21):5054–62.
Yu X, Shen N, Zhang ML, et al. Egr-1 decreases adipocyte insulin sensitivity by tilting PI3K/Akt and MAPK signal balance in mice[J]. EMBO J. 2011;30(18):3754–65.
Wu J, Tao W, Bu D, et al. Egr-1 transcriptionally activates protein phosphatase PTP1B to facilitate hyperinsulinemia-induced insulin resistance in the liver in type 2 diabetes[J]. FEBS Lett. 2019;593(21):3054–63.
Wu J, Tao WW, Chong DY, et al. Early growth response-1 negative feedback regulates skeletal muscle postprandial insulin sensitivity via activating Ptp1b transcription[J]. FASEB J. 2018;32(8):4370–9.
Fukada T, Tonks NK. The reciprocal role of Egr-1 and Sp family proteins in regulation of the PTP1B promoter in response to the p210 Bcr-Abl oncoprotein-tyrosine kinase[J]. J Biol Chem. 2001;276(27):25512–9.
Yang W, Nam K, Ju JH, et al. S100A4 negatively regulates beta-catenin by inducing the Egr-1-PTEN-Akt-GSK3beta degradation pathway[J]. Cell Signal. 2014;26(10):2096–106.
De Meyts P. The Insulin Receptor and Its Signal Transduction Network[J]. 2000.
Hanke S, Mann M. The phosphotyrosine interactome of the insulin receptor family and its substrates IRS-1 and IRS-2[J]. Mol Cell Proteom. 2009;8(3):519–34.
Gual P, Le Marchand-Brustel Y, Tanti JF. Positive and negative regulation of insulin signaling through IRS-1 phosphorylation[J]. Biochimie. 2005;87(1):99–109.
Wang Q, Somwar R, Bilan PJ, et al. Protein kinase B/Akt participates in GLUT4 translocation by insulin in L6 myoblasts[J]. Mol Cell Biol. 1999;19(6):4008–18.
Nikoulina SE, Ciaraldi TP, Mudaliar S, et al. Inhibition of glycogen synthase kinase 3 improves insulin action and glucose metabolism in human skeletal muscle[J]. Diabetes. 2002;51(7):2190–8.
Gomez-Barroso M, Vargas-Vargas MA, Pena-Montes DJ et al. Comparative Effect of Three Different Exercise Intensities in Combination with Diazoxide on Contraction Capacity and Oxidative Stress of Skeletal Muscle in Obese Rats[J]. Biology (Basel), 2022,11(9).
Dube JJ, Amati F, Stefanovic-Racic M, et al. Exercise-induced alterations in intramyocellular lipids and insulin resistance: the athlete's paradox revisited[J]. Am J Physiol Endocrinol Metab. 2008;294(5):E882–8.
Bedford TG, Tipton CM, Wilson NC, et al. Maximum oxygen consumption of rats and its changes with various experimental procedures[J]. J Appl Physiol Respir Environ Exerc Physiol. 1979;47(6):1278–83.
Liu X, Jiang X, Hu J, et al. Exercise attenuates high-fat diet-induced PVAT dysfunction through improved inflammatory response and BMP4-regulated adipose tissue browning[J]. Front Nutr. 2024;11:1393343.
Abdul-Ghani MA, Matsuda M, Balas B, et al. Muscle and liver insulin resistance indexes derived from the oral glucose tolerance test[J]. Diabetes Care. 2007;30(1):89–94.
Matthews DR, Hosker JP, Rudenski AS, et al. Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man[J]. Diabetologia. 1985;28(7):412–9.
Young A. The relative isometric strength of type I and type II muscle fibres in the human quadriceps[J]. Clin Physiol. 1984;4(1):23–32.
Sahinis C, Kellis E, Galanis N, et al. Intra- and inter-muscular differences in the cross-sectional area of the quadriceps muscles assessed by extended field-of-view ultrasonography[J]. Med Ultrason. 2020;22(2):152–8.
Roe JH, Dailey RE. Determination of glycogen with the anthrone reagent[J]. Anal Biochem. 1966;15(2):245–50.
Zhang L, Lin H, Yang X, et al. Effects of dapagliflozin monotherapy and combined aerobic exercise on skeletal muscle mitochondrial quality control and insulin resistance in type 2 diabetes mellitus rats[J]. Biomed Pharmacother. 2023;169:115852.
Paul N, Raymond J, Lumbreras S, et al. Activation of the glucocorticoid receptor rapidly triggers calcium-dependent serotonin release in vitro[J]. CNS Neurosci Ther. 2021;27(7):753–64.
