Paeonol Affects Quorum Sensing System and Exopolysaccharides That Biofilm-Eradicating of Porcine Escherichia coli

doi:10.21203/rs.3.rs-5016796/v1

Download PDF

Research Article

Paeonol Affects Quorum Sensing System and Exopolysaccharides That Biofilm-Eradicating of Porcine Escherichia coli

https://doi.org/10.21203/rs.3.rs-5016796/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background Escherichia coli (E.coli) is one of the bacteria that readily forms biofilms, posing a serious threat to food safety. Natural bioactive compounds represent an effective means to eradicate biofilm resistance, offering a novel therapeutic approach for reversing bacterial biofilm resistance. The present study aimed to clarify that paeonol could eradicate biofilm of porcine E.coli (NO. Ec032), and to explore the mechanism of paeonol eradicating Ec032 biofilm.

Results The results indicated that the concentration of paeonol at 2,048 µg/mL and the intervention time at 3 hours significantly reduced the number of viable bacteria in the mature biofilm of Ec032, achieving the highest biofilm eradication rate. The total fuorescence intensity of bioflm bacteria was signifcantly decreased by 83.56%. RT-qPCR was suggested that paeonol might influence the expression of quorum sensing (QS) system and flagellum movement-related genes in biofilm bacteria, thereby reducing biofilm maturity. The Data Independent Acquisition (DIA) proteomic technique was found that paeonol could significantly decrease flagellar motility and extracellular polysaccharide content in exopoly saccharides (EPS) components, and loosen the structure of the mature biofilm. Simultaneously, paeonol could also act as a QS inhibitor (QSI) to inhibit the production of Chromobacterium violaceum 026 (CV026) violacein. In addition, molecular docking revealed that the outer membrane proteins regulator (OmpR) may be a key target of paeonol.

Conclusions In summary, the research demonstrated that paeonol could act as a QSI, reducing the volume of biofilm by affecting the expression of QS and EPS matrix-related genes and proteins, thereby biofilm-eradicating of Ec032. Furthermore, this research provided a scientific basis for the development of paeonol as a novel biofilm scavenger and presented a reference for the prevention and treatment of E.coli biofilm-associated infections (BAI).

Paeonol

Escherichia coli

Biofilm

Eradicate

Quorum sensing

According to the report of the China Antimicroblal Resistance Survelllance System, the top two clinical isolated strains nationwide are Escherichia coli (E.coli) and Klebsiella pneumoniae[1]. Among them, E.coli is widely present in the natural environment, and is also a common pathogen in large-scale breeding, posing a serious threat to the animal husbandry industry and human health safety [2]. Currently, the resistance of E.coli is increasingly worsening, with unclear treatment effects. One of the important reasons leading to bacterial stubborn drug resistance and tolerance is the biofilm[3]. Bacteria in biofilms have high drug resistance, and antibiotics have minimal killing effects on deep and persistent bacteria within mature biofilms[4]. This forces us to seek new strategies to prevent and treat biofilms, and the development of novel antibacterial drugs with the ability to eliminate mature biofilms has become an urgent issue that needs to be addressed.

Natural bioactive compounds have unique advantages in preventing and treating infectious diseases. These advantages include treating both the symptoms and root causes, low risk of developing drug resistance, low cost, and acting on multiple target sites[5]. In the context of the "antibiotic ban" era, the feed conversion of medicinal and edible natural bioactive compounds resources is a research hotspot in treating biofilm-associated infections (BAI) is irreplaceable[6].

Nevertheless, the research team has preliminarily identified that paeonol has a significant ability to eliminate biofilms of porcine E.coli, but the mechanism of action is still unclear. This study not only intends to combine the phenotypic effects of paeonol eradicated mature biofilms of porcine E.coli (NO. Ec032), but also Data Independent Acquisition (DIA) proteomics technology to analyze its protein expression levels. This aims to preliminarily elucidate its mechanism of action, laying a theoretical foundation for the development of paeonol as a novel biofilm removal agent, and providing new strategies for the clinical prevention and treatment of BAI by E.coli.

Bacterial strains, culture conditions

Ec032 and Chromobacterium violaceum 026 (CV026) strain was resuscitated, and was cultured overnight at 37℃ in Luria-Bertani (LB), the culture was expanded. The optical density (OD) of 600 nm was adjusted to 0.1, and then diluted 100 times as the test bacterial solution.

Biomass and bioflm bacterial assays

The biomass and viable bacteria of bioflms were assayed, as described previously with minor modifcations. The results demonstrated that the minimum inhibitory concentration (MIC) value of Ec032 to paeonol was greater than 2048 µg/mL. The bioflms were preformed by adding the test bacterial solution into 96-well plates and incubating at 37℃ for 24 h. After the incubation, the mature biofilm was used. Afterwards, the plates were washed three times with phosphate-bufered saline (PBS), Mueller-Hinton broth (MHB) (containing 2% DMSO) of the Control group and paeonol liquids was added. Next, incubated at 37℃ for 3 h. The natant was discarded, and the cells were washed with PBS. Fixing with methanol for 10 min, followed by air drying, staining with 0.04% crystal violet solution for 20 min, and washing with PBS. Then, acetic acid was used to dissolve the bound crystal violet, and absorbance was measured at OD₆₀₀ nm. To count the number of bacteria in the bioflm, Triton X-100 was added to each well to disrupt the bioflm, followed by tenfold dilution and spreading on TSA plates, and the colonies were counted after 12 h at 37 ℃.

Confocal laser scanning microscopy (CLSM)

The morphological features of bioflms were observed by CLSM. In this experiment, culture mature biofilms were divided into control and paeonol groups, the test bacterial solution was added to an 8-well Lab-Tek II chambered cover glass. Then, the bioflm was washed with 0.9% NaCl and stained for 20 min at room temperature by using a Filmtracer™ LIVE/DEADTM Bioflm Viability kit. After being rinsed with PBS, the bioflm samples were imaged with CLSM, which was equipped with a Plan-Apochromat 63×/1.40 oil objective lens. Signals were recorded using the green (SYTO 9, 488 nm) and red (PI, 561 nm) channels. Images were acquired using ZEN (black edition) software. The bioflm volume, area and fuorescence intensity were analyzed by BioflmQ software.

