HSP27/IL-6 axis promotes OSCC chemoresistance of cisplatin, migration and invasion by orchestrating macrophages via a positive feedback loop

doi:10.21203/rs.3.rs-5014704/v1

Download PDF

Research Article

HSP27/IL-6 axis promotes OSCC chemoresistance of cisplatin, migration and invasion by orchestrating macrophages via a positive feedback loop

https://doi.org/10.21203/rs.3.rs-5014704/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

The mechanisms of interaction and crosstalk between tumor cells and tumor-associated macrophages (TAMs) have provided novel options for intervening in tumor progression. However, the molecular mechanisms of the interaction between the tumor cells and TAMs underlying oral squamous cell carcinoma (OSCC) invasio, migration and chemoresistance remain unclear. This study sought to specifically investigate the role of the tumor-cell-derived paracrine heat shock protein 27 (HSP27) in OSCC invasion, migration and chemoresistance and the potential molecular mechanisms of the interaction between the tumor cells and TAMs. In this study, bioinformatic analysis and IHC results demonstrated that the expression level of HSP27 was higher in the tissues of patients with advanced lymph node metastasis of OSCC than that in early stage non-metastatic patients, and that its expression level was positively correlated with the levels of multidrug resistance-associated proteins and macrophage infiltration. In vivo, Survival of low-expressing HSP27 xenograft model mice was inferior to that of controls. In vitro, TAMs-CM significantly up-regulated the expression level of HSP27 in the two types of OSCC tumor cells including CAL27 and SCC9 cells. The OSCC tumor cell-derived HSP27 regulated TAMs through paracrine mode and reduced the level of apoptosis induced by the chemotherapeutic drug cisplatin in tumor cells, thus promoting chemoresistance in OSCC. HSP27 promoted the secretion of cytokine IL-6 from TAMs, whereas TAMs-derived IL-6 up-regulated the expression of HSP27 and enhanced the chemoresistance, migration and invasion of OSCC in tumor cells through an autocrine mode and activates the β-catenin pathway during this process, additionally up-regulated the stem cell properties of tumor cells through an autocrine manner. Tumor-cell-derived paracrine HSP27 promoted OSCC invasion and migration through enhancing the epithelial–mesenchymal transition (EMT) of tumor cells via binding to toll-like receptor 4 (TLR4) on the surface of the TAMs. HSP27/TLR4 induced polarization of the TAMs to an M2-like phenotype and the secretion of IL-6 in the TAMs. Respectively, TAMs-derived IL-6 enhanced OSCC invasion and migration via autocrine HSP27/TLR4 signaling in tumor cells while IL-6 promoted the EMT of tumor cells via autocrine HSP27. Collectively, tumor-cell-derived paracrine HSP27 promoted OSCC migration, invasion and chemoresistance by orchestrating macrophage M2 polarization and IL-6 secretion from macrophages via a positive feedback loop. TAM-derived IL-6 enhanced these progressions via autocrine HSP27/IL-6 signaling in tumor cells. Targeting HSP27/IL-6 may be an effective treatment strategy for OSCC patients, and it is expected to control OSCC progression and improve its prognosis and recurrence in patients.

oral squamous cell carcinoma

macrophages

chemoresistance

HSP27

TLR4

IL-6

Oral squamous cell carcinoma (OSCC), as the sixth most common malignant tumor, is one of the common malignant subgroups of head and neck squamous carcinoma, accounting for more than 90% of all oral malignancies[1–3]. It is characterized by high recurrence rate in situ, high metastasis rate and poor prognosis because it often occurs in sites with rich blood flow and highly vascularized lymphatic vessels. Studies have shown that the five-year survival rate for patients with metastatic lymph nodes in the neck is about 50%, and the survival rate for those with distant metastases is only 20%[4].

Currently, the preferred treatment for OSCC is usually surgery, with drug therapy and radiation as adjuvant therapies. Chemotherapy resistance is one of the main factors for OSCC treatment failure. Most patients with OSCC tumors initially show a positive response to chemotherapy, but with prolonged dosing cycles and infiltrative tumor growth, the organism gradually acquires chemoresistance[5]. A common chemotherapy regimen in OSCC is cisplatin alone or a combination of cisplatin, 5-fluorouracil (5FU) and docetaxel (TPF). Some existing treatment regimens, such as combination chemotherapy and radiotherapy and combinations of different types of chemotherapeutic agents, have been widely used in patients, however, chemotherapy-resistant patients are usually not sensitive to these improved treatment strategies due to a number of underlying mechanisms of action. In addition, these combination regimens can often significantly increase the side effects of chemotherapy on the patient's systemic health, such as bone marrow suppression and impairment of immune cells in the tumor microenvironment. Therefore, it is an ongoing challenge in the field of OSCC treatment to effectively overcome chemotherapy resistance while minimizing adverse effects.

Immune cells in the TME play an important role in mediating acquired drug resistance and can be made resistant through physiological mediators that regulate cell death[6]. TAMs are the most numerous populations of immune cells in the tumor microenvironment Involved in: invasive metastasis, angiogenesis, lymphatic metastasis, chemoresistance, induction of stemness, remodeling of TME, metabolic reprogramming, immunosuppression. It has been shown that macrophages protect breast cancer cells from paclitaxel, etoposide and adriamycin-induced cell death, while in advanced non-small cell lung cancer, a high Fox3p⁺/CD8⁺ T-cell ratio is associated with poor response to chemotherapy with platinum-based drugs[7–10]. In colorectal cancer, the localization and infiltration levels of immune cells in TME were also associated with the efficacy of chemotherapy. High levels of infiltration of TAMs in the tumor microenvironment have also been reported to be positively associated with poor clinical outcomes in breast, pancreatic, bladder, ovarian, and gastric cancers. These reports suggest that immune cells, particularly macrophages in the TME, may play a key role in regulating the biological phenotype of cancer cells[11–13].

Heat shock protein 27 (HSP27) is one of the small molecule proteins in the heat shock protein family, which is aberrantly expressed in many malignant tumors, such as breast cancer, prostate cancer and lung cancer, and is closely related to tumor cell resistance to apoptosis, radiotherapy resistance and EMT process[14–17]. Breast cancer cells secrete high levels of HSP27 into breast cancer TME, which regulates the differentiation of monocytes to immune-tolerant macrophages, and these macrophages deprive T cells of immune response and thus tumor-killing activity. However, little has been reported on whether tumor cell-derived HSP27 can promote their own chemoresistance by modulating TAMs and whether they can positively regulate this process through interaction.

It was previously reported that tumor-initiating cell-derived IL-33 upregulates its own expression in a positive feedback manner by increasing the TGF-β secretion of FcεRIα⁺ macrophages, thereby promoting the autocrine IL-33-mediated invasion of squamous cell carcinoma[18], which suggests that tumor-cell-derived HSP27 may act in a similar regulation mechanism between tumor cells and TAMs in OSCC. Therefore, this study sought to specifically investigate the role of tumor-cell-derived paracrine HSP27 in OSCC progression and the potential molecular mechanisms of interaction between the tumor cells and TAMs.

2.1 HSP27 positively correlates with cisplatin chemoresistance in oral squamous carcinoma

In order to investigating the site of HSP27 expression in HNSCC tissues, a single-cell dataset (https://www.weizmann.ac.il/sites/3CA/ Puram et al.2017) was used for further analysis. UMAP analysis was performed for dimension reduction, and the cells were overlapped into 9 cell clusters, namely fibroblast, malignant, B cell, myocyte, macrophage, endothelial, T cell, dendritic, and mast (Fig. 1A, B). HSP27 was predominantly expressed in the malignant cluster (Fig. 1C). To verify the abnormal expression of HSP27 in tumor cells and its potential role in OSCC progression in vitro, the mRNA and protein expression levels of HSP27 were compared between OSCC tumor cells and normal squamous epithelial cells. We found that the HSP27 mRNA and protein expression levels were significantly higher in CAL27 cells, without or with TAMs-CM stimulation, compared to those of Hacat cells (Fig. 1D-F). The ELISA results confirmed an elevated HSP27 protein level in the CM of CAL27 cells compared with that of the Hacat cells (Fig. 1G). We further investigated the difference in HSP27 expression between the tumor cells and TAMs. The results showed that the HSP27 mRNA expression level in CAL27 cells was far higher than that in the TAMs, and HSP27 was barely expressed in the TAMs (Fig. 1H). Meanwhile, TAMs-CM significantly upregulated the mRNA expression of HSP27 in CAL27 cells (Fig. 1I) and exhibited an increasing trend (of no statistical significance) in its protein expression (Fig. 1F). These findings proved the higher expression of HSP27 in OSCC tumor cells.

