Phylogenetic and Population Genetic Analysis of Arunachali Yak (Bos grunniens) Using Mitochondrial DNA D-Loop Region

doi:10.21203/rs.3.rs-5008812/v1

Download PDF

Research Article

Phylogenetic and Population Genetic Analysis of Arunachali Yak (Bos grunniens) Using Mitochondrial DNA D-Loop Region

https://doi.org/10.21203/rs.3.rs-5008812/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

The Arunachali yak (Bos grunniens) is an important breed native to the northeastern Himalayas of India. Understanding its genetic diversity and evolutionary relationships with other bovine species is crucial for effective conservation and breeding strategies. This study investigates the mitochondrial DNA (mtDNA) D-loop region of Arunachali yak and compares it with other bovines to elucidate these relationships.

Methods

We collected blood samples from 18 Arunachali yak individuals and isolated genomic DNA. The partial mtDNA D-loop region was amplified using PCR and sequenced. Sequences were compared with those from Bos frontalis, Bos gaurus, Bos indicus, Bubalus bubalis, and Capra hircus available in GenBank. Phylogenetic relationships were assessed through Neighbor-Joining trees and median-joining networks. Genetic diversity indices and neutrality tests were applied to evaluate population genetic characteristics.

Results

Phylogenetic analysis identified three distinct clades, with Arunachali yak clustering closely with Bos indicus, and forming a separate branch from other bovine species. Median-joining networks revealed six haplogroups, with Arunachali yak uniquely representing Hap_3. Genetic diversity analysis showed no polymorphism within Arunachali yak, indicating very low genetic variation in the selected animal samples. AMOVA demonstrated significant genetic differentiation among populations (FST = 0.30053, P < 0.001), with a substantial portion of variation occurring within populations.

Conclusions

The Arunachali yak exhibits a close genetic relationship with Bos indicus, reflecting recent divergence. The study underscores the distinct genetic profile of Arunachali yak and highlights its limited genetic variability. These findings enhance our understanding of bovine evolutionary relationships and emphasize the need for targeted conservation measures to preserve the genetic integrity of Arunachali yak.

Arunachali yak

genetic diversity

mitochondrial DNA (mtDNA) D-loop phylogenetic analysis

conservation measures

The yak (Bos grunniens) is a distinctive bovine species that exhibits unique morphological and physiological adaptations, allowing it to thrive in extreme environments, particularly the high-altitude regions of the Qinghai-Tibetan Plateau (QTP) [1]. The domestication of yaks, which occurred around 7,300 years ago on the QTP, marked the beginning of their spread across the Himalayan region, including areas that now comprise parts of India, Bhutan, Nepal, Afghanistan, Pakistan, and as far north as Mongolia and Siberia [2, 3]. In India, the practice of yak husbandry is closely linked with the pastoralist lifestyle, with yaks being integral to the economy and culture of the communities in regions like Arunachal Pradesh, Ladakh, Sikkim, Himachal Pradesh, and Uttarakhand [4].

Arunachali yak, a breed registered in 2017, is native to the Tawang and West Kameng districts of Arunachal Pradesh [5]. This breed is predominantly managed by the Monpa pastoralists, who rely on yaks for various products, including milk, meat, fiber, manure, and transportation [6]. However, the economic pressures and the decline in traditional yak rearing practices have led to concerns about inbreeding and the cross-hybridization of yaks with cattle to enhance milk production [4, 7]. This trend highlights the urgency of studying and preserving the genetic diversity of the Arunachali yak, which is vital for maintaining its unique adaptations and roles within its native ecosystem.

Morphological data, such as skeletal remains and horn structures, suggest that yaks found outside China likely originated from Chinese yaks, emphasizing their role in maintaining genetic diversity across their range [8]. Variability in genetic makeup is a critical component of biological diversity, influencing the adaptability and survival of species in changing environments [9]. In the context of yaks (Bos grunniens), genetic evidence has uncovered details that archaeological studies alone could not reveal, offering deep insights into their origin and history [10, 11]. Archaeological analyses, when combined with mitochondrial DNA (mtDNA) assessments, suggest that Qinghai province may be the primary site where yak domestication first occurred [12].

Genetic diversity is a key aspect of biological diversity, driven primarily by variations in DNA sequences [13]. In the context of the Arunachali yak, understanding genetic diversity and population structure is essential for developing conservation strategies and ensuring the long-term viability of this breed. Mitochondrial DNA (mtDNA), a maternally inherited, circular DNA molecule, evolves rapidly and is particularly useful for studying genetic diversity due to its high polymorphism and lack of recombination [14, 15]. As such, mtDNA serves as an ideal marker for investigating animal evolution, classification, and population genetics [16]. Genetic analyses, particularly those focusing on mtDNA, offer valuable insights into the phylogenetic relationships, maternal origins, and evolutionary history of domestic yak populations [17, 18]. Due to its rapid evolution and lack of recombination, mtDNA enables researchers to trace lineages and assess genetic variability within and between populations [18].

Previous research on mtDNA has revealed that domestic yaks descended from a common wild ancestor, with two main migration routes: one from the QTP through the Himalayas and the Kunlun Mountains to the Pamir region, and another through the South Gobi and Altai Mountains to Mongolia and Russia [16, 19–20]. However, many mtDNA studies have focused only on the D-loop region, limiting the ability to differentiate important branches [21–22]. Complete mtDNA sequencing is now recommended to obtain a detailed genetic map (Derenko et al., 2018).