Taylor R, Magnusson I, Rothman DL, et al. Direct assessment of liver glycogen storage by 13C nuclear magnetic resonance spectroscopy and regulation of glucose homeostasis after a mixed meal in normal subjects[J]. J Clin Invest. 1996;97(1):126–32.
Taylor R, Price TB, Katz LD, et al. Direct measurement of change in muscle glycogen concentration after a mixed meal in normal subjects[J]. Am J Physiol. 1993;265(2 Pt 1):E224–9.
Kasuga M, Ogawa W, Ohara T. Tissue glycogen content and glucose intolerance[J]. J Clin Invest. 2003;111(9):1282–4.
Magnusson I, Rothman DL, Katz LD, et al. Increased rate of gluconeogenesis in type II diabetes mellitus. A 13C nuclear magnetic resonance study[J]. J Clin Invest. 1992;90(4):1323–7.
Shulman GI, Rothman DL, Jue T, et al. Quantitation of muscle glycogen synthesis in normal subjects and subjects with non-insulin-dependent diabetes by 13C nuclear magnetic resonance spectroscopy[J]. N Engl J Med. 1990;322(4):223–8.
DeFronzo RA, Lilly. lecture 1987. The triumvirate: beta-cell, muscle, liver. A collusion responsible for NIDDM[J]. Diabetes, 1988,37(6):667–687.
Solis-Herrera C, Triplitt C, Cersosimo E et al. Pathogenesis of Type 2 Diabetes Mellitus[J]. 2000.
Zhang P, Li T, Wu X, et al. Oxidative stress and diabetes: antioxidative strategies[J]. Front Med. 2020;14(5):583–600.
Petersen KF, Dufour S, Savage DB, et al. The role of skeletal muscle insulin resistance in the pathogenesis of the metabolic syndrome[J]. Proc Natl Acad Sci U S A. 2007;104(31):12587–94.
Ryan AS, Li G, McMillin S et al. Pathways in Skeletal Muscle: Protein Signaling and Insulin Sensitivity after Exercise Training and Weight Loss Interventions in Middle-Aged and Older Adults[J]. Cells, 2021,10(12).
Pedersen AJ, Hingst JR, Friedrichsen M, et al. Dysregulation of muscle glycogen synthase in recovery from exercise in type 2 diabetes[J]. Diabetologia. 2015;58(7):1569–78.
MacAulay K, Woodgett JR. Targeting glycogen synthase kinase-3 (GSK-3) in the treatment of Type 2 diabetes[J]. Expert Opin Ther Targets. 2008;12(10):1265–74.
McManus EJ, Sakamoto K, Armit LJ, et al. Role that phosphorylation of GSK3 plays in insulin and Wnt signalling defined by knockin analysis[J]. EMBO J. 2005;24(8):1571–83.
Thorburn AW, Gumbiner B, Bulacan F, et al. Multiple defects in muscle glycogen synthase activity contribute to reduced glycogen synthesis in non-insulin dependent diabetes mellitus[J]. J Clin Invest. 1991;87(2):489–95.
Pearce NJ, Arch JR, Clapham JC, et al. Development of glucose intolerance in male transgenic mice overexpressing human glycogen synthase kinase-3beta on a muscle-specific promoter[J]. Metabolism. 2004;53(10):1322–30.
Markuns JF, Wojtaszewski JF, Goodyear LJ. Insulin and exercise decrease glycogen synthase kinase-3 activity by different mechanisms in rat skeletal muscle[J]. J Biol Chem. 1999;274(35):24896–900.
Manabe Y, Gollisch KS, Holton L, et al. Exercise training-induced adaptations associated with increases in skeletal muscle glycogen content[J]. FEBS J. 2013;280(3):916–26.
Aschenbach WG, Ho RC, Sakamoto K, et al. Regulation of dishevelled and beta-catenin in rat skeletal muscle: an alternative exercise-induced GSK-3beta signaling pathway[J]. Am J Physiol Endocrinol Metab. 2006;291(1):E152–8.
Chadt A, Al-Hasani H. Glucose transporters in adipose tissue, liver, and skeletal muscle in metabolic health and disease[J]. Pflugers Arch. 2020;472(9):1273–98.
Tsao TS, Burcelin R, Katz EB, et al. Enhanced insulin action due to targeted GLUT4 overexpression exclusively in muscle[J]. Diabetes. 1996;45(1):28–36.
Cline GW, Petersen KF, Krssak M, et al. Impaired glucose transport as a cause of decreased insulin-stimulated muscle glycogen synthesis in type 2 diabetes[J]. N Engl J Med. 1999;341(4):240–6.
Stenbit AE, Tsao TS, Li J, et al. GLUT4 heterozygous knockout mice develop muscle insulin resistance and diabetes[J]. Nat Med. 1997;3(10):1096–101.