To further determine the role of HSP27 in chemoresistance in OSCC, we performed a UMAP analysis downscaling by overlapping the patients’ data into two clusters for carcinoma in primary and lymph node metastases (Fig. 1J-K). HSP27 was predominantly expressed in the primary cluster (Fig. 1L-M). Consistent with the bioinformatics analyses, immunohistochemistry (IHC) analysis was performed in 20 archived OSCC samples. As shown in the results, HSP27 positively correlates with OSCC progression in different periods (Fig. 1N). As Multidrug resistance (MDR) mediated by ATP binding cassette subfamily B number 1 (ABCB1/P-gp) is a major cause of cancer chemotherapy failure, we next examined P-gp expression levels. IHC results indicate that P-gp level was obvious upregulated with OSCC tumor progression(Fig. 1O). In light of our previous findings, to determine the relevance of macrophages to tumor chemoresistance, we also examined the expression level of CD163, one of the macrophage surface markers. All IHC results showed that HSP27 significantly correlated with the multidrug resistance marker P-gp and the level of macrophage infiltration (Fig. 1N-Q). These findings demonstrated the elevated expression and secretion of HSP27 in tumor cells and its potential regulation of OSCC cisplatin chemoresistance.

2.2 HSP27 promotes tumor cell chemoresistance through mediating macrophages

Furthermore, we investigated mRNA and protein expression levels of HSP27 to verify its significant expression of in vitro. To obtain tumor-conditioned macrophages, THP-1 cells were cultured with tumor-conditioned medium (TCM) of CAL27 and SCC9 cells for 24 hours. Conditioned medium from tumor-conditioned macrophages (TAMs-CM) was collected to incubate OSCC cells. As shown in the results, TAMs-CM significantly up-regulated the mRNA expression of HSP27 and MDR1 in CAL27 and SCC9 cells (Fig. 2A, C, D, F). According to the Western blot analysis, the protein expression levels of HSP27 were significantly higher in CAL27 and SCC9 cells after TAMs-CM stimulation (Fig. 2B, E). Furthermore, ELISA confirmed that CAL27 and SCC9 cells with TAMs-CM stimulation secreted higher levels of HSP27 than that cultured with normal medium, whereas it was rarely detectable in TAMs (Fig. 2A, D).

We next investigated the effects of HSP27 on cisplatin chemoresistant of tumor cells in vivo. To verify the chemoresistance-promoting role of HSP27-mediated crosstalk between macrophages and tumor cells in OSCC, CAL27 and SCC9 cells were transfected with the HSP27-siRNA. We constructed a xenograft tumor model and injected two kinds of tumor cells subcutaneously into immunodeficient mice BALB-C nude to observe their tumor growth, and then removed the tumors after 21 days and measured the tumor size (Fig. 2J). The results in vivo showed that the tumor growth of the hormonal mice after knockdown of HSP27 was significantly lower than that of the control group (Fig. 2K-L). In vitro, macrophages were stimulated with tumor-conditioned medium (TCM) of transfected OSCC cells. CM from macrophages was collected and used to incubate OSCC cells in turn. The RT-qPCR ,Western Blot and Flow cytometry assay showed that CM from macrophages induced by HSP27-siRNA-treated OSCC cells significantly increased the apoptosis capacity of OSCC cells (Fig. 2M, R, S, T). Furthermore, to mimic the TME with HSP27 overexpression, TCM supplemented with rhHSP27 was used to induce macrophages. As is shown in the results (Fig. 2N, Q) showed that CM from rhHSP27-induced macrophages significantly increased the apoptosis capacity of tumor cells. Accordingly, the flow cytometry assay for migration showed consistent results (Fig. 2O, P). These results illustrated the importance of HSP27 as a driver of tumor cell chemoresistance OSCC with the involvement of macrophages.

2.3 HSP27/IL-6 axis mediated cellular interaction of macrophages and OSCC Tumor cells via induced macrophage M2 polarization

Previous studies have shown that in the tumor microenvironment, macrophages can regulate tumor progression through the secretion of cytokines, chemokines, long non-coding RNAs, etc. We hypothesize whether their cytokines can also be regulated by HSP27, thereby affecting chemotherapy resistance. The same method was used to construct tumor cells with reduced HSP27 expression using siRNA. Then, macrophages were stimulated with the conditioned medium after transfection to observe the changes of cytokines in macrophages. ELISA experiment results showed that the knockdown of endogenous HSP27 in tumor cells significantly decreased the secretion of IL-6 by macrophages (Fig. 3A, E). RT-qPCR results also showed a decrease in IL-6 mRNA leve (Fig. 3C, G). To further investigate the impact of extracellular HSP27 on IL-6 secretion by macrophages, recombinant human HSP27 (rhHSP27) was added to the conditioned medium of tumor cells. ELISA results showed that rhHSP27 could promote the secretion of IL-6 by macrophages, and IL-6 mRNA level was up-regulated synchronously (Fig. 3B, F, D, H). These findings suggest that HSP27 derived from OSCC tumor cells can influence the extent to which macrophages secrete IL-6.

We have demonstrated that HSP27 can affect the secretion level of IL-6 in tumor-associated macrophages, so whether macrophages can mediate the level of HSP27 in tumor cells through IL-6 and their tolerance to the chemotherapy drug cisplatin becomes our next focus. First, we observed the effect of exogenous IL-6 on the expression level of HSP27 in tumor cells. Western Blot results showed that exogenous IL-6 up-regulated the HSP27 gene level in two OSCC tumor lines (Fig. 3I, N). Next, we tested RT-qPCR, and the results were consistent with the gene trend (Fig. 3J, Q). We also detected the extracellular secretion level of HSP27, and the ELISA results also showed an up-regulation trend to a certain extent (Fig. 3L, Q). We concluded that exogenous IL-6 can promote the expression level of HSP27 in OSCC tumor cells. Next, we added a specific inhibitor of IL-6 receptor to the supernatant of tumor-associated macrophages to see if tumor-associated macrophage-derived IL-6 could have a similar effect on OSCC tumor cells. RT-qPCR, Western Blot assay and ELISA results showed that the promotion effect of tumor-associated macrophage supernatant on HSP27 was cancelled after the addition of IL-6 receptor-specific inhibitors (Fig. 3I, N, K, P, M, R).

We next sought to investigate whether there is a regulatory role for HSP27 on macrophage polarization. The expression levels of the M1 and M2 macrophage markers were employed to investigate the effect of HSP27 signaling on the polarization of the TAMs. The RT-qPCR results showed that the expression levels of the M1-related genes (iNOS, IL-12, and TNF-α) were significantly increased in the HSP27-siRNA-treated group compared to the NC group (Fig. 3S). The expression levels of the M2-related genes (Arg-1 and IL-10) were dramatically decreased in the HSP27-siRNA-treated group compared to the NC group (Figs. 3T). As shown in Fig. 3U&V, rhHSP27 downregulated the expression of the M1-related genes (iNOS and IL-12) and upregulated the expression of the M2-related genes (Arg-1 and CD163). Furthermore, the TLR4 inhibitor TAK-242 markedly reversed the regulatory effects of rhHSP27 on IL-12 and Arg-1 (Figs. 3C). Notably, unlike the typical M1 antitumor cytokines, IL-6 exhibited similar responses to the M2 protumor cytokines upon intervention with HSP27 siRNA, rhHSP27, or TAK-242 (Fig. 3W). HSP27 siRNA downregulated the IL-6 mRNA level, rhsp27 enhanced its mRNA expression, and TAK-242 significantly inhibited the rhHSP27-induced upregulation of IL-6 mRNA expression. The ELISA results showed that the changes in IL-6 secretion were consistent with the changes in its mRNA expression following intervention with rhHSP27 or TAK-242 (Fig. 3X). These findings suggest that HSP27/TLR4 could induce the polarization of TAMs toward an M2-like phenotype and enhance their IL-6 secretion. Based on the above results, we demonstrated that tumor-associated macrophage-derived IL-6 can enhance the endogenous and exogenous HSP27 secretion levels of tumor cells.

