Neuroprotective potential of testosterone against aluminium chloride and d-galactose-induced Alzheimer-like pathology aggravated by overcrowding in mice: Role of Nrf2, HO-1, TNF-α, GSK-3β, PI3K and AKT pathway

doi:10.21203/rs.3.rs-5040660/v1

Download PDF

Research Article

Neuroprotective potential of testosterone against aluminium chloride and d-galactose-induced Alzheimer-like pathology aggravated by overcrowding in mice: Role of Nrf2, HO-1, TNF-α, GSK-3β, PI3K and AKT pathway

https://doi.org/10.21203/rs.3.rs-5040660/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Alzheimer's disease (AD) is characterized by cognitive deficits and degenerative changes in the brain, accompanied by neurochemical alterations. Overcrowding refers to a condition of stress caused by a high population density. This stress has both physical and psychological effects. We investigated the potential neuroprotective mechanisms of testosterone focusing on Nrf2 and prosurvival, GSK-3β, PI3K and Akt and neuroinflammation pathways; TNF-α, IL-1β and P38 MAPK against AlCl₃/d-gal-induced AD in overcrowded mice. Fifty Swiss Albino male mice were treated as follows: Gp 1: mice were i.p injected with saline for 80 days and served as the normal control group, Gp 2: mice were administered AlCl₃/d-gal [AlCl₃ at a dose of (20 mg/kg) followed by d-galactose at a dose of (120 mg/kg) for 40 days], Gp 3: mice were administered AlCl₃/d-gal along with exposure to overcrowding for a further 40 days, Gp 4: mice were given AlCl₃/d-gal followed by treatment with a single dose of testosterone (100 mg/kg) on day 41 and Gp 5: mice were administered AlCl₃/d-gal followed by treatment with a single dose of testosterone on day 41 coupled with exposure to overcrowding for a further 40 days. AlCl₃/d-gal and overcrowded AlCl₃/d-gal groups resulted in behavioural, neurochemical, and histopathological changes in mice. Testosterone improved animals’ behaviour and mitigated AlCl₃/d-gal-induced and overcrowded AlCl₃/d-gal-induced Alzheimer-like disease. Testosterone exerted a neuroprotective effect against AlCl₃/d-gal-induced Alzheimer-like pathology in both non-crowded and overcrowded groups via upregulation of Nrf2, HO-1, GSK-3β, PI3K and Akt and marked reduction in TNF-α, IL-1β and P38 MAPK.

Testosterone

AlCl3/d-gal

Nrf2

TNF-α

PI3K/AKT

Aluminum is a widely recognized harmful substance to the nervous system and plays a role in the development of Alzheimer's disease (AD) (Attia and Ahmed 2020). The degeneration of neurons caused by aluminum leads to cognitive impairment, and this process is linked to increased expression of amyloid precursor protein (APP) (Walton and Wang 2009) and the deposition of beta-amyloid (Aβ) (Kawahara and Kato-Negishi 2011). D-galactose is a reducing sugar which easily reacts with free amines of amino acids in peptides and proteins, to form advanced glycation end products (AGEs) (Vlassara 1994). Low-dose chronic D-gal administration has been demonstrated to cause aging-like alterations in animals, such as cholinergic neuronal degeneration, Aβ accumulation, and cognitive impairment (Wei et al. 2005), cholinergic neuronal degeneration. It also triggers oxidative stress, synaptic dysfunction, and neuronal apoptosis (Kamel et al. 2018). As a result, combining d-galactose (d-gal) and aluminum chloride (AlCl₃) in rodents has been shown to be a cost-effective method for developing models for Alzheimer's disease (AD) research (Labban et al. 2021).

Overcrowding stress refers to a form of psychological and social stress caused by a higher concentration of people in a given area. Overcrowding leads to increased aggression, disruption of typical social interactions, and decreased task performance, resulting in various psychological consequences (Kumar et al. 2009). Physiological outcomes of overcrowding include changes in organ weights (Eid et al. 2010), hyperglycemia and dyslipidemia (Bahaa El-Dein et al. 2020). The prolonged duration of stress resulted in insomnia, anxiety, depression, neurodegenerative disease, and symptoms of aging (Justice 2018).