Kim JK, Zisman A, Fillmore JJ, et al. Glucose toxicity and the development of diabetes in mice with muscle-specific inactivation of GLUT4[J]. J Clin Invest. 2001;108(1):153–60.
Goodyear LJ, Kahn BB. Exercise, glucose transport, and insulin sensitivity[J]. Annu Rev Med. 1998;49:235–61.
Richter EA, Hargreaves M, Exercise. GLUT4, and skeletal muscle glucose uptake[J]. Physiol Rev. 2013;93(3):993–1017.
Houmard JA, Shinebarger MH, Dolan PL, et al. Exercise training increases GLUT-4 protein concentration in previously sedentary middle-aged men[J]. Am J Physiol. 1993;264(6 Pt 1):E896–901.
Maarbjerg SJ, Sylow L, Richter EA. Current understanding of increased insulin sensitivity after exercise - emerging candidates[J]. Acta Physiol (Oxf). 2011;202(3):323–35.
Wright DC. Mechanisms of calcium-induced mitochondrial biogenesis and GLUT4 synthesis[J]. Appl Physiol Nutr Metab. 2007;32(5):840–5.
Holmes B, Dohm GL. Regulation of GLUT4 gene expression during exercise[J]. Med Sci Sports Exerc. 2004;36(7):1202–6.
Ferrari F, Bock PM, Motta MT, et al. Biochemical and Molecular Mechanisms of Glucose Uptake Stimulated by Physical Exercise in Insulin Resistance State: Role of Inflammation[J]. Arq Bras Cardiol. 2019;113(6):1139–48.
Ren JM, Semenkovich CF, Gulve EA, et al. Exercise induces rapid increases in GLUT4 expression, glucose transport capacity, and insulin-stimulated glycogen storage in muscle[J]. J Biol Chem. 1994;269(20):14396–401.
Chibalin AV, Yu M, Ryder JW, et al. Exercise-induced changes in expression and activity of proteins involved in insulin signal transduction in skeletal muscle: differential effects on insulin-receptor substrates 1 and 2[J]. Proc Natl Acad Sci U S A. 2000;97(1):38–43.
Kirwan JP, Del AL, Hernandez JM, et al. Regular exercise enhances insulin activation of IRS-1-associated PI3-kinase in human skeletal muscle[J]. J Appl Physiol (1985). 2000;88(2):797–803.
Cong LN, Chen H, Li Y, et al. Physiological role of Akt in insulin-stimulated translocation of GLUT4 in transfected rat adipose cells[J]. Mol Endocrinol. 1997;11(13):1881–90.
Kim YB, Nikoulina SE, Ciaraldi TP, et al. Normal insulin-dependent activation of Akt/protein kinase B, with diminished activation of phosphoinositide 3-kinase, in muscle in type 2 diabetes[J]. J Clin Invest. 1999;104(6):733–41.
Hamilton TB, Borel F, Romaniuk PJ. Comparison of the DNA binding characteristics of the related zinc finger proteins WT1 and EGR1[J]. Biochemistry. 1998;37(7):2051–8.
Svaren J, Sevetson BR, Apel ED, et al. NAB2, a corepressor of NGFI-A (Egr-1) and Krox20, is induced by proliferative and differentiative stimuli[J]. Mol Cell Biol. 1996;16(7):3545–53.
Tonks NK. PTP1B: from the sidelines to the front lines![J]. FEBS Lett. 2003;546(1):140–8.
Moller DE. New drug targets for type 2 diabetes and the metabolic syndrome[J]. Nature. 2001;414(6865):821–7.
Goldstein BJ, Bittner-Kowalczyk A, White MF, et al. Tyrosine dephosphorylation and deactivation of insulin receptor substrate-1 by protein-tyrosine phosphatase 1B. Possible facilitation by the formation of a ternary complex with the Grb2 adaptor protein[J]. J Biol Chem. 2000;275(6):4283–9.
Stull AJ, Wang ZQ, Zhang XH, et al. Skeletal muscle protein tyrosine phosphatase 1B regulates insulin sensitivity in African Americans[J]. Diabetes. 2012;61(6):1415–22.
Elchebly M, Payette P, Michaliszyn E, et al. Increased insulin sensitivity and obesity resistance in mice lacking the protein tyrosine phosphatase-1B gene[J]. Science. 1999;283(5407):1544–8.
Zabolotny JM, Haj FG, Kim YB, et al. Transgenic overexpression of protein-tyrosine phosphatase 1B in muscle causes insulin resistance, but overexpression with leukocyte antigen-related phosphatase does not additively impair insulin action[J]. J Biol Chem. 2004;279(23):24844–51.