2.4 Macrophages orchestrates chemoresistance of OSCC tumor cells via HSP27/IL-6 axis

Next, we examined whether tumor-associated macrophage-derived IL-6 could affect chemotherapy resistance of OSCC tumor cells. First, we detected the MDR1 gene level by RT-qPCR, and the results showed that exogenous IL-6 could increase the MDR1 gene level of tumor cells, and the MDR1 level of tumor cells was down-regulated after the addition of IL-6 receptor-specific inhibitors (Fig. 4A-D). We then examined the apoptosis level of OSCC tumor cells after the addition of exogenous IL-6, tumor-associated macrophage supernatant, and IL-6 receptor inhibitors. Flow cytometry results showed that exogenous IL-6 can down-regulate the apoptosis rate of tumor cells induced by cisplatin, and the apoptosis rate increased significantly after the addition of IL-6 receptor inhibitor in the supernatant of tumor-associated macrophages. (Fig. 4G, H, J, K). RT-qPCR was used to detect apoptosis-related proteins. The results showed that the gene levels of apoptosis-related proteins were down-regulated with the addition of IL-6, and up-regulated with the addition of IL-6 receptor inhibitors (Fig. 4E, F). Western Blot results showed that the protein levels of apoptosis-related proteins were also consistent with gene levels (Fig. 4I, L), indicating that tumor-associated macrophage-derived IL-6 could indeed regulate the tolerance of the two OSCC tumor cells to the chemotherapy drug cisplatin.

2.5 Paracrine HSP27 promoted OSCC migration, invasion and EMT via TLR4 on TAMs

We next investigated whether the paracrine HSP27 from the tumor cells regulated the OSCC invasion and migration through the TAMs. Gene Set Enrichment Analysis (GSEA) showed that the metastasis signaling pathway was activated in patients with high HSP27 expression in HNSCC (Fig. 5A). Furthermore, HSP27 expression significantly correlated with the metastatic signature and EMT score (Fig. 5B, C). The transwell assay results showed that the rhHSP27-treated group had significantly enhanced cell migration and invasion compared to the control group (Fig. 5D). The wound-healing assay results further confirmed the promoting effect of rhHSP27 on cell migration (Fig. 5E). To validate whether the TLR4 on the TAMs was involved in the paracrine HSP27-mediated OSCC invasion and migration via the TAMs, we performed immunofluorescence staining. The results showed the colocalization of rhHSP27 and TLR4 on the cell membrane of the TAMs after rhHSP27 incubation (Fig. 5I). Furthermore, the TLR4 inhibitor TAK-242 markedly suppressed the promoting effects of rhHSP27 on cell migration and invasion (Fig. 5D, E). These findings demonstrated that the paracrine HSP27 from the tumor cells promoted OSCC invasion and migration by binding to TLR4 on the surfaces of the TAMs.

EMT biomarkers were used to investigate whether the paracrine HSP27 from the tumor cells regulated the EMT of the tumor cells through the TAMs. The RT-qPCR results showed that the mRNA expression levels of N-cadherin and vimentin were significantly increased in the rhHSP27-treated group compared to the control group (Fig. 5J and 5K). The Western blotting results showed the upregulating effect of rhHSP27 on N-cadherin protein expression (Fig. 5L). The TLR4 inhibitor TAK-242 markedly suppressed the upregulating effect of rhHSP27 on the vimentin mRNA and N-cadherin protein levels (Fig. 5J-L). These findings demonstrated that the paracrine HSP27 from the tumor cells promoted the EMT of the tumor cells by binding to TLR4 on the surfaces of the TAMs.

2.6 TAMs-derived IL-6 enhanced OSCC migration, invasion and EMT via autocrine HSP27/TLR4 signaling in tumor cells

The IL-6R antagonist tocilizumab was used to investigate the important role of IL-6/IL-6R signaling in OSCC migration and invasion. The transwell assays results showed that the tocilizumab-treated group displayed significantly impaired cell invasion and migration compared to the control group (Fig. 6A-B), indicating that TAM-derived IL-6 may enhance OSCC migration and invasion by binding to IL-6R on the surfaces of tumor cells. Considering the promoting effect of autocrine HSP27 on the invasion and migration of OSCC cells in our previous study, the mRNA and protein expression levels of HSP27 were observed under IL-6 stimulation. The RT-qPCR and Western blotting results showed that IL-6 significantly upregulated the mRNA and protein expression levels of HSP27 in CAL27 cells (Fig. 6I-K). Furthermore, the TLR4 inhibitor TAK-242 markedly suppressed the IL-6-induced cell migration and invasion (Fig. 6C-D). These findings demonstrate that IL-6/IL-6R enhanced OSCC migration and invasion via autocrine HSP27/TLR4 signaling in the tumor cells.

HSP27 siRNA was employed to investigate the role of autocrine HSP27 in the IL-6-induced EMT of tumor cells. The RT-qPCR results showed that the mRNA expression levels of HSP27 and N-cadherin were significantly decreased in the HSP27-siRNA-treated group compared to the NC group (Figs. 6L and 6N). The mRNA expression level of E-cadherin was dramatically increased in the HSP27-siRNA-treated group compared to the NC group (Fig. 6M). The Western blotting results exhibited decreased expression levels of HSP27 and N-cadherin protein (Fig. 6O-Q). These findings demonstrated that IL-6 promoted the autocrine HSP27-mediated EMT of the tumor cells.

2.7 TAMs derived IL-6 orchestrated stem characteristic and HSP27 secretion of tumor cells via β-catenin signaling

We have established that tumor-associated macrophage-derived IL-6 can promote the upregulation of HSP27 in tumor cells and improve the resistance of tumor cells to cisplatin chemotherapy. Next, we try to explore the cellular pathways that may change in this process and its downstream targets. Therefore, we conducted RNA-seq and c sequencing on tumor cells after stimulation, and the results showed that a series of genes had significant differential expression, and the enrichment pathway results showed that genes related to β-catenin pathway had significant differential expression (Fig. 7A, B). So, we tested it in vitro. RTq-PCR results showed that β-catenin related cell pathway target gene β-catenin, c-myc, cyclind1 was up-regulated after the addition of exogenous IL-6 (Fig. 7D, E), and western blot results showed that the β-catenin protein level was also up-regulated (Fig. 7H, I). Whereas these target gene decreased significantly after the addition of IL-6 receptor inhibitor in the supernatant of tumor-associated macrophages (Fig. 7F, G). Therefore, we suggest that tumor-associated macrophages may influence HSP27 and chemotherapy resistance of tumor cells by mediating the β-catenin cell pathway.

Given that stem cell properties of tumor cells are significantly correlated with chemotherapy resistance, we next examined whether macrophage-derived secreted IL-6 can affect stem cell properties of OSCC tumor cells. We detected the levels of OCT4 and CD44, and Western Blot results showed that CD44 protein level were positively correlated with exogenous IL-6 (Fig. 7H, I). We then took at RT-qPCR and found that levels of these two markers of stem cell properties also increased significantly (Fig. 7J, N, P). However, the CD44 and OCT4 gene and protein levels of the two tumor cells were down-regulated after the addition of IL-6 receptor inhibitor in the tumor-associated macrophage supernatant (Fig. 7K, O, Q). The above experimental results confirmed our conjecture that tumor-associated macrophage-derived IL-6 also affects the stem cell characteristics of OSCC tumor cells during this process, which is closely related to the ability of chemotherapy resistance.

The mechanisms of interaction and crosstalk between tumor cells and TAMs have provided novel options for intervening in tumor progression [19–20]. Here, we demonstrated a higher expression of HSP27 in CAL27 cells compared with Hacat cells and TAMs. TAMs-CM significantly upregulated the HSP27 mRNA expression in CAL27 cells. Tumor-cell-derived paracrine HSP27 promoted OSCC invasion and migration through enhancing the EMT of tumor cells via binding to TLR4 on the surfaces of the TAMs. HSP27/TLR4 induced the polarization of the TAMs towards an M2-like phenotype, as well as the secretion of IL-6 in the TAMs. TAM-derived IL-6 enhanced OSCC invasion and migration via autocrine HSP27/TLR4 signaling in the tumor cells. IL-6 promoted the EMT of tumor cells via autocrine HSP27. Our study identified a novel loop of tumor cells interacting with tumor-associated macrophages in OSCC to mediate drug resistance. On the one hand, tumor-associated macrophages in the tumor microenvironment can alter both the intracellular and extracellular levels of HSP27 in tumor cells to promote their own drug resistance, on the other hand, intracellular and extracellular HSP27 from tumor cells can induce tumor-associated macrophages to secrete the cytokine IL-6, which can inversely modulate the chemoresistance to cisplatin in tumor cells, and at the same time this loop could also further enhance the stem cell properties of tumor cells, thus promoting OSCC tumor progression.

A previous study showed statistically significant differences in HSP27 expression between normal mucosa and well-differentiated OSCC cells, indicating that the expression level of HSP27 is closely associated with OSCC progression [21]. In this study, the higher expression of HSP27 in CAL27 cells compared to that of Hacat cells and TAMs further confirmed the findings of previous studies [14, 15, 33], suggesting that tumor-cell-derived HSP27 may play an important role in OSCC progression. It is noteworthy that TAMs-CM significantly upregulated the mRNA expression of HSP27 in CAL27 cells. Meanwhile, HSP27 was highly expressed in CAL27 cells, but not in TAMs. These results suggest that the highly expressed HSP27 in tumor cells may play an important role in the interaction between tumor cells and TAMs, which may be closely related to the invasion and migration of OSCC [22–23].