Neurofibrillary tangles and neurodegeneration result from stress-induced increases in hyperphosphorylated tau when human AD-associated tau mutations are injected into animals (Carroll et al. 2011). The corticosteroid injection alone increases Aβ, hyperphosphorylated tau, and amyloid plaque levels, suggesting that it contributes to the worsening of both extracellular and intracellular AD pathology. Corticotropin-Releasing Factor (CRF), a neuropeptide produced in response to stress, may be manipulated to affect AD pathogenic outcomes (Kang et al. 2007).

Testosterone (C₁₉H₂₈O₂), known as the primary male sex hormone, is an anabolic steroid. Testosterone deficiency negatively affects the brain by contributing to increased accumulation of Aβ protein (Ramsden et al. 2003), reduced synaptic plasticity (Sakata et al. 2000), impaired neurotransmitter release (Romeo et al. 2005), and decreased density of dendritic spines (Li et al. 2012). It has been reported that testosterone replacement can improve spatial memory in an aged rat model (Jaeger et al. 2020). Also, testosterone may improve cognitive performance via an androgen receptor to remove Aβ and increase synaptic plasticity (Huo et al. 2016). Hence, the current study aimed to investigate the possible therapeutic effects and mechanisms underlying the potential neuroprotective effects of testosterone against aluminum chloride and d-galactose-induced AD in overcrowded mice.

Drugs and chemicals

Aluminium chloride and d-galactose were purchased from Sigma-Aldrich Co (USA). Commercially available Nebido^® (Testosterone undecanoate 1000 mg/4 ml, solution for injection) was diluted in sterile castor oil and used for i.m. injection.

Animals

Adult male Swiss Albino mice, weighing 18-22 g, were used in the present study. They were purchased from the animal facility of National Research Center, Giza, Egypt. Animals were kept under controlled environmental conditions at a constant temperature (23 ± 2 ^oC), humidity (60 ± 10%) and light/dark (12 hours/12 hours) cycle, started at 8 am. They were fed on standard diet pellets (composed of 20% proteins, 5% fats and 1% multivitamins, purchased from El-Nasr Chemical Company, Egypt) and water was provided ad libitum. Animals were kept for a week of acclimatization before the start of experiments. All mice were first put in control plastic cages. The size of the control cage is (28 cm x 14 cm x 10 cm) which allows the animals to move freely. Behavioural experiments were carried out during the light phase.

Experimental design

Swiss Albino mice were classified into 5 groups each consisting of 10 mice and were treated as follows) Figure 1). Group 1: Mice were intraperitoneally (i.p) injected with saline for 80 days and served as a normal control group. Group 2: Mice were administered with AlCl₃at a dose of (20 mg/kg; orally, p.o.) for 40 days followed by d-galactose at a dose of (120 mg/kg, i.p) for 40 days (Xing et al. 2018) and served as a positive control group. Group 3: Mice were administered with AlCl₃at a dose of (20 mg/kg, p.o.) for 40 days followed by d-galactose at a dose of (120 mg/kg, i.p) coupled with exposure to overcrowding for a further 40 days (Xing et al. 2018). Group 4: Mice were administered with AlCl₃at a dose of (20 mg/kg, p.o.) followed by d-galactose at a dose of (120 mg/kg, i.p) for 40 days (Xing et al. 2018) followed by a single administration of testosterone (100 mg/kg, i.m.) on day 41 (Ibrahim et al. 2020). Group 5: Mice were administered with AlCl₃at a dose of (20 mg/kg, p.o.) for 40 days followed by d-galactose at a dose of (120 mg/kg, i.p) for 40 days (Xing et al. 2018) followed by a single administration of testosterone (100 mg/kg, i.m.) on day 41 coupled with exposure to overcrowding for a more 40 days (Ibrahim et al. 2020).

After 24 h of administration of the last dose, mice were subjected to various behavioural investigations [Morris water maze (MWM), novel object recognition (NOR), and Y-maze tests. They were then sacrificed by euthanasia. For further research, brain tissues (cortex and hippocampus) were harvested.