Quantitative realtime PCR (qRTPCR)

Total RNA was extracted from culture mature biofilms by Trizol reagents. Then the cDNA is generated using PrimeScript™ RT reagent Kit with gDNA Erase (Takara Co.,Ltd, China). According to the NCBI, we designed amplification primers for the qPCR of the test genes (Table 1) (Beijing Tsingke Biotech Co., Ltd.). Then each reaction is performed three times in duplicate using ABI 7500 Fast Real-Time PCR system (Applied Biosystems, USA). The two-step reaction procedure is adopted: 95℃ 30 s; 95℃ for 10 s, 60℃ for 34 s, 40 cycles in total; 95℃ 15 s, 60℃ 1 min, 95℃ 15 s, 60℃ 15 s. The qPCR reaction system is as follows: 2 µL cDNA, 0.4 µL (10 mM) each of forward and reverse primers, 10 µL 2×SYBR Green Pro Taq HS Premix, supplement ddH₂O to 20 µL. The reaction without template and the negative reference samples were used as negative controls. Raw data is exported to GraphPad Prism for analysis. At the same time, relative mRNA levels were determined using the comparative Ct method and normalized against gapA mRNA, so as to calculate the relative mRNA level of by ^ΔΔct method.

Table 1

The list of primer information in this study
Primer	Forward primer(5’→3’)	Forward primer(5’→3’)
gapA	GTTGTCGCTGAAGCAACTGG	CGATGTCCTGGCCAGCATAT
mqsR	AAAACTTGTCAATGCCGGGC	CCTGTAACAAGCCTGGGTCT
rdcA	GCGTTGTGCGTGAGACTTTT	GACCTGCTCTGCCAGAACTT
csgD	GATTACCCGTACCGCGACAT	GCGTAATCAGGTAGCTGGCA
csgA	TCTGGGCAGGTGTTGTTCCTC	CCGCCATGCTGGGTAATAT
csgB	AGTGCCAACGATGCCAGTAT	TCACGCGAATAGCCATTTGC
motA	CGCCGAAACCAGCAAATGA	TCCTCGGTTGTCGTCTGTTG
motB	TGACTGCGATGATGGCCTTT	CCCCTGGCTTTGGGTGTAAT
fimA	TTGTTCTGTCGGCTCTGTCC	ACTGGTTGCTCCTTCCTGTG
papG	TTCGCATCGTGAAACAGCAC	TACGTTTCGCTTCCATGGCT
luxS	TTGGTACGCCAGATGAGCAG	ACGTCACGTTCCAGAATGCT
qseB	ATTGGCGACGGCATCAAAAC	CACGCTGACCTTTTTCTCGC
qseC	CGTGACCCTGACTCGGAAAA	TTCGGTTTGCACTTTCAGCG
lsrK	CAGATTACTTTGGCTGGCGC	CGTAGGCCAGCCATATCCAG
rcsB	ATCAGTGCTGGTGGTTACGG	TCAGCAGGGCGATATCGTTC
flhC	ATGCTGCCATTCTCAACCATAT	GCTTGTGGGCACTGTTCAAG
flhD	TCCGCTATGTTTCGTCTCGG	ATCGTCAACGCGGGAATCTT
yciR	GTCATTGGGCAAAGCGTGTT	TTGCGAAACAGAAACAGCCG
rpoS	AGCTGAACGTTTACCTGCGA	TGTCCAGCAACGCTTTTTCG
wza	GACTTTAGCGGCATGACCCT	CGTGGCATCGGACATATCCA

DIA

Using a 6-well cell culture plate to construct a biofilm in vitro, administer paeonol for 3 hours, and simultaneously set up a control group. Each experimental group collected three independent replicates of samples, sent them to the company for DIA sequencing (Bioprofile, China). The software DIA-NN was used to merge all mass spectrometry data, complete the database retrieval of DIA mass spectrometry data, and perform protein DIA quantitative analysis. The organized genes related to the biofilm were imported into STRING (https://string-db.org/) to obtain a protein-protein interaction (PPI) network diagram. The obtained images were analyzed and integrated using Cytoscape 3.9.1 software. The plugin CentiScaPe 2.2 was used to analyze the network topology based on the Betweenness and degree values, to select key targets of paeonol acting on the biofilm. For the molecular docking part, the open source software AutoDock1.5.7 was used for docking and data processing, and Pymol was used to process the docking result files and export the pictures. The best-matched 3 D structure was selected in the following databases based on the proteomics number. The 3D structure files of the target proteins were obtained from RCSB PDB database (https://www.rcsb.org/), Deep Mind database (https://alphafold.ebi.ac.uk/), SWISS-MODEL database (https://swissmodel.expasy.org/repository/), the 3D structure of paeonol was obtained from the Pubchem database (https://pubchem.ncbi.nlm.nih.gov/).

Quorum sensing inhibitor (QSI) test

Add CV026 to LB agar containing KAN (20 µg/mL) and C4-HSL (10 µM/mL), mix well, and pour onto cell culture plates. After the agar solidifies, used a sterile cork borer to make holes, add 20 µL of prepared paeonol, seted an equal amount of DMSO control group, and were cultured after 12 h at 37 ℃.

Swimming test

The cultured biofilm bacteria liquid was dropped vertically and gently the surface of swimming agar plate, left to dry for 10–15 min. Then gently transfer it to the incubator and culture for 6–8 h. The results were observed and recorded. The independent test was repeated three times.