In this study, we focus on analyzing genetic diversity and population structure among 18 Arunachali yak by comparing their mitochondrial DNA (mtDNA) D-loop sequences with those from other bovine species (Bos indicus, Bos gaurus, Bos frontalis and Babulus bubalis) and domestic goat (Capra hircus). This comparative approach aims to clarify the population genetic structure of Arunachali yak and their genetic relationships with other bovine populations. By integrating mtDNA D-loop regions and additional genetic markers, we aim to deepen our understanding of the genetic diversity and evolutionary history of Arunachali yak.

2.1. Sample collection

Blood samples were collected randomly from eighteen Arunachali yak at various locations. Approximately 5 ml of blood was aseptically drawn from the jugular vein of each animal using a vacutainer tube with EDTA as an anticoagulant, under sterile conditions. Blood samples were then brought to the laboratory in an icebox and were stored at -80°C until further processing. Genomic DNA was isolated from the frozen whole blood samples by following the manufacturer’s standard protocol using QIAmp DNA Mini Kit (250). In this experiment, primers were designed by using Primer3Plus software (https://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi). Partial mitochondrial D-loop region was amplified using polymerase chain reaction (PCR). The designed primer with forward primer mtYak_1.F- 5’ACCCCCAAAGCTGAAGTTCT3’ and reserve primer mtYak_1.R-5’GCTGGGACCAAACCTATGTG3’ primers was used to amplify more than 850 bp from the mitochondrial D loop region. PCR reaction was carried out by mixing a 50µl reaction volume containing 2.5 µl genomic DNA, 25µl of master mix, 5µl of forward primer, 5 µl of reverse primer and 12.5 µl nuclease free water to make the volume. Amplification was performed in a thermal cycler using a 5 min initial denaturation step at 95°C followed by 35 cycles of 30 sec at 95°C, 30 sec annealing at 60°C, 1.45 min at 72°C and a final extension at 72°C for 7 min. The size of amplified PCR product was checked by 1.5% (w/v) agarose gel electrophoresis containing 0.5 µl/mL ethidium bromide. The amplified products were then sent to Redcliffe Genetics Private Limited, Noida, India for sequencing. DNA sequences were submitted to the National Center for Biotechnology Information (NCBI). The newly sequenced mitochondrial partial D-loop region of the yak in this study has been deposited in GenBank under Accession Numbers PQ109054 to PQ109071.

2.2. Data analysis

2.2.1. Comparative Phylogenetic analysis.

Eighteen different sequences for each species of Bos frontalis, Bos gaurus, Bos indicus, Bubalus bubalis, and Capra hircus deposited in GenBank from India, China, and Malaysia were retrieved from the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov) and compared with the sequences of Arunachali yak used in the present study (Table 1). The sequences of the partial mitochondrial DNA D-loop region used in this study were mostly collected from India and China. Nucleotide sequence analysis was performed with BLAST sequence algorithms and sequences were aligned using ClustalW software [23]. Mega11 software was used to determine the variable and parsimony informative sites [24]. A neighbor-joining (NJ) tree was constructed, and the reliability of the tree topology was assessed by 1000 bootstrap replications. Then, median-joining network [25] was employed to further investigate the possible relationships among the lineages by using in PopART 1.7 software [26] with default parameters.

Table 1

Accession numbers of nucleotide sequence of mitochondrial D loop region of different bovine species from different countries.
Sl. No.	Bovine species	Country	N	Accession Number
1.	Bos frontalis	India	12	HM215207, HM215208, HM215211, HM215215, HM215217, HM215218, HM215236, HM215240, HM215241, HM215242, HM215244, HM215233
1.	Bos frontalis	China	6	HM215209, HM215210, HM215222, HM215209, HM215234, HM215235
2.	Bos gaurus	India	12	MG018948, DQ377060, DQ377061, KR233667, KR233666, KF414734, KF414735, KR233658, KR233670, DQ377056, KR233653
		China	1	HM215246
		Malayasia	5	MK584901, MK584900, MK584896, MK584898, MK584899
3.	Arunachali Yak	India	18	PQ109054-PQ109071
4.	Bos indicus	India	12	GQ890140, GQ890092, GQ890126, GQ890066, JN417003, HQ234720, HQ234721, HQ234742, HQ234743, HQ234728, AB085922, AB085923
4.	Bos indicus	China	6	DQ887762, DQ887765, DQ887768, EF524178, EF524184, EF524176
5.	Babulus bubalis	India	12	EF464323, EF121707, EF126135, EF126131, EF121728, EF121688, EF121675, EF121638, EF121614, EF121600, EF464411, EF464457
5.	Babulus bubalis	China	6	MG491488, EF053551, MF380176, MF380077, EF053547, EF053540
6.	Capra hircus	India	12	KM279318, KM279306, KM279301, MK139101, MN865073, MT747030, MN865082, MK139131, MG923271, MG923212, MG923256, MG923225
6.	Capra hircus	China	6	KY112708, DQ121491, DQ121506, AY860885, DQ121604, AY860934

3.1 Phylogeny

Amplification of the mitochondrial D-loop region using mtYak_1.F and mtYak_1.R primers resulted in a PCR product of approximately 850 base pairs. Nucleotide sequences from eighteen samples of Arunachali yak breed were aligned with sequences of four other bovine species and domestic goat, Capra hircus. All the sequences were obtained from GenBank. The sequences of the Arunachali yak were deposited in GenBank under accession numbers PQ109054-PQ109071. These sequences, along with those retrieved from GenBank, were used to construct a phylogenetic tree (Fig. 1). For congeneric species, up to eighteen sequences per species or all available sequences were included in the analysis. The domestic goat, Capra hircus, was employed as an outgroup.