Methods

Induction of Alzheimer-like pathology

Aluminium chloride was administered at a dose of (20 mg/kg, p.o.) for 40 days followed by d-galactose at a dose of (120 mg/kg, i.p.) for 40 days (Xing et al. 2018).

Induction of overcrowding

Overcrowding was caused by housing 8 mice per cage (28 cm x 14 cm x 10 cm) for 12 hours per day (8:00 am − 8:00 pm) for 40 days before the start of the behavioural assessments so that each mouse has 49 cm² surface area to move within. The mice would be immediately returned to their home cages after being exposed to overcrowding (Ago et al. 2014). In the Alzheimer's group, mice would be overcrowded throughout the disease induction period.

Behavioural assessment

Morris water maze (MWM) test

The Morris water maze (MWM) was used to assess spatial learning and memory in mice. This procedure followed a comprehensive description by (Vorhees and Williams 2006). The apparatus consisted of a circular stainless steel tank (150 cm diameter, 60 cm height) filled with approximately 30 cm of water and maintained at a constant temperature of 25 ± 2°C. The tank filled with water was divided into four quadrants. Northeast (NE), northwest (NW), southeast (SE), and southwest (SW) with a 2.5 cm deep evacuation platform in the centre of the northwest quadrant. During the main pre-test training session, each mice was placed in each of her other three quadrants (northeast, southeast, southwest) for up to 60 seconds to find the escape platform. Those who could not find an evacuation platform were directed to one. On the day of testing, the animal was placed in each of its three quadrants for a maximum of 1 minute, and the time required to find the escape platform was recorded as the escape latency. Those who could not find the escape platform within 60 seconds were eliminated and their escape latency was recorded as 60 seconds.

Y-maze spontaneous alternation test

Short-term memory was estimated using the spontaneous alternation percentage (SAP) in the Y-maze task. It consisted of three arms (35 cm long, 25 cm high, and 10 cm wide) and an equilateral triangular central region. The mouse was put at the end of one arm and permitted to move freely through the maze for 3 minutes. An arm entry was calculated when all four limbs of the mouse were completely located within the arm. Additionally, the maze was cleansed with alcohol-free disinfectant wipes between each trial. SAP was defined as entry into all three sectors in a sequential decision. The number of maximum SAP was calculated manually as the total number of arms entered minus 2 and percent spontaneous alternation was estimated as (actual alternations/maximum alternations) / 100 (Kraeuter et al. 2019).

Novel object recognition (NOR) test

In mice, novel object recognition was used to assess hippocampus function and recognition memory, especially working and spatial memory. The equipment consists of a large open field chamber separated into arenas. The animal is put in the centre of the field during the acquisition phase, with two similar items placed in the field's two corners. The animal was permitted to roam the field for ten minutes. During the retrieval phase, the animal is placed in the field again with two items, one familiar (similar to the object from the acquisition phase) and one new (which the animal has never seen before). The animal was permitted to roam the field for three minutes. To compute the discrimination and recognition index, the time spent (s) examining known and unfamiliar items is recorded (Pandareesh et al. 2016).

Preparation of brain samples

Animals were sacrificed by decapitation under mild anaesthesia (thiopental, 50 mg/kg, i.p.) twenty-four hours after the behavioural testing. Following that, brains were excised on ice-cold glass plates. To make 10% w/v homogenates, the hippocampi and frontal cortex were separated, rinsed with saline, dried between two filter sheets, weighed, and homogenized in 50 mM phosphate buffer (pH 7.4) using an electronic homogenizer (Ezister Daihan Scientific Co., Korea). These homogenates were centrifuged for 15 minutes at 4^oC using a cooling centrifuge (Hermile Labortechnik, Germany); the supernatant was separated into numerous aliquots and kept at − 80^oC for assessment of different biochemical parameters. According to FOPCU guidelines, dead remains were kept frozen until incineration.