Assays of Exopolysaccharides (EPS)

The EPS content was determined by ruthenium red staining. Ruthenium red dye solution was added to the mature biofilm after intervention,cultured after 60 min 37℃, cleaned, drawed the unattached ruthenium red dye solution to a new 96-well plate, and absorbance was measured at OD₄₅₀ nm. The EPS content of biofilm was calculated according to the formula: EPS content = [OD₄₅₀ (blank control group) -OD₄₅₀ (sample group)]× bacterial count.

Statistical analyses

All experimental results were replicated three times. Data was analyzed by GraphPad Prism 8.0 software, and the statistical analysis was performed according to Student's T-tests. Analysis of variance was used for statistical analyses. Signifcant diferences were indicated as *(P < 0.05), **(P < 0.01), ***(P < 0.001), ****(P < 0.0001), respectively. Not Statistically Significant acronym for “ns”.

Paeonol signifcantly reduced the biomass and viable bacteria of Ec032 bioflm

To explore the optimal conditions for paeonol intervention in the mature biofilm formation of Ec032, the detection was carried out under the same concentration and different time periods of intervention. The results showed that when the paeonol concentration was 2,048 µg/mL, compared with the control group, the Ec032 biomass decreased by 32.66% (P < 0.01), 42.51% (P < 0.0001), 52.90% (P < 0.0001), 53.71% (P < 0.001), 58.31% (P < 0.001), and 56.98% (P < 0.01) during the 1–6 h intervention, respectively. The clearance effect of paeonol intervention for 3 h was significantly higher than that for 2 h (Fig. 1A). Therefore, the optimal time for paeonol was determined to be 3 h. As the concentration of paeonol increases, its ability to eradicate the biofilm gradually strengthens. However, there is no statistically significant difference in the eradication rate between 4,096 µg/mL and 2,048 µg/mL. The ability of paeonol to eradicate the biofilm exhibits good dose-dependence (Fig. 1B).

Furthermore, the plate pouring method was used to perform viable bacterial counts on the biofilm after paeonol intervention. The results show that compared to the Control group, the paeonol group at concentrations of 4,096 µg/mL, 2,048 µg/mL, 1,024 µg/mL, and 512 µg/mL could significantly reduce the viable bacterial count in the biofilm (a reduction of 1.34, 1.45, 1.08, and 0.52 Log₁₀ CFU/mL, respectively), and there was no statistical difference in the viable bacterial counts between the 4,096 µg/mL and 2,048 µg/mL concentrations (Fig. 1C). The results indicate that paeonol could act on the bacteria within the mature biofilm, and when the paeonol concentration reaches 2,048 µg/mL, it achieves the optimal inhibitory effect.

Paeonol eradicated E. coli biofilm

To corroborate the eradication activity of paeonol, CLSM was used to visualize the preformed bioflm after treatment with paeonol. By staining with SYTO 9 (live) and propidium iodide (PI) (dead) bacteria. Representative orthogonal views of Z-stacks and 3D images (Fig. 2A-D) showed the fluorescence intensity was significantly reduced in paeonol treated bioflms. In addition, quantifying the picture information by using the Biofilm Q software, the number (83.56%), area (7.29%) and volume (98.01%) of Ec032 bioflms were decreased (Fig. 2E-G). The ratio of PI and SYTO 9 fluorescence intensities per unit basearea showed that the paeonol group had a highly significant reduction in both parameters. Specifically, the PI fluorescence intensity per unit basearea in the paeonol group decreased by 82.35%, while the SYTO 9 fluorescence intensity per unit basearea decreased by 93.54% (Fig. 2H and I). The ratio of PI and SYTO 9 fluorescence intensities per unit volume showed that the paeonol group had a highly significant increase in both parameters. Specifically, the PI fluorescence intensity per unit volume in the tannic acid group increased by 89.90%, and the SYTO 9 fluorescence intensity per unit volume increased by 71.91%, with a highly significant difference (Fig. 2J and K). In summary, these results indicate that paeonol treatment led to a significant reduction in the biofilm number and basearea within the Ec032 biofilms, while also causing an increase in the fluorescence intensities per unit volume. This suggests that paeonol can effectively disrupt and eradicate the biofilm structure.

Paeonol decreased transcript levels of biofilm-related genes except mqsr

After paeonol treated, accompanied by down-regulation in the expression of QS-related genes (luxS, lsrK, qseB, and qseC), but mqsR was significant up-regulation (Fig. 3A). Flagellar-related genes (flhD, flhC, motA, motB, and ycgR) were down-regulation (Fig. 3B). Adhesion-related genes (papG, csgA, csgB, csgD, and bcsA ) were all down-regulation, but fimA was not statistically significant (Fig. 3C). The transcriptional level of the EPS gene about wza, which is homologous to gcfE, was down-regulation, other related genes were also down-regulation (Fig. 3D). These findings suggest that paeonol could target multiple regulatory pathways and genes involved in E.coli biofilm formation and maintenance, leading to the significant reduction in biofilm biomass and viability reported earlier.

Paeonol affected the expression of biofilm related proteins via DIA analysis

DIA technology results revealed that paeonol affected 1001 differentially expressed proteins, with 292 proteins were significantly up-regulated and 709 proteins significantly down-regulated (Fig. 4A). The extremely significant proteins were YecD, TklA, GlsA 2, OsmE, etc. (Fig. 4B), and proteins were clustered and plotted into a heatmap (Fig. 4C). To gain insights into the mechanism of these proteins, the GO and KEGG pathway analyses were conducted. GO function annotation showed that the top 10 most significant terms were distributed across the three main branches: cell components (CC), molecular function (MF), and biological process (BP) (Fig. 4D). The differential proteins was performed on pathway annotation, and the results indicate that the top ten enriched pathways were primarily related to metabolic pathways, which contained the largest number of enriched differential proteins (Fig. 4E). Down-regulated proteins were primarily associated with flagellar assembly. Conversely, up-regulated proteins were linked to pyruvate metabolism. However, the two-component system (TCS) is distributed between flagellar assembly and pyruvate metabolism (Fig. 4F), and showed the chord diagram of the relationship between differential proteins and pathways (Fig. 4G). The differentially expressed proteins related to biofilm formation were classified according to different pathways, the analysis revealed that there were mainly distributed in the QS system and motility-related proteins. Furthermore, among the motility-related proteins, the majority were associated with flagellar assembly (Table 2). This classification and pathway-based analysis of the differentially expressed biofilm-related proteins provides important insights into the molecular mechanisms underlying the anti-biofilm effects of paeonol.