3.2 Gene/allele genealogy

The genealogic relationships among the mitochondrial D-loop sequences, as estimated by PopArt, detected six common haplogroups: Hap_1, Hap_2, Hap_3, Hap_4, Hap_5, and Hap_6 (Fig. 2). In Arunachali yak, only Hap_3 was identified, making it the sole haplogroup present with 100% frequency. This complete dominance of Hap_3 suggested a uniform genetic background within this population. In contrast, Bos indicus populations were primarily present in Hap_2 (16.7%) and Hap_3 (83.3%). The presence of Hap_3 in both Arunachali yaks and Bos indicus suggested that these populations might share a common genetic ancestry or have been influenced by similar evolutionary processes, despite the differing frequencies of other haplogroups.

Among 18 haplotypes of Bos frontalis, 88.9% predominantly belonged to haplogroup Hap_1, while Hap_2 and Hap_3 each accounted for 5.6%. Haplogroup Hap_6 was notably prevalent in Bubalus bubalis (61.1%) and Capra hircus (100%), indicating a strong genetic link or shared evolutionary history between these populations. However, Bos gaurus populations displayed a diverse haplogroup distribution: Hap_1 (11.1%), Hap_2 (27.8%), Hap_4 (16.7%), and the predominant Hap_5 (44.4%).

3.3 Diversity indices

Population genetic indices were calculated using the nucleotide data of the mitochondrial D-loop from the Arunachali yak and other sequences retrieved from GenBank (Table 2). Haplotype diversity (Hd) for all the 108 sequences was calculated to be 0.7805 ± 0.04 SD. The average number of nucleotide differences, k, was found to be 1.404, and nucleotide diversity (π) was 0.20061 ± 0.0002. Haplotype and nucleotide diversity indices were highest in the Bos gaurus population, followed by the Bubalus bubalis population. In contrast, the haplotype and nucleotide diversity were 0 in the case of the 18 Arunachali yak samples, indicating no polymorphism in the sample and a lack of genetic variation in the population for the studied DNA segment. Neutrality indices were calculated by Tajima’s D and Fu’s Fs test. Bos frontalis had a slightly negative Tajima's D (-0.77699), indicating mild population expansion, and a near-zero Fu's Fs (0.05), suggesting equilibrium. Bos gaurus showed a slightly positive Tajima's D (0.43139) and positive Fu's Fs (1.73), indicating a population bottleneck or balancing selection. Arunachali yak and Capra hircus both had negative Tajima's D values (-0.3396 and − 0.96212, respectively), suggesting population expansion, with Capra hircus having a strongly negative Fu's Fs (-8.643), indicative of significant recent expansion. Bos indicus had negative values for both indices, suggesting recent expansion. Bubalus bubalis showed positive Tajima's D (1.27) and negative Fu's Fs (-0.7), indicating balancing selection or a recent selective sweep. Overall, the combined data showed a highly positive Tajima's D (2.583), indicating a population bottleneck or balancing selection, with a near-neutral Fu's Fs (0.806).

Table 2

Diversity and neutrality indices for *Arunachali* yak and five other bovine populations (*Bos frontalis*, *Bos gaurus*, *Bos indicus*, *Bubalus bubalis* and *Capra hircus*), calculated from nucleotide sequences of the mitochondrial D-loop region.
Organisms	n	S	K	H	Hd	π	D	Fu’s Fs
Bos frontalis	18	3	0.529	3	0.215 ± 0.09	0.075 ± 0.01	-0.776	0.05
Bos gaurus	18	2	1.045	4	0.725 ± 0.1	0.149 ± 0.020	0.431	1.73
Arunachali Yak	18	0	0	1	0	0	-0.33	8.554
Bos indicus	18	1	0.29	2	0.294 ± 0.11	0.042 ± 0.011	-0.35	-1.243
Bubalus bubalis	18	2	0.973	3	0.542 ± 0.12	0.139 ± 0.019	1.27	-0.7
Capra hircus	18	0	0	1	0	0	-0.962	-8.643
Total	108	3	1.404	6	0.7805 ± 0.04	0.2006 ± 0.003	2.583	0.806

n: number of sequences examined; S: Number of segregating (polymorphic/variable) sites; K: Average number of pairwise nucleotide differences; H: Number of haplotypes; Hd: Haplotype diversity; π: nucleotide diversity; D: Tajima's D test statistics

The inter-population nucleotide differences (Kxy) and the average number of nucleotide substitutions per site (Dxy) between the studied populations ranged from 0.16667 and 0.02381, respectively, in the comparison between Arunachali Yak and Bos indicus, to 2.72222 and 0.38889 in the comparison between Bos frontalis and Arunachali Yak (Table 3). Gst values were observed to range from 0.0625 between Arunachali Yak and Bos indicus to 1 between Arunachali Yak and Capra hircus, indicating varying levels of genetic differentiation. Additionally, Da values spanned from 0.0028 (Arunachali Yak and Bos indicus) to 0.35107 (Bos frontalis and Arunachali Yak). Notably, the Arunachali Yak exhibited particularly high genetic differentiation and low gene flow with populations such as Capra hircus, underscoring distinct evolutionary histories and limited genetic exchange with these species. This substantial differentiation highlights the unique genetic characteristics of the Arunachali Yak compared to other populations.