Histopathological examination

The hippocampal and frontal cortex tissues of three mice from each group were isolated immediately after death. The samples were fixed in 10% formalin prepared in saline for at least 72 hours. All the specimens were washed in tap water for half an hour, then dehydrated using ascending grades of alcohol (70% − 80% − 90% and finally absolute alcohol). Sections were prepared, cleared in xylene and embedded in paraffin at 56^◦C in a hot air oven for 24 hours. Paraffin wax tissue blocks were prepared for sectioning at 3 µm thickness by a slidge microtome. The obtained tissue sections were collected on glass slides, deparaffinised and stained by:

1-Hematoxylin and eosin (H&E) staining, as a general examination staining method.

2-Nissl staining with toluidine blue for the demonstration of intact and damaged neurons.

Techniques were conducted as outlined by (Bancroft and Gamble 2008). The counting of cells in the toluidine blue stained sections was performed within 3 fields for each sample. Slides micrographs and analysis were performed using Leica Application Suite attached to a full HD microscope imaging system (Leica Microsystems GmbH, Germany). For evaluation of the detected alterations in brain sections in both the cerebral cortex and hippocampus, a score ranging from 0 to 4 was given to describe the severity of the lesion as follows 0 = absent, 1 = mild, 2 = moderate, 3 = severe and 4 = very severe as previously mentioned in Ali et al. (2016) with modification.

Immunohistochemistry

Five µm tissue sections were cut on adhesive slides, deparaffinized and rehydrated to distilled water. Tissue sections were subjected to heat-induced epitope retrieval followed by incubation with primary anti-GFAP antibody (abx000622, Abbexa, Cambridge, UK) at a dilution of 1:200, for one hour at room temperature. After washing, peroxidase blocking was performed followed by detection using an HRP-labelled secondary detection kit (BioSB, USA) as manufacturer instructions. Negative control slides were obtained by escaping incubation with a primary antibody. Positive expression was quantified as the mean area percent of positive staining in each group.

Biochemical measurements

Colorimetric analysis

Hippocampal and cortical homogenate GSH and MDA contents were determined using Biodiagnostic assay kit according to the method described by (Beutler et al. 1963) and (Kei 1978), respectively.

Enzyme-linked immunosorbent analysis

Hippocampal and cortical homogenate were used for detecting the oxidative stress, inflammatory, neurological and apoptotic biomarkers. To assess oxidative stress, erythroid 2-related factor 2 (Nrf2), heme oxygenase-1 (HO-1), and cAMP- respond element-binding protein (CREB) were obtained from (MyBioSource, USA, cat. nos. MBS752046, MBS5764989 and MBS7255484, respectively). TNF-α, IL-1β and P38 MAPK mice-specific ELISA kit were purchased (CUSABIO, Inc. Cat No: CSB-E11987r, MyoBioSource, Inc., San Diego, USA Cat No: MBS825017 and MBS765087, respectively) to evaluate the inflammatory cues. To assess neurological biomarkers, amyloid-beta (Aβ), brain-derived neurotrophic factor (BDNF), and protein kinase B (Akt) were obtained from cat. nos., MBS726579, MBS824814 and MBS1600201, respectively). Caspase-3 mice-specific ELISA kit were purchased (MyoBioSource, Inc., San Diego, USA Cat No MBS7244630). All the mice-specific ELISA kits were used and applied according to the manufacturer’s instructions and measured by ELISA reader (Stat Fax 2200, Awareness Technologies, Florida, USA) absorbance was measured at 450 nm. The results were expressed as pg/mg protein for Aβ42, BDNF, IL-1 β and TNF-α. The results were expressed as ng/mg protein for P38 MAPK, CREB, AKT, caspase-3, Nrf2 and HO-1.