Table 2

Paeonol intervention Ec.032 bioflm of different biofilm-related proteins
Protein	ID	Product	Log₂ (Fold Change)	P < 0.05	FDR
Flagellate related the representative proteins
FimH	P08191	Type I fibrin D-mannose-specific adhesin	-1.02649	0.034747	0.101722
FlgE	P75937	The flagellar hook protein	-2.56064	0.041467	0.114035
FlgF	P75938	The flagellar basal rod protein	-3.65048	0.014684	0.05765
FlgH	A7ZKI4	The flagellar L loop protein	-4.30144	0.000128	0.005451
FlgL	P29744	Flagellar hook-associated proteins	-2.55501	0.031210	0.094066
FlgM	P0AEM4	A negative regulator of flagellin synthesis	-3.11295	0.001333	0.014904
FliC	B7USU2	Flagellin protein	-4.15076	0.048799	0.127855
FliD	P24216	Flagellar hook-associated proteins	-2.56227	0.032770	0.097179
FliF	P25798	Flagellar M loop protein	-2.69079	0.006461	0.034971
FliH	P31068	The flagellar synthesis protein	-2.25999	0.017590	0.065617
FliI	P52612	Flagellar-specific ATP synthetase	-6.49255	0.000087	0.004638
FliM	P06974	The flagellar motor switch proteins	-5.22377	0.000139	0.005591
FliN	P15070	The flagellar motor switch proteins	-6.64995	0.003409	0.024698
YcgR	P76010	Flagellar brake protein	-3.32071	0.000310	0.007374
MotB	P0AF06	Motor protein B	-3.15661	0.005233	0.031267
CsgD	P52106	csgBAC Operon transcription regulatory protein	-2.630017	0.001212	0.014490
YdiV	P76204	Putative anti-FlhC2D4 factor	-0.699854	0.001328	0.014903
QS system related the representative proteins
LsrA	Q8XAY7	AI-2 was input into the ATP-binding protein	-1.24599	0.017274	0.064792
LsrD	A8A068	The AI-2 input system permease protein LsrD	-1.28718	0.001764	0.017691
LsrF	A7ZLX4	3-hydroxyl-5-oxogentane phosphate-2,4-diketothioatase	-0.70379	0.008582	0.040709
LsrK	A7ZLW9	AI-2 kinase	-1.81263	0.000668	0.011202
LsrR	A8A065	The transcriptional regulator	-0.91206	0.001029	0.013768
TqsA	P0AFS5	The AI-2 transporter protein	2.5477413	0.012339	0.051382
TCS related the representative proteins
RcsD	A0A826QV10	Phosphotransferase	0.826203	0.045135	0.120857
UvrY	P0AED5	Reaction regulator	-0.740389	0.003200	0.023728
OmpR	P0AA16	The extracellular membrane protein regulator	0.918623	0.000481	0.009347
EPS related the representative proteins
GfcE	P0A932	Putative polysaccharide export proteins GfcE and Wza are homologous	-0.59090	0.03051	0.092794
c-di-GMP
PdeB	P77473	Phosphodiesterase	0.611601	0.014329	0.056973
PdeL	P75800	Phosphodiesterase	-0.830624	0.002331	0.019851
Other related the representative proteins
OmpX	P0A917	Outer membrane protein	0.926739	0.007363	0.037105
AcrD	P24177	Putative aminoglycoside efflux pump	0.595218	0.009581	0.043787
AcrE	P24180	The multidrug export protein	5.245012	0.000017	0.002923
AcrA	P0AE06	Multidrug efflux pump subunit	1.025486	0.024429	0.080365
AcrF	A0A828IPI4	Efflux pump cell membrane transporter	0.000053	6.621870	0.004262
TolA	A0A0C2K8P5	Cell envelope integrity proteins	-1.47184	0.002993	0.02285
Mcr-1	A0A0R6L508	Phosphatidylethanolamine transferase	-1.05854	0.002109	0.019068
BhsA	P0AB40	The multiple stress resistance protein	8.2029282	0.02035	0.071448
TanA	A7ZTR3	Tryptophanase	-1.560635	0.032435	0.096688
MarA	P0ACH5	Multiple antibiotic resistance proteins	5.246705	0.001668	0.017191
MdtD	A7ZNQ0	Polydrug-resistant proteins	2.96873	0.001818	0.017813
MdtQ	P33369	Multidrug-resistant outer membrane proteins	2.279707	0.016443	0.062296
MarR	P27245	Multiple antibiotic resistance proteins	3.917514	0.000014	0.002615

Network pharmacology revealed the mechanism of paeonol eradicating biofilm

PPI results that the outer circle contains 35 proteins with relatively strong protein-protein interactions. The inner circle consists of core protein components RNA polymerase factor (RpoS), outer membrane protein regulator (OmpR), multiple antibiotic resistance protein (MarA), flagellar protein (FliC), and flagellar synthesis negative regulator (FlgM) (Fig. 5A). Based on the screening results and the 3D structure of paeonol, molecular docking was carried out, and the results were sorted in descending order of the absolute value of the binding energy (Table 3). Among them, the binding energy between OmpR and paeonol was the highest (-5.43 kcal/mol). Therefore, the docking result of the OmpR protein was used as a representative figure for analysis (Fig. 5B), and indicated that OmpR is the key target for the binding of paeonol. Meanwhile, the 44 differentially expressed proteins were imported the STRING database, we was found that them are closely connected with the proteins involved in bacterial flagella assembly (FimH, FlgE, FlgF, FlgH, FlgL, FlgM, FliC, FliD, FliF, FliH, FliI, FliM, and FliN, etc.), some proteins (RpoS, OmpR, UvrY, etc.) are related to each other or to other protein components. In addition, the bacterial QS-related proteins (LsrA, LsrD, LsrF, LsrK, LsrR, and TqsA, etc.) also have good interactions with each other (Fig. 5C). In summary, differentially expressed proteins are mainly involved in key physiological processes, such as bacterial flagella assembly and QS system. They have close inter-connections and regulations.