Previous studies have proven that tumor-cell-derived proteins may promote tumor invasion and migration by regulating TAMs [24–27]. Considering the importance of EMT in OSCC invasion and migration [28], we investigated the intervention of paracrine HSP27 from tumor cells on the invasion and migration of OSCC and the EMT of tumor cells through TAMs. Our results showed that the paracrine HSP27 from tumor cells promoted OSCC invasion and migration through enhancing the EMT of tumor cells via the TAMs. Despite there were the small changes of EMT proteins in mRNA and protein expression, they can facilitate invasion and migration to some extent. In addition, tumor invasion and migration are not only related to EMT, they may also be influenced by other factors, such as cell morphology and motility.

HSP27 also plays an important role in inducing chemotherapy resistance. In non-small cell lung cancer, specific inhibitors targeting HSP27 reduced resistance due to epidermal growth factor receptor (EGFR) to its inhibitors (TKIs)[29]. Heat shock protein αB-Crystallin with HSP27 protects cisplatin-resistant ovarian cancer cells against apoptosis induced by withaferin A and induces differentiation towards a more metastatic phenotype [30]. HSP27 was shown to be highly expressed in drug-resistant cell lines of oral squamous carcinoma, indicating that HSP27 may play a role in tumor progression and chemotherapy resistance in oral squamous carcinoma. Extracellular and intracellular HSP27 may synergistically enhance chemoresistance in tongue squamous cell carcinoma by enhancing TLR5/NF-κB signaling and interacting with BAX and BIM to inhibit the mitochondrial apoptotic pathway[31].In addition, HSP27 in the tumor microenvironment can interact with other cells in the tumor stroma to influence tumor progression. Extracellular HSP27 can upregulate the level of VEGF secreted in endothelial cells through TLR3, which in turn promotes angiogenesis [32]; extracellular HSP27 also exhibits regulatory effects on monocytes, enhances the secretion of cytokines IL-10 and TNF-α [33], blocks the differentiation of monocytes from normal dendritic cells [34] and promotes the differentiation of monocytes from tumor-associated macrophage differentiation to promote tumor progression [35]. Previous studies by our group demonstrated that OSCC tumor cell-derived HSP27 induces the conversion of TAMs to a pro-tumorigenic phenotype via TLR4 and upregulates the secretion level of IL-6, which in turn promotes the invasive migratory ability of tumor cells.

TLR4, as a main pattern recognition receptor, has been the center of scientific attention due to its contributory role in many inflammatory diseases, including septic shock and asthma. This receptor is expressed on the surfaces of a variety of cells, including macrophages, mast cells, dendritic cells, and neutrophils [36]. It can recognize a series of exogenous and endogenous danger-associated molecular patterns (DAMPs) encompassing a great variety of molecules, including HSP27. Extracellular HSP27 may activate the NF-κB signaling pathway through the TLR4 receptor on the surfaces of macrophages and promote the secretion of GM-CSF, IL-10, and IL-4 [37]. Recently, abundant evidence has shown that TLR4 on the surfaces of TAMs is closely associated with tumorigenesis and tumor progression [38–41]. There is a possibility that tumor-cell-derived HSP27 promotes the invasion and migration of OSCC and the EMT of tumor cells by binding to TLR4 on the surfaces of TAMs. Through immunofluorescence staining, our study revealed that HSP27 and TLR4 were collocated on the surfaces of TAMs. The TLR4 inhibitor TAK‐242 suppressed OSCC invasion and migration through the inhibition of EMT.

tumor-associated macrophages with a pro-tumor phenotype not only influence the proliferation and growth of tumor cells and promote angiogenesis and tissue repair, but also often secrete cytokines and specific proteins to effectively improve tumor tolerance in the presence of chemotherapeutic agents. It has been demonstrated that monocyte-derived IL-1β can generate chemotherapy resistance in pancreatic cancer cells by upregulating cyclooxygenase-2 [42]. The exosome miR-223 derived from M2-type macrophages not only reduced the apoptosis rate of ovarian cancer cells SKOV3 induced by cisplatin/paclitaxel combination, but also showed a significant positive correlation with the recurrence rate and poor prognosis of ovarian cancer patients, and has now become a recurrence and prognostic marker with outstanding potential in this field [43]. Studies have shown that multidrug resistance protein 1 (MDR1) is usually up-regulated in drug-resistant tumor cells, and macrophages in the colorectal cancer microenvironment can induce MDR1 expression through the secretion of IL-6 [44], demonstrating that TAMs-derived IL-6 possesses a complex and multidimensional regulatory mechanism for multidrug resistance (MDR).IL-6 not only regulates multidrug resistance (MDR) through the activation of several pathways, including MDR1 and BCL − 2 through the activation of several pathways and genes including MDR1 and BCL1 to promote the upregulation of their autocrine levels, thereby rendering ovarian cancer cells chemoresistant, but also by inducing the expression of C/EBP and MDR1 to produce MDR effects in breast cancer cells [45].Notably, our results indicated that OSCC tumor cells orchestrates IL-6 expression in tumor conditioned macrophages. The link between tumor cells and TAMs in OSCC chemoresistance has not been revealed before.

The interaction and crosstalk between the tumor cells and TAMs for invasion and migration in OSCC show similar regulatory mechanisms as those in other tumor types. Tumor-cell-derived mediators including RNA and proteins can promote OSCC invasion and migration through inducing the M2 polarization of TAMs. Tumor-cell-derived ANLN-210 mRNA can be transferred to macrophages via exosomes by binding to the RNA-binding protein hnRNPC and induce M2-like macrophage polarization via the PTEN/PI3K/Akt signaling pathway, thus promoting tumor proliferation, migration, and invasion of head and neck squamous cell carcinoma in a positive feedback loop [46]. A new study has shown that the PAI-1 and IL-8 produced by OSCC cancer cells contribute to the differentiation of monocytes to CD206 + TAMs [47]. In the present study, HSP27/TLR4 induced the polarization of TAMs to an M2-like phenotype, suggesting that the HSP27/TLR4-mediated OSCC invasion and migration was due to the tumor-promoting properties of M2-type TAMs.

Tumor-cell-derived mediators may also promote tumor invasion and metastasis through inducing the secretion of IL-6 in TAMs [46, 47]. The expression of hypoxia-induced high-mobility group box 1 (HMGB1) in tumor cells promoted hepatocellular carcinoma (HCC) invasiveness and metastasis via enhancing macrophage-derived IL-6 [10]. The tumor-cell-derived phosphatase of regenerating liver-3 (PRL-3) and small extracellular vesicles (SEVs) upregulated the expression of IL-6 in TAMs by activating the MAPK and TLR4/NF-κB pathways [8, 43]. In turn, IL-6 secreted from the TAMs induced the EMT program to enhance colorectal cancer invasion and metastasis via the IL-6R/STAT3 signaling pathway [8, 48]. However, the role of TAM-derived IL-6 in the interaction between TAMs and OSCC cells, as well as in OSCC invasion and migration and its underlying mechanisms, have not been completely elucidated. It was reported that the M2-type TAM-derived IL-6 promoted the PLOD2-integrinβ1axis-enhanced invasion and metastasis of OSCC [49]. The latest research has shown that the tumor-cell-derived paracrine THBS1 promotes the EMT, invasion, and migration of OSCC cells through inducing the abundant secretion of IL-6 from M1-like TAMs and the subsequent activation of the IL-6/STAT3 signaling pathway in OSCC cells. Our results proved that tumor-cell-derived paracrine HSP27/TLR4 signaling promoted the EMT, invasion, and migration of OSCC cells through enhancing the secretion of IL-6 from M2-type TAMs and the subsequent activation of the IL-6/IL-6R signaling pathway in OSCC cells. It is noteworthy that the abundant secretion of IL-6 in this study derived from M2-type TAMs, rather than M1-type TAMs, which is consistent with previous studies [50, 51, 52].