Western blot analysis

Hippocampal and cortical homogenate of p-tau, p-PI3K, and p-GSK-3β protein expression were determined by Western blot analysis. The isolated hippocampi and cortical tissues were homogenized in lysis buffer containing 50 mM Tris-HCl (pH 7.4), 10 mM NaF, 2 mM EDTA, 1 mM PMSF, 10 mM β-glycerol phosphate, and protease inhibitor cocktail. The obtained homogenates were centrifuged at 12000 rpm and 4°C for 20 min and then the protein concentration was determined in lysate aliquots using a Bio-Rad protein assay kit (CA, USA). The protein samples were separated by SDS polyacrylamide gel electrophoresis and transferred onto nitrocellulose membranes using a semi-dry transfer apparatus (Bio-Rad, CA, USA). The membranes were blocked with 5% blocking solution containing non-fat dry milk in Tris-buffered saline with Tween (TBST) for 1 h at 37°C to prevent non-specific interactions between the antibodies and the nitrocellulose membranes. The membranes were then incubated overnight on a roller shaker at 4°C with 1:1000 dilutions of the following primary antibodies: anti-β-actin (4967, Cell Signaling Technology, USA), anti-p-PI3K p85 (Tyr458)/p55 (Tyr199) (4228, Cell Signaling Technology, USA), anti-p-GSK-3β (Ser9) (5558, Cell Signaling Technology, USA), and anti-p-tau (Ser404) (44–758 G, Thermo Fisher Scientific, USA). After washing in TBST, the membranes were probed with the secondary antibody, HRP-conjugated goat anti-mouse immunoglobulin (Dianova, Hamburg, Germany). Finally, the protein bands were developed using an enhanced chemiluminescence substrate reaction (Amersham Biosciences, Arlington Heights, IL, USA). The protein band intensities were quantified by densitometric analysis using a scanning laser densitometer (Biomed Instrument, Inc., USA). The results were presented as arbitrary units relative to the intensity of the corresponding β-actin bands.

Real-time polymerase chain reaction (RT-PCR) quantitative analysis

NOX1 gene expression was determined by quantitative RT-PCR. Total RNA was extracted from hippocampal and cortical samples using an RNeasy Mini Kit (Qiagen, Venlo, Netherlands) in compliance with the manufacturer’s instructions. Any residual DNA was removed by DNase supplied with the kit. The quantity of the isolated RNA in each sample was determined at 260 nm using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, USA), and RNA purity was assessed based on the 260/280 nm absorption ratio. For cDNA synthesis, a reverse transcription system (Promega, Leiden, Netherlands) was used according to the manufacturer’s protocol. The RNA was incubated with MgCl2 (25 mM), RTase buffer (10×), a dNTP mixture (10 mM), oligo d (t) primers, RNase inhibitor (20 U), and AMV reverse transcriptase (20 U/µl) at 42°C for 1 h.

The expression levels of the NOX1 gene were analyzed by quantitative RT-PCR using SYBR Green PCR Master Mix (Applied Biosystems, CA, USA) with an ABI PRISM 7500 Fast Sequence Detection System (Applied Biosystems, CA, USA) and the associated quantification software (Applied Biosystems, CA, USA). The sequences of the primers used are listed in Table 1. β-Actin was used as the housekeeping gene. The relative expression of the target genes was obtained using the comparative CT (ΔΔCT) method. ΔCT was calculated by subtracting the CT value of the reference gene (β-actin) from that of each target gene, whereas ΔΔCT was obtained by subtracting the ΔCT of the calibrator sample (control group) from that of the test sample (AlCl₃/D-gal or testosterone group). The relative expression was calculated from the 2 − ΔΔCT formula24.

Table (1): The primer sequences of nicotinamide adenine dinucleotide phosphate oxidase-1 (NOX-1)

mRNA species

Accession number

Forward primer sequence (5’-3’)

NOX-1

NM_053683.1

F: TCTTGCTGGTTGACACTTGC

R: TATGGGAGTGGGAATCTTGG

β-actin

NM_031144.3

F: TATCCTGGCCTCACTGTCCA

R: AACGCAGCTCAGTAACAGTC

Statistical analysis

Data were expressed as means ± standard deviation (SD). Comparisons between means were carried out using one way analysis of variance (ANOVA) test followed by Tukey Kramer multiple comparisons test. However, escape latency during the MWM acquisition phase was analysed by two-way ANOVA followed by Tukey’s multiple comparisons test. Furthermore, histological scores were analysed using Kruskal-Wallis test followed by Dunn’s multiple comparisons tests and were expressed as the mean ± SD. For all statistical tests, the level of significance was fixed at p < 0.05. GraphPad Prism® software package, version 5 (GraphPad Software Inc., USA) was used to carry out all statistical analyses and graph presentations. Correlation analysis was performed using Pearson’s correlation coefficient.