Table 3

Binding energies of the molecular docking by paeonol and proteins
Proteins	Afnity (kcal/mol)
OmpR	-5.43
MarA	-4.5
FliC	-4.1
RpoS	-3.74
FlgM	-2.88

The results based on proteomic analysis and qRT-PCR showed that paeonol could significantly inhibit the production of purple pigment in CV026, and the higher concentration with the larger diameter of the inhibition zone of CV026 purple pigment (Fig. 5D and E). This indicates that paeonol can act as a QSI to inhibit the production of violacein in CV026. Furthermore, paeonol can significantly inhibit the bacteria flagellar motility and biofilm-forming ability (Fig. 5F and G). Besides, the EPS content was significantly reduced by 27.9%, indicating that paeonol reduces the polysaccharide component in the EPS matrix of Ec032 biofilm (Fig. 5H).

In the context of reducing resistance, the development of alternative anti-infective drugs against BAI is particularly important. Natural product monomers, with their advantages of being green, low-toxicity, and less likely to develop resistance, are considered to be promising candidate drugs for combating BAI[7]. Paeonol, also known as moutan phenol or paeony alcohol, with the chemical formula C₉H₁₀O, is a phenolic compound extracted from the dried root bark of the peony or the whole herb vincetoxicum pycnostelma kitag[8]. It has a wide range of biological activities, such as antimicrobial, anti-inflammatory, analgesic, antipyretic, and antiallergic effects[9]. Studies have shown that paeonol can inhibit the formation of biofilms in bacteria, such as Pseudomonas aeruginosa and Klebsiella pneumoniae[10, 11]. This study used crystal violet staining and CLSM techniques to find that paeonol has a significant effect in eradicating E.coli biofilms, and this effect exhibits a typical dose-dependent pattern. Under the CLSM observation, a dense biofilm was clearly observed in the control group. In contrast, the fluorescence intensity was significantly reduced in the paeonol treatment group, with only a small amount of biofilm remaining. Quantitative analysis of the CLSM images by Biofilm Q software, with the methods of analyzing fluorescence intensity per unit area and per unit volume, can better reflect the survival status of bacteria within the biofilm[12]. This study found that paeonol reduced the Ec032 mature biofilm, and the main mechanism was by decreasing the biofilm volume.

With the result that genes related to the bacterial QS system, such as luxS, lsrK, qseB, and qseC, have undergone significant changes. Among them, luxS and lsrK encode LuxS, which is involved in the synthesis of AI-2, and LsrK, which is responsible for phosphorylating AI-2, respectively. AI-2 serves as an important signaling molecule in the QS system and participates in the regulation of biofilm formation and various biological processes. After the intervention of paeonol, the expression of both luxS and lsrK genes were significantly downregulated, indicating that paeonol can inhibit the production of bacterial AI-2, thereby suppressing the formation of bacterial biofilms. The AI-2 can also activate the QS regulator MqsR, which influences the formation and structure of bacterial biofilms[13]. MqsR can also positively regulate the transcription of the qseBC and motAB genes, and negatively regulate the transcription of the main biofilm formation control factor CsgD[14, 15]. In the differentially expressed proteins, the expression of qseBC, flhDC, motAB, and ycgR were downregulated, suggesting that paeonol may inhibit the flagellar motility of biofilm-forming bacteria. Furthermore, paeonol seems to disrupt the regulatory process of MqsR on qseBC and motAB, leading to the upregulation of MqsR. While the transcription level of the multi-level cascaded CsgD decreased, indicating that paeonol did not affect the regulatory role of MqsR on CsgD. Studies have shown that decreased CsgD expression can affect the reattachment process of biofilm-forming bacteria[16]. Combining the omics results, it is speculated that paeonol indirectly affects the adhesion ability of bacteria by influencing the regulatory function of MqsR, thereby inhibiting biofilm formation. The adhesins and extracellular polysaccharides as polysaccharide components of EPS in E. coli can stabilize the three-dimensional structure of the biofilm[17]. The study found that the expression of BcsA, the cellulose synthase encoded by bcsA, was downregulated, suggesting that paeonol may lead to decreased cellulose production and inhibit curli fimbriae synthesis in biofilm-forming bacteria. The transcription levels of waz and papG were also downregulated, resulting in reduced production of colanic acid and other polysaccharide components, leading to a more loosened structure of the mature biofilm. In summary, paeonol may reduce the EPS matrix of the biofilm, leading to decreased flagellar motility and aggregation ability of biofilm-forming bacteria, thereby disrupting the mature biofilm structure.