In the present study, TAM-derived IL-6 was proven to enhance OSCC invasion and migration via IL-6/IL-6R signaling. However, its underlying mechanism is not fully understood. In our previous study, it was found that the autocrine HSP27 derived from OSCC cells could promote its own invasion and migration. It was reported that tumor-initiating-cell-derived IL-33 upregulates its own expression in a positive feedback manner by increasing the TGF-βsecretion of FcεRIα + macrophages, thereby promoting the autocrine IL-33-mediated invasion of squamous cell carcinoma [53]. We hypothesized that TAM-derived IL-6, similarly to TGF-β, may be involved in regulating the expression of HSP27 in OSCC cells. The results showed that IL-6 upregulated HSP27 expression in the CAL27 cells, revealing a potential mechanism by which the TAMs-CM upregulated the HSP27 expression in CAL27 cells. Importantly, IL-6/IL-6R promoted OSCC invasion and migration via autocrine HSP27/TLR4 signaling in tumor cells. Furthermore, IL-6/IL-6R promoted the autocrine HSP27-mediated EMT of OSCC cells. In a word, TAM-derived IL-6 promotes OSCC invasion and migration by increasing the secretion of autocrine HSP27 in tumor cells through a positive feedback loop induced by TAM-derived IL-6 and tumor-cell-derived paracrine HSP27. TAM-derived IL-6 and tumor-cell-derived paracrine HSP27 forms a positive feedback loop that continuously increases the secretion of autocrine HSP27 in tumor cells. Subsequently, tumor-cell-derived autocrine HSP27 promotes OSCC invasion and migration.

CD44 and OCT4, which are common surface markers of tumor stem cell properties, also show a trend of high expression in OSCC tumor cells [54] and are now recognized to play an important role in tumor chemoresistance. It has been shown that head and neck squamous carcinoma cells, as a cell population with stem cell properties, show a trend of high expression of surface proteins (e.g., CD10, CD44, CD133), pluripotency-associated transcription factors (SOX2, OCT4, NANOG), and aldehyde dehydrogenase (ALDH) [55], whereas chemotherapy per se, i.e., chemotherapy, increases the proportion of cells with stem cell properties. Importantly, the intra-tumor heterogeneity of stem cell subpopulations also reflects the plasticity of the tumor cells, which is important for generating chemoresistance. The results of the present experiments complemented the demonstration that TAMs-derived IL-6 significantly up-regulated the expression of stem cell characteristic markers CD44 and OCT4 in two OSCC tumor cells while promoting chemoresistance, suggesting that TAMs have a positive inducing effect on the stem cell characteristics of tumors. The stem cell properties of tumors are considered to be the origin of tumorigenesis, metastasis, drug resistance and recurrence, and these two stem cell property markers may play a potentially important role in regulating chemoresistance in tumors, and we hypothesized that IL-6 may mediate chemoresistance by recognizing the potential ligand of CD44 and activating the corresponding kinases and transcription factors of stemness. Previous studies have demonstrated that the interaction between GPNMB/CD44 proteins can promote the EMT process in OSCC [56], so whether HSP27/IL-6 can also mediate chemoresistance by regulating the development of tumor stem cell properties through cell-cell interactions, and whether we can find other ligands for CD44 in this process, will also broaden the idea and direction of the design and conduct of our subsequent studies. This will also broaden our ideas and directions for the design and conduct of subsequent studies.

In summary, the present study elucidated that in the OSCC tumor microenvironment, both exogenous and endogenous HSP27 from OSCC cells can upregulate the pro-resistance effect of TAMs and promote the expression of the cytokine IL-6 by acting on TAMs, thus mediating its own chemoresistance, and through further studies, it was found that IL-6 derived from TAMs can also be reversed by HSP27 expressed by OSCC cells to promote its chemoresistance. This positive feedback loop elucidates the mechanism by which HSP27/IL-6 promotes chemoresistance in OSCC through tumor-associated macrophages, and provides a possible therapeutic target for the treatment of OSCC.

4.1 Human OSCC samples

The paraffin-embedded OSCC tissues were obtained from the Department of Oral Pathology at the Hospital of Stomatology which is affiliated with China Medical University (Shenyang, China). The specimens were collected between 2020 and 2022 with informed consent from the patients or their guardians, following a protocol approved by the Research Ethics Committee. The histopathological diagnosis of the OSCC specimens was conducted by at least two pathologists using the World Health Organization (WHO) classification. For the semi-quantitative IHC analysis, the IHC score of HSP27, P-gp, CD163 protein equals to the staining intensity (on a scale of 0–3: 0 = negative; 1 = low positive; 2 = positive; 3 = high positive) × the percentage of cells stained. A final H-score ranges from 0 to 300.

4.2 Mice, cell culture and reagents

BALB-C nude mice were purchased from the China Medical University. Mice were used at 6–8 weeks of age. Experiments were conducted using age- and gender-matched groups. Animals were housed under specific pathogen free (SPF) conditions. All in vivo procedures were performed in accordance with protocols approved by the Animal Experiment Administration Committee of the University.

The OSCC cell line CAL27 cells, SCC9 cells, the monocytic leukemia cell line THP-1 cells and mouse peritoneal macrophages RAW264.7 cells were all purchased from the Chinese Type Culture Collection. Cells were confirmed to be mycoplasma free and passaged no more than 18 to 25 times after thawing. They were cultured with high-sugar DMEM (Gibco, Thermo Fisher Scientific) and 1640 (Gibco, Thermo Fisher Scientific) containing 10% FBS, 1% penicillin-streptomycin (BIOFIL), and placed in an incubator containing 5% carbon dioxide at 37°C. In some experiments. related cells were cultured in medium with recombinant human protein HSP27 (rhHSP27) purchased from R&D Systems (1580-HS), recombinant human protein IL-6 (rhIL-6) from peprotech (AF-200-06-20) and IL-6 receptor inhibitor Tocilizumab (anti-IL-6R) from Selleck (A2012).

4.3 Activation of macrophages

To induce monocytes differentiation into macrophages, THP-1 cells were adjusted to 106 cells/mL and plated in the 10 mm cell culture dish (Jet Biofil, Guangzhou, China) containing 10 mL medium with 100 ng/mL phorbol 12-myristate 13-acetate (PMA, Sigma-Aldrich, St Louis, MO, USA) for 24 hours, followed by culture in complete medium for another 24 hours. To obtain tumor-conditioned macrophages in vitro, THP-1-derived macrophages were cultured with 50% TCM for 48 hours. The medium was replaced with fresh complete medium and macrophages-conditioned medium (TAMs-CM) were collected after additional 24 hours.

4.4 Preparation of conditioned medium (CM) and induction of TAMs

Preparation of conditioned medium (CM): Incubate CAL27 and SCC9 cells in 25 cm² and 75 cm² culture flasks. When cells grow to about 70%, collected the tumor supernatant (small culture flask 3 mL, large culture flask 9 mL), if the cells are full, proceed to cell passage and discard for the first day, collected supernatant the next day. The collected supernatant was centrifuged at 500 rpm for 5 minutes, and then filtered with a 0.22 mm filter (BIOFIL) to remove impurities and stored at -20°C. This collected medium was mixed with regular medium (v/v = 5:5) to generate tumor conditioned medium (CM). This CM was used to treat macrophages in vitro.

Induction of TAMs: Cultured THP-1 and Raw264.7 cells in a six-well plate, and after the cells grow adherently, add the pre-prepared conditioned medium to induce at different time according to the experimental purpose. TAMs were generated from CAL27 and SCC9 cells induced by exposure to condition medium from CAL27 and SCC9 cells.

4.5 Cell transfections

For establishing a HSP27-knocked-down OSCC cell lines, we selected transient transfection by siRNA.1×104 CAL27 and SCC9 cells were seeded in a six-well plate and cultured for 24 hours, cells reached to 50% and transfected with negative control or HSP27 siRNA (GenePharma, ShangHai, China) using transfection reagent (Jinchuan Technology Co., Ltd., Changchun, China). After 8 h of transfection, the medium was changed to a medium containing 1% double antibody and 10% FBS. After 24 hours, the same medium was changed again, and the supernatant was collected after culturing for 48 hours, and then centrifuged at 500 rpm for 5 minutes. Using a 0.22 mm filter to remove impurities and store at -20°C. The sequences are follows: HSP27 siRNA(5’-3’): Sense: CAAGU UUCCUCCUCCCUGUTT, Anti-sense: ACAGGGAGGAGGAAACUUGTT; Negative Control༈NC༉: Sense: UUCUCCGAACGUGUCACGUTT; Anti-sense: ACGUGACACGUUCGG AGAATT.

4.6 RNA extraction and quantitative real-time PCR

Total RNA was extracted from cells using TRIzol reagent (Takara, Tokyo, Japan) after washing 3 times with PBS. The concentrations of RNA were determined by using a NanoDrop 2000 (Thermo Fisher Scientific). Then reversely transcribed them to cDNA according to the instructions for the use of TAKARA kits(Takara, Tokyo, Japan). Finally, real time PCR connected with SYBR Green Premix PCR Master Mix༈Takara, Tokyo, Japan༉following the manufacture’s guideline. β-actin (Sangon Biotech, Shanghai, China) was used as an internal control, relative mRNA expression used 2-ΔΔCT method to calculate and analyze. The sequences of all primers according to Table 1 above.