Behavioural study

Effects of testosterone on Morris water maze (MWM) test in mice subjected to AlCl₃/d-gal-induced Alzheimer-like pathology

In the MWM test, the escape latency reflects the spatial learning progress. The escape latency was increased in AlCl₃/d-gal during 2^nd, 3^rd, and 4^th days of acquisition phase test by 258.18%, 314.57% and 197.35%, respectively, with respect to normal control group. Also, in overcrowded group, administration of AlCl₃/d-gal to mice resulted in a marked elevation in escape latency during 2^nd, 3^rd, and 4^th days of acquisition phase test by 325.94%, 711.83% and 318.19%, respectively, with respect to normal control group (Fig 2 a). As shown in Fig (2 a), treatment with testosterone-induced a prominent decrease in the escape latency during 2^nd, 3^rd, and 4^th days of acquisition phase test by 30.18%, 28.96% and 40.58%, respectively, with respect to AlCl₃/d-gal-intoxicated group. Similarly, treatment with testosterone reduced escape latency during 2^nd, 3^rd, and 4^th days of acquisition phase test by 34.09%, 52.1% and 41.57%, respectively, with respect to AlCl₃/d-gal-intoxicated group exposed to overcrowding (Fig 2 a).

Effects of testosterone on MWM test in probe test in mice subjected to AlCl₃/d-gal-induced Alzheimer-like pathology

As illustrated in Fig (2b), AlCl₃/d-gal administration to mice exhibited a lower index of retrieval, which manifested as less time spent in target quadrant in MWM test by 50.24% with respect to normal control group. In the same context, administration of AlCl₃/d-gal to overcrowded mice reduced the time spent in target quadrant in MWM test by 74.89% with respect to normal control group (Fig 2 b). While, treatment with testosterone-induced substantial increase in time spent in target quadrant in MWM test by 40.19% with respect to AlCl₃/d-gal-intoxicated group (Fig 2b). Moreover, treatment with testosterone resulted in a remarkable elevation in time spent in target quadrant 30.76% with respect to AlCl₃/d-gal-intoxicated group exposed to overcrowding (Fig 2 b).

Effects of testosterone on discrimination index (DI) and preference index (PI) using NOR test in mice subjected to AlCl₃/d-gal-induced Alzheimer-like pathology

The NOR test revealed that AlCl₃/d-gal impaired non-spatial memory quantified by the DI and PI which were reduced by 276.92% and 33.92% respectively, with respect to normal control group (Fig 2 c, d). Fig (2 c, d) illustrated that administration of AlCl₃/d-gal to overcrowded mice induced a significant decrease in DI and PI in NOR test by 576.92% and 75% respectively, with respect to normal control group. However, treatment with testosterone significantly increased the DI and PI in NOR test by 300% and 91.89% respectively, with respect to AlCl₃/d-gal-intoxicated group (Fig 2 c, d). Likewise, treatment with testosterone significantly increased DI and PI in NOR test by 162.9% and 85.71% respectively, with respect to AlCl₃/d-gal-intoxicated group exposed to overcrowding (Fig 2 c, d).

Effects of testosterone on total arm entries (TAE) spontaneous alternation percentage (SAP) using Y-maze test in mice subjected to AlCl₃/d-gal-induced Alzheimer-like pathology

As clarified in Fig (2 e, f), administration of AlCl₃/d-gal to mice induced a significant decrease in TAE and SAP in Y-maze test by 43.11% and 24.33%, respectively with respect to normal control group. Furthermore, administration of AlCl₃/d-gal to overcrowded mice induced a significant decrease in TAE and SAP in Y-maze test by 81.89% and 49.05%, respectively, with respect to normal control group (Fig 2 e, f). On the contrary, treatment with testosterone significantly increased TAE and SAP in Y-maze test by 64.41% and 22.63% with respect to AlCl₃/d-gal-intoxicated group (Fig 2 e, f). In the same manner, treatment with testosterone significantly increased TAE and SAP in Y-maze test by 57.14% and 17.65%, respectively with respect to AlCl₃/d-gal-intoxicated group exposed to overcrowding (Fig 2 e, f).