The proteomic results suggest that paeonol may act on the QS system of E.coli, leading to reduced biofilm formation. The QS signal transduction protein TqsA can inhibit or promote the transport of AI-2[18]. TqsA is also related to antibiotic resistance, and deletion of the tqsA gene affects AI-2 transport, inducing the expression of the efflux pump genes acrEF[19]. Among the differentially expressed proteins, AcrE and AcrF were upregulated, perhaps due to the inductive effect of TqsA. After treatment with paeonol, the proteins responsible for regulating AI-2 transport and phosphorylation in the biofilm-forming bacteria were downregulated, consistent with the qRT-PCR results. However, the TqsA protein, which is responsible for AI-2 transport, was significantly upregulated. Paeonol may upregulate the expression of TqsA, leading to increased export of AI-2 from the cells, thus increasing the extracellular AI-2 concentration. At the same time, paeonol also reduced the expression of the AI-2 uptake proteins LsrA and LsrD, decreasing the amount of AI-2 entering the cells. Due to the insufficient phospho-AI-2 inside the cells, it was unable to effectively relieve the repression of the lsrR and lsr operons by LsrR[20]. As a result, the bacteria was unable to obtain enough AI-2 signals to trigger the normal cell processes related to biofilm formation, as the proteins involved in AI-2 uptake and utilization were reduced, and the threshold for activating the massive AI-2 uptake process could not be reached[21, 22]. In addition, the biosensor strain CV026 does not produce AHL signaling molecules, but it can utilize exogenous autoinducer signals in the environment to produce the purple pigment violacein, displaying a purple color reaction. Therefore, it can be used to detect whether a drug is a QS Inhibitor (QSI)[23]. Similarly, there are reports that the crude extract of Paeonia suffruticosa has anti-QS activity, and the active QSI component in Paeonia suffruticosa has been identified as paeonol[24]. The current study found that paeonol can inhibit the production of violacein in CV026, further confirming that paeonol is a QSI. From this, we can see that paeonol can reduce biofilm formation by affecting the AI-2 transport and utilization pathways in the bacterial QS system.

In this investigation, the proteins responsible for flagellar assembly (FliC, FliG, FliM, FliN, FlgE, FlgF, FlgH, FlgL, FliD, FliF, FliH, FliI) and YcgR were all downregulated. Combined with the bacterial motility results, this indicates that paeonol can inhibit the flagellar assembly process in the biofilm-forming bacteria, thereby weakening the bacterial motility. This suggests that paeonol affects the assembly of flagellar components, impairing the normal function of the flagella and reducing the swimming motility. This in turn decreases the supportive role of the EPS matrix components in the biofilm structure, leading to reduced biofilm formation. The BarA-UvrY TCS consists of the transmembrane sensor kinase protein BarA and the cytoplasmic response regulator protein UvrY, where UvrY can also stimulate the transcription of barA[25, 26]. Among the differentially expressed biofilm-associated proteins, the expression of UvrY was decreased, suggesting that paeonol may interfere with the expression of type I fimbriae, affecting the adhesion of bacteria. Among the differentially expressed biofilm proteins, RcsD was upregulated, while the expression of RcsC and RcsB showed no statistical significance. Paeonol appears to enhance the phosphorylation and transfer process, affecting the expression of csgD and flhD by the RcsCDB system, indirectly regulating the production of EPS structural components and controlling the re-adhesion process of bacteria. All in all, paeonol can affect the assembly of flagella and the synthesis of curli fimbriae in the EPS structural components, thereby weakening the supporting role of EPS in the biofilm structure and making the biofilm structure unstable. It may also affect the initial adhesion process of bacteria, reducing the formation of biofilms. Furthermore, the study found that the expression of RpoS and CsgD were downregulated, indicating that paeonol may also affect the biofilm reattachment process, resulting in decreased bacterial adhesion to the surface.

The MarA protein is encoded by the marRAB operon and is a regulator of biofilm formation[27]. The multidrug resistance repressor protein MarR is a negative regulator of the marRAB operon, which can be induced and bound by plant phenolic compounds[28]. The paeonol studied in this paper is a phenolic compound extracted from plants, and the expression of both MarA and MarR was upregulated after paeonol intervention, indicating that paeonol can bind to MarR and weaken its inhibitory effect on the marRAB operon, leading to increased expression of MarA. This indirectly reduces the EPS polysaccharide component of the biofilm, thereby diminishing the volume of the mature biofilm[29]. There are reports that paeonol can reduce the content of extracellular polysaccharides in Klebsiella pneumoniae, and the expression of GcfE, a protein involved in the production/export of extracellular polysaccharides, is downregulated[30]. Combined with the experimental results, this further confirms that paeonol has the ability to reduce extracellular polysaccharides. Therefore, it is speculated that paeonol reduces the content of EPS polysaccharide components, which may be more due to its impact on the colanic acid content, leading to a loose biofilm structure, reduced volume of mature biofilms, and ultimately achieving the goal of eradicating biofilms.

BsmA is a biofilm peroxide resistance protein, belonging to the BhsA/McbA family, encoded by the bsmABC gene cluster, and is involved in protecting the biofilm from stress responses[31]. The most notable feature of bsmA deletion is the loss of microcolony formation and a significant increase in flagellar motility[32]. In this analysis, the expression of stress response-related proteins BsmA and BhsA, as well as multiple antibiotic resistance and efflux pump proteins (AcrA, MdtD, MdtQ, etc.) were upregulated. The addition of paeonol may have triggered a stress response in E. coli, stimulating an increase in the resistance of BsmA and BhsA proteins, protecting the biofilm from drug damage and forcing the expulsion of paeonol.

The research results of this paper show that the expression of OmpX is upregulated, indicating that paeonol can inhibit flagellar motility, thereby reducing the formation of biofilms. The outer membrane protein regulator OmpR, as a member of the TCS, plays a role in the regulation of various genes, including the specific regulation of the master regulator flhDC of flagella in E.coli, the main control factor CsgD for biofilm formation, and the alteration of virulence characteristics of pathogens[33–35]. The results found that OmpR protein expression was upregulated, while CsgD expression was downregulated, and biofilm formation was reduced. OmpR may act as a bacterial compensatory mechanism to maintain low-level expression of curli fimbriae[36]. The proteomic results show that the expression of FimH and CsgD were downregulated. Paeonol may upregulate the expression of OmpR and promote its phosphorylation, thereby weakening the bacterial adhesion ability and inhibiting the re-formation of biofilms. Combined with the results of molecular docking, this study speculates that OmpR is a key target of the action of paeonol.