Table 1

Primers used for RT-PCR.
Gene transcript	Accession number	Primer Sequence (5′-3′)
HSP27	NM_001540	For: TACCCGCATAGCCGCCTCTTC
		Rev: GCTGCTGCCGCCTAACCAC
E-CADHERIN	NM_001317185	For: ATGAAGAAGGAGGCGGAGAAGAGG
		Rev: TGCAACGTCGTTACGAGTCACTTC
N-CADHERIN	NM_001308176	For: AAGGTGGATGAAGACGGCATGGTG
		Rev: TGCTGACTCCTTCACTGACTCCTC
VIMENTIN	NM_003380	For: ACCAGCCGCAGCCTCTACG
		Rev: AGCGAGTCCACCGAGTCC
β-ACTIN	NM_001101	For: CCTGGCACCCAGCACAAT
		Rev: GGGCCGGACTCGTCATAC
IL-6	NM_001314054	For: ACTTCCATCCAGTTGCCTTCTTGG
		Rev: TTAAGCCTCCGACTTGTGAAGTGG
Arg-1	NM_000045	For: TGCTCACACTGACATCAACACTCC
		Rev: GGTCTACGTCTCGCAAGCCAATG
CD163	XM_024449278	For: GGTGGCCTCTGTCATCTGCT
		Rev: GCTGGCCACTTGCTATGCAG
IL-12	NM_001303244	For: CCTGTGACACGCCTGAAGAAGATG
		Rev: CTTGTGGAGCAGCAGATGTGAGTG
iNOS	NM_001313922	For: TGCCACGGACGAGACGGATAG
		Rev: CTCTTCAAGCACCTCCAGGAACG
TNF-α	NM_001278601	For: CTCATGCACCACCACCAAGGACTC
		Rev: AGACAGAGGCAACCCGACCACTC
HSP27	NM_013560	For: GCTCACAGTGAAGACCAAGGAAGG
		Rev: GCACCGAGAGATGTAGCCATGTTC
β-actin	NM_007393	For: GTGCTATGTTGCTCTAGACTTCG
		Rev: ATGCCACAGGATTCCATACC

4.7 Western Blotting assays

Cells were lysed on ice by RIPA (Beyotime Biotechnology, Beijing, China) buffer containing PMSF and total protein concentration was measured using a bicinchoninic acid protein assay kit, which are from Beyotime Biotechnology (Shanghai, China). Then 10% SDS-PAGE separates the protein, and transfer the same quality protein to the PVDF membrane (Bio-Rad, California, USA) at 120 V for 1.5 hours, after that, PVDF membrane is blocked with 5% skimmed milk powder (Solarbio, Beijing, China), the primary antibody is incubated overnight at 4℃.Next day, after washing 3 times with TBST (TBS containing Tween-20), the secondary antibody is incubated at room temperature for 2 hours, Finally, incubate with ECL (Bio-rad, California, USA) developer solution for 5 minutes at room temperature, and expose it to Tianneng's automatic chemiluminescence imaging analysis system ((Tanon, Shanghai, China)). Western blotting was performed with primary antibodies for HSP27 (#50353, 1:1000), anti–β-actin (Abcam; ab115777, 1:2000), and secondary antibodies HRP-linked antibody(7074s, 1:2000) were all purchased from Cell Signaling Technology Inc. Images were cropped for presentation. Western blots shown in the accompanying figures are derived from three independent experiments.

4.8 Enzyme-linked immunosorbent assays

OSCC cell supernatant, rhHSP27-containing tumor supernatant and the tumor supernatant after HSP27-siRNA treated was applied to Raw264.7 and THP-1 cells for 12 hours, and then replaced with a regular medium. After 24 hours, the supernatants of each group were collected. With a centrifugation at 3000×g for 15 min at 4°C, the supernatant was added to a 96 well plate and tested according to the IL-6 ELISA kit. The IL- 6 ELISA kit was purchased from CUSABIO (Wu Han, China). The supernatant of Hacat cells, OSCC cells and the supernatant of OSCC cells after intervention of TAMs supernatant were collected and used to detect the expression level of HSP27 according to the instructions of HSP27 ELISA kit (ab113334, Abcam) .

4.9 Immunohistochemistry

The paraffin-embedded OSCC tissues were cut into 4-µm-thick slides. After dewaxing with xylene and hydration in 100% ethanol, the slides were recovered using 3% hydrogen peroxide and blocked with 5% goat serum. Then, the slides were incubated with anti-P-gp primary antibody (1:125; abcam, Minneapolis, MN, USA), anti-HSP27 antibody (1:500; proteintech, China), anti-CD163 antibody (1:500; proteintech, China), and secondary antibody using a DAB substrate kit (Gene Tech Co., Ltd., Shanghai, China).

4.10 Immunofluorescence staining

The pre-prepared cell slides were placed in a six-well plate after being grown to approximately 50%-60% on coverslips, and the CAL27 conditioned medium (in different concentrations, according to the experimental purpose) was added to the well plates and incubated for 30 minutes. After fixation with 4% paraformaldehyde for approximately 10 minutes, the mixture was blocked in 5% BSA at room temperature for 1 hour, added to a properly diluted primary antibody mixture of HSP27 (Thermo Fisher Scientific, USA, #MA5-29333, 1:100) and TLR4 (Abcam, UK, ab22048, 1:100), and shaken slightly to cover the slide. It was incubated overnight in a refrigerator at 4°C. On the second day, we added a mixture of red goat anti-rabbit IgG (H + L) (Thermo Fisher Scientific, USA, #R37117, 1 ml diluted with two drops of antibody) and green goat anti-mouse IgGH&L (Abcam, UK, ab1150113, 1:200) secondary antibodies and incubated the mixture for 1 h in the dark at room temperature. We then used DAPI nuclear staining (Thermo Fisher Scientific, USA, D1306, 1:5000,) and incubated the mixture for 2 min in the dark. Finally, we took pictures with a Leica fluorescent microscope (Leica Microsystems, Wetzlar, Germany).

4.11 Wound-healing assays

The CAL27 cells were plated in the wound-healing plug-in (Corning, USA) for 24 hours, and the plug-in was taken out after the cells had adhered. Then, CAL27 cells were stimulated with CM from TAMs preincubated with rhHSP27 (2 µg/ml) or rhHSP27 (2 µg/ml) and TAK-242 (1 µM), for 24 hours, and the plug-in was taken out after the cells had adhered. The CAL27 cells were treated with TAMs supernatants corresponding to different experimental purposes. Finally, pictures were taken at the specified time points, including 0 hours and 24 hours under a microscope.

4.12 Transwell assays

The transwell assay was conducted using transwell inserts (8 µm pore size, Corning, USA) in 24-well dishes. Migration experiment: The upper and lower chambers were temporarily separated and RAW264.7 cells were seeded into the lower chambers 24 hours in advance, with each chamber containing 600 µl of medium with 3×10⁴ cells. The CAL27 cells were resuspended in DMEM containing 5% FBS, and were then spread on the upper chambers, which included 200 µl of medium and 2×10⁴ cells. After the cells had adhered to the wall and the 12-hour induction of the RAW264.7 cells with the CAL27 CM was completed as previously described, the medium was replaced with regular medium with 10% FBS and the upper and lower chambers were placed together. After 24 hours, the upper chambers were fixed in 4% paraformaldehyde, stained with crystal violet, and photographed in five random fields under a microscope.

Invasion experiment: We spread Matrigel (R&D Systems) in the upper chambers 24 hours in advance, diluting with serum-free medium and Matrigel at a ratio of 9:1 to 50 µl in each chamber. The rest of the steps were the same as those in the migration experiment.

4.13 RNA sequencing

Total RNA extracted from the macrophages was preserved in TRIzol (TAKARA) andprocessed according to a standard protocol (BGI Technology; China). The cDNA libraries were generated using TruSeq RNA Sample Preparation (Illumina). Following library preparation, each library was sequenced using an Illumina HiSeq 4000 platform.

4.14 scRNA-seq data analysis

Using Seurat R package and pipeline, after defining the numbers of principal components (nPCs = 10), uniform manifold approximation and projection (UMAP) method was used for non-linear dimension reduction and according to cell annotation 9 cell clusters were identified (Fibroblast, Malignant, B cell, Myocyte, Macrophage, Endothelial, T cell, Dendritic, Mast). The data is obtained from the Curated Cancer Cell Atlas (https://www.weizmann.ac.il/sites/3CA/ Puram et al. 2017).