Table 3

Population genetics indices between different populations of *Arunachali* Yak and five other bovine populations (*Bos frontalis*, *Bos gaurus*, *Bos indicus*, *Bubalus bubalis* and *Capra hircus*), calculated from nucleotide sequences of the mitochondrial D-loop region.
POPULATION 1	POPULATION 2	Kxy	Gst	Dxy	Da
Bos frontalis	Bos gaurus	1.2037	0.30612	0.17196	0.05945
Bos frontalis	Arunachali Yak	2.72222	0.79503	0.38889	0.35107
Bos frontalis	Bos indicus	2.57407	0.57493	0.36772	0.3089
Bos frontalis	Bubalus bubalis	1.01235	0.42982	0.14462	0.03724
Bos frontalis	Capra hircus	1.05556	0.80531	0.15079	0.11298
Bos gaurus	Arunachali Yak	2	0.46763	0.28571	0.21102
Bos gaurus	Bos indicus	1.83333	0.30331	0.2619	0.1662
Bos gaurus	Bubalus bubalis	1.18827	0.14307	0.16975	0.0255
Bos gaurus	Capra hircus	1.44444	0.46763	0.20635	0.13165
Arunachali Yak	Bos indicus	0.16667	0.0625	0.02381	0.0028
Arunachali Yak	Bubalus bubalis	2.05556	0.57326	0.29365	0.22409
Arunachali Yak	Capra hircus	2	1	0.28571	0.28571
Bos indicus	Bubalus bubalis	1.88889	0.41014	0.26984	0.17927
Bos indicus	Capra hircus	1.83333	0.74359	0.2619	0.2409
Bubalus bubalis	Capra hircus	0.72222	0.17822	0.10317	0.03361

Kxy: Average proportion of nucleotide differences between populations; Dxy: The average number of nucleotide substitutions per site between populations; Da: The number of net nucleotide substitutions per site between populations; Gst: Genetic differentiation index based on the frequency of haplotypes.

Table 4

**Pairwise genetic distance (Fst in lower diagonal) and gene flow (Nm in upper diagonal) between different populations of Bos** **frontalis**, **Bos gaurus**, **Arunachali** **yak**, **Bos indicus**, **Bubalus bubalis** **and** **Capra hircus** **calculated from nucleotide sequence of mitochondrial D loop region.**
	Bos frontalis	Bos gaurus	Arunachali yak	Bubalus bubalis	Bos indicus	Capra hircus
Bos frontalis		0.94412	1.00406	0.86334	0.29706	0.53362
Bos gaurus	0.34623		6.39232	4.20600	1.13368	1.89783
Arunachali yak	0.33243	0.07254		4.76921	1.00493	2.08511
Bubalus bubalis	0.36675	0.10625	0.09489		0.89590	1.69116
Bos indicus	0.62730	0.30606	0.33224	0.35819		0.64005
Capra hircus	0.48374	0.20852	0.19342	0.22819	0.43858

Pairwise genetic distance (Fst) in the six populations varied from 0.07254, with an Nm value of 6.39232 (between Bos gaurus and Arunachali yak), to 0.62730, with an Nm value of 0.29706 (between Bos frontalis and Bos indicus) (Table 4). The Fst values between Arunachali yak and Bubalus bubalis (0.09489), as well as between Bos gaurus and Arunachali yak (0.07254), indicated low genetic differentiation between these populations, suggesting higher gene flow. When Bos frontalis was compared with other populations, the Fst values ranged from 0.29706 to 0.62730, with Nm values ranging from 0.29706 to 1.00406, indicating that these populations were differentiated with varying levels of gene flow. Bos gaurus, in comparison to other species, showed very low genetic differentiation (Fst 0.07254 to 0.34623) with relatively high gene flow (Nm 1.13368 to 6.39232). Further, all populations except the pairs of Bos frontalis with Bos gaurus, and Arunachali yak with Bos indicus, showed significant pairwise genetic distances.

The AMOVA analysis showed substantial subdivision among the populations (FST = 0.30053, P < 0.001), but a large fraction of variation was found within the populations. The partitioning levels of genetic diversity within and among the populations revealed that 69.95% of the total genetic variance existed within populations, while 30.05% was attributed to differences among populations (Table). This suggests a significant level of genetic differentiation between the populations studied.

Table 5

Hierarchical analysis of molecular variance (AMOVA)
Source of Variation	Degree of freedom (d.f.)	Sum of Squares Variance	Variance Components	Percentage of Variance
Among populations	5	3015.380	29.66810	30.05%
Within populations	102	7043.111	69.05011	69.95%
Total	107	10058.491	98.71821	100%

Mitochondrial DNA (mtDNA) is a powerful tool for phylogenetic studies due to its maternal inheritance and presence in multiple copies within cells [27–28]. Unlike nuclear DNA, mtDNA has a higher nucleotide substitution rate, which allows for a finer resolution of genetic differences and evolutionary relationships [29]. This characteristic makes mtDNA an invaluable resource for investigating genetic relationships and evolutionary history, offering insights that are often not possible with nuclear DNA alone. The mitochondrial D-loop region, a non-coding part of mtDNA, plays a crucial role in studying genetic diversity and phylogenetic relationships due to its high mutation rate and rapid evolution [30–32]. The high mutation rate of mtDNA, particularly in the D-loop region, provides a comprehensive view of genetic diversity and population structure [33–34]. A total of eighteen Arunachali yak samples from Arunachal Pradesh were sequenced in this study. Their genetic diversity was evaluated by comparing their mtDNA sequences with each other and with sequences from other bovine species retrieved from the GenBank database. This comparison facilitated the construction of a comprehensive phylogenetic tree, highlighting the genetic relationships and diversity within and between yak populations and other bovines.