In conclusion, this work clarified the role of paeonol in inhibiting and killing effect on the mature biofilm of E.coil. Our results suggested that paeonol inhibited the flagellar motility and extracellular polysaccharide synthesis of biofilm bacteria, reduced the production of bacterial EPS components, thereby affecting the EPS structure and reducing the volume of mature biofilms. In addition, Paeonol can also affect the transport of autoinducers in the QS system, so that they cannot function normally, thereby affecting the normal development of biofilms.

Declaration of Competing Interest

The authors declare that they have no conflicts of interest regarding the contents of this article.

Author Contribution

Hongwei Chen and Maixun Zhu: Writing-review & editing, Supervision, Project administration, Funding acquisition, Conceptualization. Hongzao Yang: Writing original draft & review, Investigation, Funding acquisition, Formal analysis. Yuan Liang: Writing-original draft, Visualization, Methodology, Data curation. Wei Wei: Writing & editing, Investigation. Suhui Zhang: Visualization, Supervision, Resources. Zhuo Yang: Validation, Formal analysis. Jingjing Liu: Validation, Resources. Chenjun Ma: Visualization, Software, Formal analysis. Lei Ran: Visualization, Software, Resources. Lin Liu: Software, Formal analysis.Declaration of Competing Interest

Acknowledgements

This research was funded by Chongqing Natural Science Foundation (CSTB2024NSCQ-MSX0373), Fundamental Research Funds for Central Universities (SWU-KQ22045), National Center of Technology Innovation for Pigs (NCTIP-XD/B12), Yunnan Province Science and Technology Department key research and development plan (202403AC100013), Science and Technology Research Program Project of Chongqing Municipal Education Commission (KJQN20240021), Southwest University Postgraduate Scientific Research Innovation Project (SWUS24193).

Data Availability

Data will be made available on request.