4.15 Flow cytometry

For the TUNEL assay, an In Situ Cell Death Kit (Roche) was used according to the manufacturer's recommendations. For Annexin V and PI staining, cells were stained with 50 µg/ml PI and Annexin V (BD Bioscience) in Annexin V buffer. The cells were analyzed by Fortessa flow cytometer (BD Biosciences). Data analysis was conducted using the FlowJo software.

4.16 Statistical Analysis

Statistical analyses were performed using SPSS (version 26.0, Armonk, NY, USA) and GraphPad Prism (version 9.0, San Diego, CA, USA). The results are recorded as the mean value ± SD. Data analysis were interpreted by the t-test between two groups, between multiple groups. To compare multiple groups, one-way ANOVA analysis with a Tukey’s post test was utilized. Image J to analyze the results of cell scratches and the chi-square test was used to analyze associations between HSP27, P-gp, CD163 expression and the characteristics of OSCC patients. Significance was set at p < 0.05. One asterisk (*) means p < 0.05, two asterisks (**) means p < 0.01, and three asterisks (***) means p < 0.001.

Acknowledgement

The authors would like to acknowledge the provided experimental support from the Central Laboratory and Department of Oral Pathology in School of Stomatology Affiliated to China Medical University.

Funding

This research was funded by Natural Science Foundation of Jilin Province (YDZJ202401228ZYTS).

CRediT authorship contribution statement

Ying Qi: Conceptualization, Data curation, Formal analysis, Methodology, Writing-original draft. Juan Cao: Conceptualization, Data curation, Methodology. Mingjing Jiang: Data curation, Methodology. Ying Lin: Formal analysis, Data curation. Weibo Li & Yafei Li: Formal analysis. Bo Li: Conceptualization, Funding acquisition, Writing-review & editing.

Ethical statement

All experiments were performed under the approval of the Ethics Committee at the China Medical University (No. K2022039).

Declaration of competing interest

The authors declare no competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Data availability

The authors do not have permission to share data.

Sung H, Ferlay J, Siegel RL, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin, 2021, 71(3):209–249.
Clemens E, Brooks B, de Vries ACH, et al. A comparison of the Muenster, SIOP Boston, Brock, Chang andCTCAEv4.03 ototoxicity grading scales applied to 3,799 audiograms of childhood cancer patients treated with platinum-based chemotherapy. PLoS One, 2019, 14(2):e0210646.
Adamska A, Elaskalani O, Emmanouilidi A, et al. Molecular and cellular mechanisms of chemoresistance in pancreatic cancer. Adv Biol Regul, 2018, 68:77–87.
Law ZJ, Khoo XH, Lim PT, et al. Extracellular Vesicle-Mediated Chemoresistance in Oral Squamous Cell Carcinoma. Front Mol Biosci, 2021, 8:629888.
Kawasaki K, Kasamatsu A, Ando T, et al. Ginkgolide B Regulates CDDP Chemoresistance in Oral Cancer via the Platelet-Activating Factor Receptor Pathway. Cancers (Basel), 2021, 13(24):6299.
Zi M, Xingyu C, Yang C, et al. Improved antitumor immunity of chemotherapy in OSCC treatment by Gasdermin-E mediated pyroptosis. Apoptosis, 2023, 28(3–4):348–361.
Elmusrati A, Wang J, Wang CY. Tumor microenvironment and immune evasion in head and neck squamous cell carcinoma. Int J Oral Sci, 2021, 13(1):24.
Wu K, Lin K, Li X, et al. Redefining Tumor-Associated Macrophage Subpopulations and Functions in the Tumor Microenvironment. Front Immunol, 2020, 11:1731.
Vitale I, Manic G, Coussens LM, et al. Macrophages and Metabolism in the Tumor Microenvironment. Cell Metab, 2019, 30(1):36–50.
Kloosterman DJ, Akkari L. Macrophages at the interface of the co-evolving cancer ecosystem. Cell, 2023, 186(8):1627–51.
Pittet MJ, Michielin O, Migliorini D. Clinical relevance of tumor-associated macrophages. Nat Rev Clin Oncol, 2022, 19(6):402–21.
Chaudhari N, Prakash N, Pradeep GL, et al. Evaluation of density of tumor-associated macrophages using CD163 in histological grades of oral squamous cell carcinoma, an immunohistochemical study. J Oral Maxillofac Pathol, 2020, 24(3):577.
Kumar AT, Knops A, Swendseid B, et al. Prognostic Significance of Tumor-Associated Macrophage Content in Head and Neck Squamous Cell Carcinoma: A Meta-Analysis. Front Oncol, 2019, 9(656).
Alderton GK. Microenvironment: Protective surroundings. Nat Rev Cancer, 2011, 12(1):2.
Geršak K, Geršak BM, Gazić B, et al. The Possible Role of Anti- and Protumor-Infiltrating Lymphocytes inPathologic Complete Response in Early Breast Cancer Patients Treated with Neoadjuvant Systemic Therapy. Cancers (Basel), 2023, 15(19):4794.
Ding, Z.C. and G. Zhou. Cytotoxic chemotherapy and CD4 + effector T cells: an emerging alliance for durable antitumor effects. Clin Dev Immunol, 2012, 2012: p. 890178.
Gawiński C, Michalski W, Mróz A, et al. Correlation between Lymphocyte-to-Monocyte Ratio (LMR), Neutrophil-to-Lymphocyte Ratio (NLR), Platelet-to-Lymphocyte Ratio (PLR) and Tumor-Infiltrating Lymphocytes (TILs) in Left-Sided Colorectal Cancer Patients. Biology (Basel), 2022, 11(3):385.
Wang Y, Johnson KCC, Gatti-Mays ME, et al. Emerging strategies in targeting tumor-resident myeloid cells for cancer immunotherapy. J Hematol Oncol, 2022, 15(1):118.
Lee JC, Sim DY, Lee HJ, et al. MicroRNA216b mediated downregulation of HSP27/STAT3/AKT signaling is critically involved in lambertianic acid induced apoptosis in human cervical cancers. Phytother Res, 2021, 35(2):898–907.
Yao Y, Cui L, Ye J, et al. Dioscin facilitates ROS-induced apoptosis via the p38-MAPK/HSP27-mediated pathways in lung squamous cell carcinoma. Int J Biol Sci, 2020, 16(15):2883–94.
Rizvi SF, Hasan A, Parveen S,et al. Untangling the complexity of heat shock protein 27 in cancer and metastasis. Arch Biochem Biophys, 2023, 736:109537.
Fezza M, Hilal G, Tahtouh R, et al. HSP27 modulates tumoral immune evasion by enhancing STAT3-mediated upregulation of PD-L1 and NLRC5 in ovarian cancer. Ecancermedicalscience, 2023, 17:1526.
Paladino L, Santonocito R, Graceffa G, et al. Immunomorphological Patterns of Chaperone System Components in Rare Thyroid Tumors with Promise as Biomarkers for Differential Diagnosis and Providing Clues on Molecular Mechanisms of Carcinogenesis. Cancers (Basel), 2023, 15(8):2403.
Choi SK, Kim M, Lee H, et al. Activation of the HSP27-AKT axis contributes to gefitinib resistance in non-small cell lung cancer cells independent of EGFR mutations. Cell Oncol (Dordr), 2022, 45(5):913–930.
Carmichael MM, Alchaar I, Davis KA, et al. The small heat shock protein αB-Crystallin protects versus withaferin A-induced apoptosis and confers a more metastatic phenotype in cisplatin-resistant ovarian cancer cells. PLoS One, 2023, 18(1):e0281009.
Liang Y, Wang Y, Zhang Y, et al. HSPB1 facilitates chemoresistance through inhibiting ferroptotic cancer cell death and regulating NF-κB signaling pathway in breast cancer. Cell Death Dis, 2023, 14(7):434.
Guo E, Mao X, Wang X, et al. Alternatively spliced ANLN isoforms synergistically contribute to the progression of head and neck squamous cell carcinoma. Cell Death Dis, 2021, 12(8):764.
Kai K, Moriyama M, Haque A, et al. Oral Squamous Cell Carcinoma Contributes to Differentiation of Monocyte-Derived Tumor-Associated Macrophages via PAI-1 and IL-8 Production. Int J Mol Sci, 2021, 22(17).
Feng S, Lou K, Zou X, et al. The Potential Role of Exosomal Proteins in Prostate Cancer. Front Oncol, 2022, 12:873296.
Obianwuna UE, Agbai Kalu N, Wang J, et al. Recent Trends on Mitigative Effect of Probiotics on Oxidative-Stress-Induced Gut Dysfunction in Broilers under Necrotic Enteritis Challenge: A Review. Antioxidants (Basel), 2023, 12(4):911.
Fouani M, Basset CA, Mangano GD, et al. Heat Shock Proteins Alterations in Rheumatoid Arthritis. Int J Mol Sci, 2022, 23(5):2806.
Alberti G, Vergilio G, Paladino L, et al. The Chaperone System in Breast Cancer: Roles and Therapeutic Prospects of the Molecular Chaperones Hsp27, Hsp60, Hsp70, and Hsp90. Int J Mol Sci, 2022, 23(14):7792.
Mezzasoma L, Bellezza I, Romani R, et al. Extracellular Vesicles and the Inflammasome: An Intricate Network Sustaining Chemoresistance. Front Oncol, 2022, 12:888135.
Taniguchi S, Elhance A, Van Duzer A, et al.Tumor-initiating cells establish an IL-33-TGF-β niche signaling loop to promote cancer progression. Science, 2020, 369(6501).
Yin Y, Yao S, Hu Y, et al. The Immune-microenvironment Confers Chemoresistance of Colorectal Cancer through Macrophage-Derived IL6. Clin Cancer Res, 2017, 23(23):7375–7387.
Foley SE, Dente MJ, Lei X, et al. Microbial Metabolites Orchestrate a Distinct Multi-Tiered Regulatory Network in the Intestinal Epithelium That Directs P-Glycoprotein Expression. mBio, 2022, 13(4):e0199322.
Danella EB, Costa de Medeiros M, D'Silva NJ. Cytokines secreted by inflamed oral mucosa: implications fororal cancer progression. Oncogene, 2023, 42(15):1159–1165.
Zhang KW, Wang D, Cai H, et al. IL–6 plays a crucial role in epithelial–mesenchymal transition and pro-metastasis induced by sorafenib in liver cancer. Oncol Rep, 2021, 45(3):1105–1117.
Wang ZT, Peng Y, Lou DD, et al. Effect of Shengmai Yin on Epithelial-Mesenchymal Transition of Nasopharyngeal Carcinoma Radioresistant Cells. Chin J Integr Med, 2023, 29(8):691–698.
Fan X, Meng M, Li B, et al. Brevilin A is a potent anti-metastatic CRC agent that targets the VEGF-IL6-STAT3 axis in the HSCs-CRC interplay. J Transl Med, 2023, 21(1):260.
Bayanbold K, Singhania M, Fath MA, et al. Depletion of Labile Iron Induces Replication Stress and Enhances Responses to Chemoradiation in Non-Small-Cell Lung Cancer. Antioxidants (Basel), 2023, 12(11):2005.
Singhania M, Zaher A, Pulliam CF, et al. Quantitative MRI Evaluation of Ferritin Overexpression in Non-Small-Cell Lung Cancer. Int J Mol Sci, 2024, 25(4):2398.
Huang WJ, Guo SB, Shi H, et al. The β-catenin-LINC00183-miR-371b-5p-Smad2/LEF1 axis promotes adult T-cell lymphoblastic lymphoma progression and chemoresistance. J Exp Clin Cancer Res, 2023, 42(1):105.
Wang W, Rana PS, Markovic V, et al. The WAVE3/β-catenin oncogenic signaling regulates chemoresistance in triple negative breast cancer. Breast Cancer Res, 2023, 25(1):31.
Wang J, Sheng N, Li Y, et al. Ly6D facilitates chemoresistance in laryngeal squamous cell carcinoma through miR-509/β-catenin signaling pathway. Am J Cancer Res, 2023, 13(5):2155–2171.
Zeng Y, Jiang H, Zhang X, et al. Canagliflozin reduces chemoresistance in hepatocellular carcinoma through PKM2-c-Myc complex-mediated glutamine starvation. Free Radic Biol Med, 2023, 208:571–586.
Li X, Bu W, Meng L, et al. CXCL12/CXCR4 pathway orchestrates CSC-like properties by CAF recruited tumor associated macrophage in OSCC. Exp Cell Res, 2019, 378(2): 131–8.
Dorna D, Paluszczak J. Targeting cancer stem cells as a strategy for reducing chemotherapy resistance in head and neck cancers. J Cancer Res Clin Oncol, 2023, 149(14):13417–13435.
Lin Y, Qi Y, Jiang M, et al. Lactic acid-induced M2-like macrophages facilitate tumor cell migration and invasion via the GPNMB/CD44 axis in oral squamous cell carcinoma. Int Immunopharmacol, 2023, 124(Pt B):110972.
Guo E, Mao X, Wang X, Guo L, An C, Zhang C, et al. Alternatively spliced ANLN isoforms synergistically contribute to the progression of head and neck squamous cell carcinoma. Cell Death Dis. 2021; 12(8):764.
Kai K, Moriyama M, Haque A, Hattori T, Chinju A, Hu C, et al. Oral Squamous Cell Carcinoma Contributes to Differentiation of Monocyte-Derived Tumor-Associated Macrophages via PAI-1 and IL-8 Production. Int J Mol Sci. 2021; 22(17).
Jiang M, Li B. STAT3 and Its Targeting Inhibitors in Oral Squamous Cell Carcinoma. Cells. 2022; 11(19).
He Z, Wang J, Zhu C, Xu J, Chen P, Jiang X, et al. Exosome-derived FGD5-AS1 promotes tumor-associated macrophage M2 polarization-mediated pancreatic cancer cell proliferation and metastasis. Cancer Lett. 2022; 548:215751.
Zhong Q, Fang Y, Lai Q, Wang S, He C, Li A, et al. CPEB3 inhibits epithelial-mesenchymal transition by disrupting the crosstalk between colorectal cancer cells and tumor-associated macrophages via IL-6R/STAT3 signaling. J Exp Clin Cancer Res. 2020; 39(1):132.
Saito K, Mitsui A, Sumardika IW, Yokoyama Y, Sakaguchi M, Kondo E. PLOD2-driven IL-6/STAT3 signaling promotes the invasion and metastasis of oral squamous cell carcinoma via activation of integrin β1. Int J Oncol. 2021; 58(6).
You Y, Tian Z, Du Z, Wu K, Xu G, Dai M, et al. M1-like tumor-associated macrophages cascade a mesenchymal/stem-like phenotype of oral squamous cell carcinoma via the IL6/Stat3/THBS1 feedback loop. J Exp Clin Cancer Res. 2022; 41(1):10.