Effects of testosterone on the chosen biochemical parameters

Effects of testosterone on hippocampal and cortical amyloid-beta (Aβ), p-^(ser404) Tau expression and brain-derived neurotrophic factor (BDNF) content in mice subjected to AlCl₃/d-gal-induced Alzheimer-like pathology

Fig (3 a, b and c) illustrated that induction of Alzheimer-like pathology by administration of AlCl₃/d-gal to mice caused a marked increment in hippocampal and cortical Aβ content and p-^(ser404) tau expression by 105.04%, 522.77% and decreased BDNF content by 56.74%, with respect to normal control group. Furthermore, administration of AlCl₃/d-gal to overcrowded mice resulted in increased hippocampal and cortical Aβ content and p- ^(ser404) tau expression by 183.8% and 736.63% and decreased BDNF content by 67.82%, respectively with respect to normal control group. As shown in Fig (3 a, b and c), treatment with testosterone was associated with a significant diminution of hippocampal and cortical Aβ content and p-^(ser404) tau expression by 38.67% and 51.83% and elevation of BDNF content by 101.8%, with respect to normal control group. In the same context, treatment of overcrowded mice with testosterone was associated with a significant diminution of hippocampal and cortical Aβ content and p- ^(ser404) tau expression by 40.44% and 54.32% and increased BDNF content by 79.88%, with respect to normal control group (Fig 3 a, b and c).

Effects of testosterone on hippocampal and cortical phosphorylated glycogen synthase kinase-3 beta (p-^(ser9)GSK-3β), phosphatidylinositol-3-kinase (p-^{(Tyr458-199)-}PI3K) protein expressions and protein kinase B (p-Akt) content in mice subjected to AlCl₃/d-gal-induced Alzheimer-like pathology

Fig (4 a, b and c) clarified that induction of Alzheimer-like symptoms by administration of AlCl₃/d-gal to mice distinctly mitigated the hippocampal and cortical expression of p-^(ser9)GSK-3β, p-^{(Tyr458-199)-}PI3K and p-Akt content by 68.32%, 84.15% and 66.27%, respectively with respect to normal control group. Also, administration of AlCl₃/d-gal to overcrowded mice resulted in a decreased hippocampal and cortical p-^(ser9)GSK-3β, p-^{(Tyr458-199)-}PI3K expression and p-AKT content by 81.11%, 89.1% and 63.64%, respectively with respect to normal control group (Fig 4 a, b and c). As illustrated in Fig (4 a, b and c), treatment with testosterone was associated with a significant elevation in hippocampal and cortical p-^(ser9)GSK-3β, p-^{(Tyr458-199)-}PI3K expression and p-Akt content by 125%, 350% and 111.06%, respectively with respect to AlCl₃/d-gal control group. In addition, treatment of overcrowded mice with testosterone was associated with a significant increase of hippocampal and cortical p-^(ser9)GSK-3β, p-^{(Tyr458-199)-}PI3K expression and p-AKT content by 563.63%, 372.72% and 115.71%, respectively with respect to AlCl₃/d-gal control group (Fig 4 a, b and c).

Effects of testosterone on hippocampal and cortical reduced glutathione (GSH), malondialdehyde (MDA) contents and nicotinamide adenine dinucleotide phosphate oxidase-1 (NOX-1) gene expression in mice subjected to AlCl₃/d-gal-induced Alzheimer-like pathology

As shown in Fig (5 a, b and c), administration of AlCl₃/d-gal for 40 days to mice was accompanied by a significant decrease in hippocampal and cortical GSH content by 45.81% and a significant increase in hippocampal and cortical MDA content and NOX-1 gene expression by 240.34% and 711.88%, respectively with respect to normal control group. Also, in overcrowded group, administration of AlCl₃/d-gal induced a significant decrease in hippocampal and cortical content of GSH by 53.87% and a significant increase in hippocampal and cortical MDA content and NOX-1 gene expression by 603.05% and 949.5%, respectively with respect to normal control group (Fig 5 a, b and c). Conversely, treatment with testosterone produced a further prominent elevation in hippocampal and cortical content of GSH by 63.7% and decreased hippocampal and cortical MDA content and NOX-1 gene expression by 35.79 % and 60.98%, respectively with respect to AlCl₃/d-gal-intoxicated group (Fig 5 a, b and c). In the same manner, treatment of overcrowded mice with testosterone significantly increased hippocampal and cortical content of GSH content by 57.25% and decreased hippocampal and cortical MDA content and NOX-1 gene expression by 56.37% and 62.83%, respectively with respect to AlCl₃/d-gal control group (Fig 5 a, b and c).