Phylogenetic relationship analyses conducted in this study revealed that the populations of yak and as well as other bovine animals were separable into three distinct branches. Compared to previous findings [34, 21], this experiment identified a new phylogenetic branch that includes all five bovine species along with the outgroup Capra hircus.

The phylogenetic analysis in this study revealed a significant genetic similarity between yaks (Bos grunniens) and Bos indicus, providing new insights into the evolutionary relationships within bovine species. This similarity suggests a relatively recent divergence from a common ancestor when compared to other bovine species included in this study, such as Bos frontalis and Bubalus bubalis. These findings are consistent with previous research [35, 36] that utilized complete mitochondrial DNA and Y chromosomal DNA markers, indicating that yaks and Bos indicus share a closer evolutionary trajectory, likely influenced by geographic proximity and similar environmental adaptations.

Similar to studies by [37] and [38], which employed Capra hircus as an outgroup with mitochondrial DNA and microsatellite markers, the phylogenetic tree observed in this study also showed Capra hircus consistently serving as the outgroup.

The analysis of the complete mitochondrial Cyt b gene and partial D-loop sequences from 143 Pakistani domestic yaks revealed that Bos grunniens (yak) is more closely related to bison than to Bos indicus (zebu cattle) [38]. The nucleotide sequence divergence between yaks and bison was lower compared to that between yaks and Bos indicus, with 7.8% for the Cyt b gene and 15.75% for the D-loop. Additionally, Bos grunniens and Bos mutus (wild yak) was clustered together, indicating a higher genetic similarity between these two species than between yaks and Bos indicus. Although Capra hircus (GU295658) was not directly compared in this analysis, it is known to be more distantly related to bovines, including yaks. The distinct genetic divergence of Capra hircus from the studied bovine species reinforces the robustness of the phylogenetic framework used. This separation highlights the evolutionary distance between caprids and bovines, underscoring the distinct evolutionary pathways of these groups.

The genetic closeness between yaks and Bos indicus raises intriguing questions about potential historical interbreeding events or parallel adaptation strategies to similar ecological niches, as suggested by previous findings [40–42] and in understanding these genetic connections can offer valuable insights into the domestication processes and migratory patterns of these species, contributing to a broader understanding of bovine evolution. Furthermore, the evolutionary tree demonstrated that the three highly differentiated genetic branches all had high support rates. This high support excluded the influence of nuclear genes, verifying the reliability of the phylogenetic branches.

The classification of yaks within the Bovidae family has long been debated. Historically, Linnaeus placed yaks in the genus Bos alongside domestic cattle (Bos taurus) and zebu (Bos indicus). Recent studies, however, have revealed a more complex relationship between yaks and cattle, highlighted by mitochondrial DNA (mtDNA) evidence of past hybridization and gene flow between these species. Such genetic introgression is notably prevalent in specific regions, such as the Qinghai-Tibet Plateau (QTP) and parts of Mongolia and Russia [42]. In the present study, a median-joining network of 108 sequences from various bovine species and one ruminant (Capra hircus) categorized the data into six haplogroups. Notably, Arunachali yaks predominantly clustered with Bos indicus and, to a lesser extent, with Bos frontalis within the same haplogroup (haplogroup 3). This clustering pattern aligned with earlier findings by [43, 34]. Specifically, ten haplotypes in yak populations, all belonging to the T3 haplogroup, were identified by [43], which is also common in European cattle. Similarly, the T3 haplogroup was reported to be predominant in Chinese taurine cattle by [34]. In addition, another study [44] found cattle-specific alleles within yak populations, further indicating significant genetic introgression. Additionally, the analysis of three microsatellite loci (ILSTS013, ILSTS050, SPS115) revealed distinct alleles between yaks and cattle, suggesting a more pronounced cattle introgression in the QTP region. This indicates a notable genetic overlap between the two species.

The present findings may be influenced by potential haplogroup bias due to the limited selection of species and sample sizes in the study. Future research with broader sampling and additional genetic markers may provide a more comprehensive understanding of the genetic relationship between yaks and cattle.

Genetic diversity is an integral part of all biological diversity, serving as the basis for biological evolution, species differentiation, and is crucial for population maintenance, reproduction, and adaptation to habitat changes. High Hd and π values indicated high genetic diversity in Bos gaurus, Bubalus bubalis, and Bos indicus. However, Arunachali yak exhibited zero haplotype and nucleotide diversity, indicating no genetic variation in the studied sample sequences. This was likely due to a recent bottleneck, strong selection pressure, or inbreeding, which potentially limited the adaptability and long-term viability of these populations. Low level of genetic diversity lead to inbreeding and decreased population fitness [45], and this result differed significantly from previous studies by [27, 46–47] where higher degrees of haplotype and nucleotide diversity were observed in some yak breeds.