No competing interests reported.

graphicalabstract.jpg

Download PDF

Reviews received at journal
22 Nov, 2024
Reviews received at journal
22 Nov, 2024
Reviewers agreed at journal
22 Nov, 2024
Reviewers agreed at journal
21 Nov, 2024
Reviewers agreed at journal
20 Nov, 2024
Reviewers agreed at journal
20 Nov, 2024
Reviewers agreed at journal
20 Nov, 2024
Reviewers agreed at journal
20 Nov, 2024
Reviewers invited by journal
30 Oct, 2024
Editor assigned by journal
03 Sep, 2024
Submission checks completed at journal
03 Sep, 2024
First submitted to journal
01 Sep, 2024

You are reading this latest preprint version

HSP27/IL-6 axis promotes OSCC chemoresistance of cisplatin, migration and invasion by orchestrating macrophages via a positive feedback loop

Status:

Version 1

Abstract

Figures

1 INTRODUCTION

2 RESULUTS

2.1 HSP27 positively correlates with cisplatin chemoresistance in oral squamous carcinoma

2.2 HSP27 promotes tumor cell chemoresistance through mediating macrophages

2.4 Macrophages orchestrates chemoresistance of OSCC tumor cells via HSP27/IL-6 axis

2.5 Paracrine HSP27 promoted OSCC migration, invasion and EMT via TLR4 on TAMs

2.6 TAMs-derived IL-6 enhanced OSCC migration, invasion and EMT via autocrine HSP27/TLR4 signaling in tumor cells

2.7 TAMs derived IL-6 orchestrated stem characteristic and HSP27 secretion of tumor cells via β-catenin signaling

3 DISCUSSION

4 MATERIALS AND METHODS

4.1 Human OSCC samples

4.2 Mice, cell culture and reagents

4.3 Activation of macrophages

4.4 Preparation of conditioned medium (CM) and induction of TAMs

4.5 Cell transfections

4.6 RNA extraction and quantitative real-time PCR

4.7 Western Blotting assays

4.8 Enzyme-linked immunosorbent assays

4.9 Immunohistochemistry

4.10 Immunofluorescence staining

4.11 Wound-healing assays

4.12 Transwell assays

4.13 RNA sequencing

4.14 scRNA-seq data analysis

4.15 Flow cytometry

4.16 Statistical Analysis

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1