Guo Y, Ding L, Yang Y, Han R, Yin D, Wu S, et al. Multicenter Antimicrobial Resistance Surveillance of Clinical Isolates from Major Hospitals - China, 2022. China CDC Wkly. 2023;5:1155–60.
Long J, Yang C, Liu J, Ma C, Jiao M, Hu H, et al. Tannic acid inhibits Escherichia coli biofilm formation and underlying molecular mechanisms: Biofilm regulator CsgD. Biomed Pharmacother. 2024;175:116716.
Sundaramoorthy NS, Shankaran P, Gopalan V, Nagarajan S. New tools to mitigate drug resistance in Enterobacteriaceae - Escherichia coli and Klebsiella pneumoniae. Crit Rev Microbiol. 2023;49:435–54.
Barman S, Kurnaz LB, Leighton R, Hossain MW, Decho AW, Tang C. Intrinsic antimicrobial resistance: Molecular biomaterials to combat microbial biofilms and bacterial persisters. Biomaterials. 2024;311:122690.
Zhang M, Han W, Gu J, Qiu C, Jiang Q, Dong J, et al. Recent advances on the regulation of bacterial biofilm formation by herbal medicines. Front Microbiol. 2022;13:1039297.
Shao QQ, Xiao P, Zhang X, Guo S, Duan JA. Application strategy of artificial intelligence technology in feed-based development of medicinal and edible homologous traditional Chinese medicine(TCM)resources in era of the antibiotic ban. China J Chin Materia Med. 2024;49:344–53.
Song L, Hu X, Ren X, Liu J, Liu X. Antibacterial Modes of Herbal Flavonoids Combat Resistant Bacteria. Front Pharmacol. 2022;13:873374.
Bae HJ, Kim JY, Choi SH, Kim SY, Kim HJ, Cho YE, et al. Paeonol, the active component of Cynanchum paniculatum, ameliorated schizophrenia-like behaviors by regulating the PI3K-Akt-GSK3beta-NF-kappaB signalling pathway in MK-801-treated mice. J Ethnopharmacol. 2023;314:116627.
Vellasamy S, Murugan D, Abas R, Alias A, Seng WY, Woon CK. Biological Activities of Paeonol in Cardiovascular Diseases: A Review. Molecules 2021;26.
Qian W, Li X, Yang M, Mao G. Antibacterial and anti-biofilm activities of paeonol against Klebsiella pneumoniae and Enterobacter cloacae. Biofouling. 2021;37:666–79.
Yang D, Hao S, Zhao L, Shi F, Ye G, Zou Y, et al. Paeonol Attenuates Quorum-Sensing Regulated Virulence and Biofilm Formation in Pseudomonas aeruginosa. Front Microbiol. 2021;12:692474.
Ma C, Mei C, Liu J, Li H, Jiao M, Hu H, et al. Effect of baicalin on eradicating biofilms of bovine milk derived Acinetobacter lwoffii. BMC Vet Res. 2024;20:212.
Zhang XS, Garcia-Contreras R, Wood TK. Escherichia coli transcription factor YncC (McbR) regulates colanic acid and biofilm formation by repressing expression of periplasmic protein YbiM (McbA). ISME J. 2008;2:615–31.
Kim Y, Wang X, Zhang XS, Grigoriu S, Page R, Peti W, et al. Escherichia coli toxin/antitoxin pair MqsR/MqsA regulate toxin CspD. Environ Microbiol. 2010;12:1105–21.
Gonzalez BA, Zuo R, Hashimoto Y, Yang L, Bentley WE, Wood TK. Autoinducer 2 controls biofilm formation in Escherichia coli through a novel motility quorum-sensing regulator (MqsR, B3022). J Bacteriol. 2006;188:305–16.
Yan CH, Chen FH, Yang YL, Zhan YF, Herman RA, Gong LC et al. The Transcription Factor CsgD Contributes to Engineered Escherichia coli Resistance by Regulating Biofilm Formation and Stress Responses. Int J Mol Sci 2023;24.
Kumari S, Das S. Functional amyloid fibrils of biofilm-forming marine bacterium Pseudomonas aeruginosa PFL-P1 interact spontaneously with pyrene and augment the biodegradation. Int J Biol Macromol. 2024;266:131266.
Wakimoto T, Nakagishi S, Matsukawa N, Tani S, Kai K. A Unique Combination of Two Different Quorum Sensing Systems in the beta-Rhizobium Cupriavidus taiwanensis. J Nat Prod. 2020;83:1876–84.
Herzberg M, Kaye IK, Peti W, Wood TK. YdgG (TqsA) controls biofilm formation in Escherichia coli K-12 through autoinducer 2 transport. J Bacteriol. 2006;188:587–98.
Xue T, Zhao L, Sun H, Zhou X, Sun B. LsrR-binding site recognition and regulatory characteristics in Escherichia coli AI-2 quorum sensing. Cell Res. 2009;19:1258–68.
Li J, Fan Q, Jin M, Mao C, Zhang H, Zhang X, et al. Paeoniflorin reduce luxS/AI-2 system-controlled biofilm formation and virulence in Streptococcus suis. Virulence. 2021;12:3062–73.
Deng Z, Hou K, Valencak TG, Luo XM, Liu J, Wang H. AI-2/LuxS Quorum Sensing System Promotes Biofilm Formation of Lactobacillus rhamnosus GG and Enhances the Resistance to Enterotoxigenic Escherichia coli in Germ-Free Zebrafish. Microbiol Spectr. 2022;10:e61022.
Tang H, Yang D, Zhu L, Shi F, Ye G, Guo H, et al. Paeonol Interferes With Quorum-Sensing in Pseudomonas aeruginosa and Modulates Inflammatory Responses In Vitro and In Vivo. Front Immunol. 2022;13:896874.
Tang Y. Screening and activity evaluation of bacterialquorum sensing inhibitory factor. OCEAN UNIVERSITY OF CHINA; 2014.
Contreras FU, Camacho MI, Pannuri A, Romeo T, Alvarez AF, Georgellis D. Spatiotemporal regulation of the BarA/UvrY two-component signaling system. J Biol Chem. 2023;299:104835.
Wu P, Wang Q, Yang Q, Feng X, Liu X, Sun H et al. A Novel Role of the Two-Component System Response Regulator UvrY in Enterohemorrhagic Escherichia coli O157:H7 Pathogenicity Regulation. Int J Mol Sci 2023;24.
Kettles RA, Tschowri N, Lyons KJ, Sharma P, Hengge R, Webber MA, et al. The Escherichia coli MarA protein regulates the ycgZ-ymgABC operon to inhibit biofilm formation. Mol Microbiol. 2019;112:1609–25.
Sulavik MC, Gambino LF, Miller PF. The MarR repressor of the multiple antibiotic resistance (mar) operon in Escherichia coli: prototypic member of a family of bacterial regulatory proteins involved in sensing phenolic compounds. Mol Med. 1995;1:436–46.
Kim B, Madukoma CS, Shrout JD, Nerenberg R. Effect of EPS production on the performance of membrane-based biofilm reactors. Water Res. 2023;240:120101.
Liu Jingyun LT, Wang Dangfeng YYLJ, Xie Jing W, Mingli Z, Xiaomin, Xiaohua G. Effeet of Paeonol on Ouorum Sensing Phenomenon and Biofilm Formation of Serratia grimessi. Zhongguo Shipin Xuebao. 2021;21:25–34.
Luo HZ, Zhou JW, Sun B, Jiang H, Tang S, Jia AQ. Inhibitory effect of norharmane on Serratia marcescens NJ01 quorum sensing-mediated virulence factors and biofilm formation. Biofouling. 2021;37:145–60.
Weber MM, French CL, Barnes MB, Siegele DA, McLean R. A previously uncharacterized gene, yjfO (bsmA), influences Escherichia coli biofilm formation and stress response. Microbiol (Reading). 2010;156:139–47.
Wang Y, Ling N, Jiao R, Zhang X, Ren Y, Zhao W, et al. A universal mechanism on desiccation tolerance of Cronobacter based on intracellular trehalose accumulation regulated by EnvZ/OmpR. Food Microbiol. 2024;119:104455.
Kenney LJ, Anand GS. EnvZ/OmpR Two-Component Signaling: An Archetype System That Can Function Noncanonically. EcoSal Plus 2020;9.
Nieckarz M, Jaworska K, Raczkowska A, Brzostek K. The Regulatory Circuit Underlying Downregulation of a Type III Secretion System in Yersinia enterocolitica by Transcription Factor OmpR. Int J Mol Sci 2022;23.
Sano K, Kobayashi H, Chuta H, Matsuyoshi N, Kato Y, Ogasawara H. CsgI (YccT) Is a Novel Inhibitor of Curli Fimbriae Formation in Escherichia coli Preventing CsgA Polymerization and Curli Gene Expression. Int J Mol Sci 2023;24.

No competing interests reported.

Download PDF

Editor assigned by journal
03 Sep, 2024
Submission checks completed at journal
03 Sep, 2024
First submitted to journal
02 Sep, 2024

You are reading this latest preprint version

Paeonol Affects Quorum Sensing System and Exopolysaccharides That Biofilm-Eradicating of Porcine Escherichia coli

Status:

Version 1

Abstract

Figures

Introduction

Methods

Bacterial strains, culture conditions

Biomass and bioflm bacterial assays

Confocal laser scanning microscopy (CLSM)

Quantitative realtime PCR (qRTPCR)

DIA

Quorum sensing inhibitor (QSI) test

Swimming test

Assays of Exopolysaccharides (EPS)

Statistical analyses

Results

Paeonol affected the expression of biofilm related proteins via DIA analysis

Network pharmacology revealed the mechanism of paeonol eradicating biofilm

Discussion

Conclusion

Declarations

Declaration of Competing Interest

Author Contribution

Acknowledgements

Data Availability

References

Additional Declarations

Status:

Version 1