Despite the wide distributional range, interpopulation comparisons (Kxy, Dxy, Gst, and Da) revealed varying levels of genetic differentiation among the studied populations. Arunachali yak and Bos indicus showed low divergence and shared common genetic variations. However, gene flow (Nm) and Fst values were very high for Arunachali yak compared to other bovine species and domestic goat, Capra hircus, suggesting that Arunachali yak was relatively isolated with minimal gene flow. This observation was also supported by AMOVA analysis, which indicated 30.05% of the variance among the studied populations.

Ethical Statements:

The collection of the samples was with the approval of the Committee for Control and Supervision of Experiments on Animals (CCSEA), New Delhi, India vide office order no. V-11011(13)/13/2022-CPCSEA-DADF.

Consent to participate:

Not applicable as no human participants were involved.

Consent to publish:

All the authors consent to publishing the paper and declare no competing interests.

Funding:

This research was supported by the Indian Council of Agricultural Research (ICAR) and no external funding was received.

Author Contribution

M. P. and P. J. D. conceptualised the work and performed all the experimental analyses. A. D., A. C. and M. P. analyzed the results, performed statistical analyses, designed the study and drafted the manuscript. M.P. and M.S. critically reviewed the manuscript and approved the version to be published.

Acknowledgement

The authors are grateful to Indian Council of Agricultural Research (ICAR) for financially supporting this study. The first author is thankful to Directors, ICAR-NRC on Pig and ICAR-NRC on Yak for providing all the necessary support required for this study.

Data Availability

The newly sequenced mitochondrial partial D-loop region of the yak in this study has been deposited in GenBank under Accession Numbers PQ109054 to PQ109071.