No competing interests reported.

Onlinefloatimage1.png
Graphical Abstract
AppendixA.Supplementarymaterial.pdf

Download PDF

Editorial decision: Revision requested
28 Sep, 2024
Reviews received at journal
28 Sep, 2024
Reviews received at journal
26 Sep, 2024
Reviewers agreed at journal
18 Sep, 2024
Reviewers agreed at journal
17 Sep, 2024
Reviewers invited by journal
17 Sep, 2024
Editor assigned by journal
04 Sep, 2024
Submission checks completed at journal
04 Sep, 2024
First submitted to journal
31 Aug, 2024

You are reading this latest preprint version

Aerobic exercise attenuates high-fat diet-induced glycometabolism abnormalities in skeletal muscle of rats via EGR-1/PTP1B signaling pathway

Status:

Version 1

Abstract

Figures

1 Introduction

2 Material and methods

2.1 Experimental animal

2.2 Treadmill running protocol

2.3 Oral glucose tolerance test (OGTT) and insulin sensitivity

2.4 Sample collection and biochemical assays

2.5 PAS staining and measurement of skeletal muscle glycogen content

2.6 Quantitative real-time polymerase chain reaction (qPCR)

2.7 Western Blotting

2.8 Immunofluorescence

2.9 Statistical analysis

3 Results

3.1 Aerobic exercise reduced body weight and fat weight in rats fed a high-fat diet

3.2 Aerobic exercise restored insulin sensitivity in rats fed a high-fat diet

3.3 Aerobic exercise restored glycogen content in skeletal muscle of rats fed a high-fat diet

3.4 Aerobic exercise restored glycogen anabolism in skeletal muscle of rats fed a high-fat diet

4 Discussion

5 Limitations

6 Conclusion

Declarations

Declaration of competing interest

Funding

References

Additional Declarations

Supplementary Files

Status:

Version 1