Qiu Q, Zhang G, Ma T, Qian W, Ye Z, Cao C, Hu Q, Kim J, Larkin DM, Auvil L, Capitanu B, Ma J, Lewin HA, Qian X, Lang Y, Zhou R, Wang L et al (2012) The yak genome and adaptation to life at high altitude. Nat Genet 44(8):946–949. https://doi.org/10.1038/ng.2343
Qiu Q, Wang L, Wang K, Yang Y, Ma T, Wang Z, Zhang X, Ni Z, Hou F, Long R, Abbott R, Lenstra J, Liu J (2015) Yak whole-genome resequencing reveals domestication signatures and prehistoric population expansions. Nat Commun 6:10283. https://doi.org/10.1038/ncomms10283
FAO (2003) The Yak- Second Edition. Eds: Weiner G, Jianlin H, & Ruijun L, http://www.fao.org/3/ad347e/ad347e00.htm
Pal RN (1993) Yak husbandry in India. http://www.fao.org/3/ad347e/ad347e0q.htm https://nbagr.icar.gov.in/en/registered-yak/ last accessed on 23-07-2021
Arunachali yak INDIA_YAK_2300_ARUNACHALI_16001 https://nbagr.icar.gov.in/en/registered-yak/
Das PJ (2016) Arunachali Yak: An alpine Treasure on Northeast India. In: Arunachali Yak. P J Das, S Deori and S M Deb. (Eds). Published by ICAR-National Research Centre on Yak, Dirang, Arunachal Pradesh. Pp. 158–199. https://www.researchgate.net/publication/323005223_Arunachali_Yak_An_Alpine_Treasures_of_North_East_India
Sharma H, Sharma R, Ahlawat S, Das PJ, Jayakumar S, Tantia MS (2018) Cattle microsatellite markers successfully established diversity status of Arunachali yak (only registered yak breed of India). Indian J Anim Sci 88(9):1051–1057. https://doi.org/10.56093/ijans.v88i9.83553
Shijan G, Weisheng C (1997) The situation of yak in China. In: Miller DG, Craig SR, Rana GM (eds), Proceedings of a workshop on conservation and management of yak genetic diversity held at ICIMOD, Kathmandu, Nepal, 29–31 October 1996. ICIMOD (International Centre for Integrated Mountain Development), Kathmandu, Nepal. pp. 25–28. https://doi.org/10.53055/ICIMOD.227
Demir E, Moravcikova N, Argun KB, Kasarda R, Aytekin I, Bilginer U, Karsli T (2023) Mitochondrial DNA diversity of D-loop region in three native Turkish cattle breeds. Arch Anim Breed 24(1):31–40. https://doi.org/10.5194/aab-66-31-2023
Olsen SJ (1990) Fossil ancestry of the yak, its cultural significance and domestication in Tibet. P Acad Nat Sci Phila 142:73–100. https://api.semanticscholar.org/CorpusID:128042529
Cai L, Wiener G (1995) The yak. FAO (Food and Agricultural Organization of the United Nations) Regional Office for Asia and the Pacific, Bangkok, Thailand. 237 pp
Ma ZJ, Xia XT, Chen SM, Zhao XC, Zeng LL, Xie YL, Chao SY, Xu JT, Sun YG, Li RZ (2018) Identification and diversity of Y-chromosome haplotypes in Qinghai yak populations. Anim Genet 49(6):618–622. https://doi.org/10.1111/age.12723
Guo SC, Qi DL, Chen GH, Xu SX, Zhao XQ (2008) Genetic diversity and classification of domestic yaks inferred from mitochondrial DNA sequences. Acta Ecol Sin 28(9):4286–4294. https://www.researchgate.net/publication/288967323_Genetic_diversity_and_classification_of_domestic_yaks_ inferred_from_mitochondrial_DNA_sequences
Song QQ, Chai ZX, Xin JW, Zhao SJ, Zhong JC (2015) Genetic diversity and classification of Tibetan yak populations based on the mtDNA COIII gene. Genet Mol Res Gmr 14(1):1763–1770. https://doi.org/10.4238/2015.march.13.3
Zeyland J, Wolko u, Lipiński D, Wożniak A, Nowak A, Szalata M, Bocianowski J, Stomski R (2012) Tracking of wisent–bison–yak mitochondrial evolution. J Appl Genet 3(3):317–322. https://doi.org/10.1007/s13353-012-0090-4
Ma ZJ, Zhong JC, Han JL, Xu JT, Liu ZN, Bai WL (2013) Research progress on molecular genetic diversity of the yak (Bos grunniens). Hereditas 35(2):151–160. https://doi.org/10.3724/sp.j.1005.2013.00151
Guo S, Savolainen P, Su J, Zhang Q, Qi D, Zhou J, Zhong Y, Zhao X, Liu J (2006) Origin of mitochondrial DNA diversity of domestic yaks. BMC Evol Biol 22:6:73. http://doi.org/10.1186/1471-2148-6-73
Ma ZJ, Li GZ, Chen SM, Han JL, Hanif Q (2022) Rich maternal and paternal genetic diversity and divergent lineage composition in wild yak (Bos mutus). Anim Biotechnol 33(6):1382–1386. https://doi.org/10.1080/10495398.2021.1884567
Chen PP, Chai ZX, Zhong JC (2015) Research progress and application of yak mitochondrial gene. Heilongjiang Anim Sci Veterinary Med 19:54–56
Wang X, Pei J, Xiong L, Bao P, Chu M, Ma X, La Y, Liang C, Yan P, Guo X (2024) Genetic diversity, phylogeography, and maternal origin of yak (Bos grunniens). BMC Genomics 25:481. https://doi.org/10.1186/s12864-024-10378-z
Lai SJ, Chen SY, Liu YP, Yao YG (2007) Mitochondrial DNA sequence diversity and origin of Chinese domestic yak. Anim Genet 38(1):77–80. https://doi.org/10.1111/j.1365-2052.2007.01555.x
Tu ZC, Qiu H, Zhang YP (2002) Polymorphism in mitochondrial DNA (mtDNA) of yak (Bos grunniens). Biochemical genetics 5–6(40):187–193. https://doi.org/10.1023/a:1015836209577
Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680. https://doi.org/10.1093/nar/22.22.4673
Tamura K, Stecher G, Kumar S (2021) Mol Biol Evol 38(7):3022–3027. https://doi.org/10.1093/molbev/msab120. MEGA11: Molecular Evolutionary Genetics Analysis Version 11
Bandelt HJ, Forster P, Rohl A (1999) Median-joining networks for inferring intraspecific phylogenies. Mol Biol Evol 16(1):37–48. https://doi.org/10.1093/oxfordjournals.molbev.a026036
Leigh JW, Bryant D (2015) POPART: full-feature software for haplotype network construction. Methods Ecol Evol 6:1110–1116. 10.1111/2041-210X.12410
Chen S, Lin BZ, Baig M, Mitra B, Lopes RJ, Santos ANM, Magee DA, Azevedo M, Tarroso P, Sasazaki S (2010) Zebu Cattle Are an Exclusive Legacy of the South Asia Neolithic. Mol Biol Evol 27(27):1. https://doi.org/10.1093/molbev/msp213
Cai X, Chen H, Lei C (2010) Matrilineal genetic inter-introgression of Bos taurus and Bos indicus in China. Livest Sci 128(1–3):12–19. https://doi.org/10.1016/j.livsci.2009.06.017
Brown WM, Prager EM, Wang A, Wilson AC (1982) Mitochondrial DNA sequences of primates: tempo and mode of evolution. J Mol Evol 18:225–239. https://doi.org/10.1007/bf01734101
Brown WM, George M, Wilson AC (1979) Rapid evolution of animal mitochondrial-DNA. Proc Natl Acad Sci USA 76:1967–1971. https://doi.org/10.1073/pnas.76.4.1967
Anderson TA, Bankier GB, Barrell HM, Bruijn D, Coulson RA, Drouin J (1981) Sequence and organization of the human mitochondrial genome. Nature 290(5806):457–465. https://doi.org/10.1038/290457a0
Mipam TD, Wen YL, Fu CX, Li SR, Zhao HW, Ai Y, Li L, Zhang L, Zou DQ (2012) Maternal Phylogeny of a Newly Found Yak Population in China. Int J Mol Sci 13(9):11455–11470. https://doi.org/10.3390/ijms130911455
Bradley DG, Loftus RT, Cunningham P, Machugh DE (1998) Genetics and domestic cattle origins. Evol Anthropol. 6:79–86. https://doi.org/10.1002/(SICI)1520-6505(1998)6:3%3C79::AID-EVAN2%3E3.0.CO;2-R
Lai SJ, Liu YP, Liu YX, Li XW, Yao YG (2006) Genetic diversity and origin of Chinese cattle revealed by mtDNA D-loop sequence variation Molecular. Phylogenetics Evol 38:146–154. https://doi.org/10.1016/j.ympev.2005.06.013
Kamalakkannan R, Bhavana K, Prabhu VR, Sureshgopi D, Singh HS, Nagarjana M (2020) The complete mitochondrial genome of Indian gaur, Bos gaurus and its phylogenetic implications. Sci Rep. 11936 (2020). https://doi.org/10.1038/s41598-020-68724-6
Nijman IJ et al (2008) Phylogeny of Y chromosomes from bovine species. Cladistics 24:723–726. https://doi.org/10.1111/j.1096-0031.2008.00201.x
Mukherjee A, Mukherjee S, Sahoo NR, Longkumer I, Mech M, Rajakhowa C (2013) Characterization of leptin gene and analysis of genetic polymorphism in mithun. Indian J Anim Sci 83(8):851–853. https://www.researchgate.net/publication/288168643_Characterization_of_leptin_gene_and_analysis_of_genetic_polymorphism_in_mithun
Hussain T, Wajid A, Soail M, Ali A, Abbas K, Marikar FMMT, Musthafa MM, Babar ME (2021) Molecular Phylogeny and Genetic Diversity of Domestic Yaks (Bos grunniens) in Pakistan based on Mitochondrial and Microsatellite Markers. VETERINARSKA STANICA 52(6):2021. https://doi.org/10.46419/vs.52.6.5
Wall DA, Davis SK, Read BM (1992) Phylogenetic relationships in the subfamily Bovinae (Mammalia: Artiodactyla) based on ribosomal DNA. J Mammal 73:262–275. https://doi.org/10.2307/1382056
Kikkawa Y, Takada T, Nomura K, Namikawa T, Yonekawa H, Amano T (2003) Phylogenies using mtDNA and SRY provide evidence for male-mediated introgression in Asian domestic cattle. Anim Genet 34:96–101. https://doi.org/10.1046/j.1365-2052.2003.00956.x
Ritz LR, Glowatzki-Mullis ML, MacHugh DE, Gaillard C (2000) Phylogenetic analysis of the tribe Bovini using microsatellites. Anim Genet 31:178–185. https://doi.org/10.1046/j.1365-2052.2000.00621.x
Qi XB, Jianlin H, Wang G, Rege JE, Hanotte O (2010) Assessment of cattle genetic introgression into domestic yak populations using mitochondrial and microsatellite DNA markers. Anim Genet 3242–252. https://doi.org/10.1111%2Fj.1365-2052.2009.01989.x
Troy CS, MacHugh DE, Bailey JF, Magee DA, Loftus RT, Cunningham P, Chamberlain AT, Sykes BC, Bradley DG (2001) Genetic evidence for Near-Eastern origins of European cattle. Nature 410:1088–1091. https://doi.org/10.1038/35074088
Feng DM, Zhao HJ, Jianlin H (2009) Species specific alleles at three microsatellite loci in yak and cattle. Acta Veterinaria et Zootechnica Sinica, in press. https://hdl.handle.net/10568/3469
Jump A, Marchant R, Penuelas J (2009) Environmental change and the option value of genetic diversity. Trends Plant Sci 14(1):51–58. https://doi.org/10.1016/j.tplants.2008.10.002
Tu ZC, Zhang YP, Qiu H (1998) Mitochondrial DNA Polymorphism and Genetic Diversity in Chinese Yaks. Chin J Genet 25(03):205–212. https://doi.org/10.1023/a:1015836209577
Wang X, Pei J, Bao P et al (2021) Mitogenomic diversity and phylogeny analysis of yak (Bos grunniens). BMC Genomics 22:325. https://doi.org/10.1186/s12864-021-07650-x

The present study unveils the close evolutionary relationship between Bos indicus and Arunachali yak, revealing a distinct lineage for the latter. The observed low genetic diversity among the eighteen samples of Arunachali yak breed, indicative of a potential bottleneck effect, underscores the urgent need for targeted conservation strategies. Implementing measures such as habitat protection, controlled breeding programs, and genetic management could help preserve the unique genetic resources of the Arunachali yak. Future research should also explore broader genomic regions and additional populations to better understand the genetic diversity and evolutionary history of these bovine species.

No competing interests reported.

Download PDF

Editorial decision: Revision requested
18 Oct, 2024
Reviews received at journal
17 Oct, 2024
Reviews received at journal
15 Oct, 2024
Reviewers agreed at journal
14 Oct, 2024
Reviewers agreed at journal
14 Oct, 2024
Reviewers agreed at journal
09 Oct, 2024
Reviewers agreed at journal
09 Sep, 2024
Reviewers invited by journal
05 Sep, 2024
Editor assigned by journal
04 Sep, 2024
Submission checks completed at journal
04 Sep, 2024
First submitted to journal
31 Aug, 2024

You are reading this latest preprint version

Phylogenetic and Population Genetic Analysis of Arunachali Yak (Bos grunniens) Using Mitochondrial DNA D-Loop Region

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

1. Introduction

2. Methods & Materials

2.1. Sample collection

2.2. Data analysis

2.2.1. Comparative Phylogenetic analysis.

3. Results

3.1 Phylogeny

3.2 Gene/allele genealogy

3.3 Diversity indices

4. Discussion

Declarations

Funding:

Author Contribution

Acknowledgement

Data Availability

References

Conclusion

Additional Declarations

Status:

Version 1