Effects of testosterone on hippocampal and cortical content of nuclear factor erythroid 2-related factor 2 (Nrf2), heme oxygenase 1 (HO-1) and cAMP response element binding protein (CREB) in mice subjected to AlCl₃/d-gal-induced Alzheimer-like pathology

Fig (6 a, b and c) illustrated that induction of Alzheimer-like pathology by administration of AlCl₃/d-gal was associated with a significant diminution in hippocampal and cortical content of Nrf2, HO-1 and CREB by 58.77 %, 65.41% and 73.84%, respectively with respect to normal control group (Fig 6 a, b and c). Likewise, administration of AlCl₃/d-gal to overcrowded mice resulted in decreased hippocampal and cortical content of Nrf2, HO-1 and CREB by 74.29%, 78.34% and 82.57%, respectively with respect to normal control group. Fig (6 a, b and c) clarified that treatment with testosterone was associated with an obvious elevation in hippocampal and cortical content of Nrf2, HO-1 and CREB by 87.69%, 136.28% and 74.81%, respectively with respect to AlCl₃/d-gal control group. Similarly, treatment of overcrowded mice with testosterone was associated with significant elevation of hippocampal and cortical content of Nrf2, HO-1 and CREB by 81.46%, 125.29% and 51.25%, respectively with respect to AlCl₃/d-gal control group (Fig 6 a, b and c).

Effects of testosterone on hippocampal and cortical content of tumor necrosis factor-alpha (TNF-α), interleukin-1 beta (IL-1β) and p38 mitogen-activated protein kinases (P38 MAPK) in mice subjected to AlCl₃/d-gal-induced Alzheimer-like pathology

As shown in Fig (7 a, b and c), induction of Alzheimer-like pathology by administration of AlCl₃/d-gal to mice aggravated inflammatory states as reflected by prominent elevation in hippocampal and cortical content of TNF-α, IL-1β and p38 MAPK by 341.52%, 112.1% and 440.08% respectively with respect to normal control group. Moreover, administration of AlCl₃/d-gal to overcrowded mice resulted in increased hippocampal and cortical content of TNF-α, IL-1β and p38 MAPK by 531.38%, 218.28% and 594.26%, respectively with respect to normal control group (Fig 7 a, b and c). In contrast, treatment with testosterone blunted the elevated hippocampal and cortical content of TNF-α, IL-1β and p38 MAPK by 55.66%, 42.21% and 58.27%, respectively with respect to AlCl₃/d-gal control group (Fig 7 a, b and c). Similarly, treatment of overcrowded mice with testosterone showed a marked decrease in hippocampal and cortical content of TNF-α, IL-1β and p38 MAPK by 59.25%, 48.63% and 61.74%, respectively with respect to AlCl₃/d-gal control group (Fig 7 a, b and c).

Effects of testosterone on hippocampal and cortical content of caspase-3 in mice subjected to AlCl₃/d-gal-induced Alzheimer-like pathology

Fig (8) showed that induction of Alzheimer-like pathology by administration of AlCl₃/d-gal to mice resulted in decreased hippocampal and cortical content of caspase-3 by 381.51% with respect to normal control group. Likewise, administration of AlCl₃/d-gal to overcrowded mice resulted in decreased hippocampal and cortical content of caspase-3 by 596.57% with respect to normal control group (Fig 8). As clarified in Fig (8), treatment with testosterone was associated with significant elevation of hippocampal and cortical content of caspase-3 by 58.75% with respect to AlCl₃/d-gal control group. Moreover, treatment of overcrowded mice with testosterone was associated with a significant elevation of hippocampal and cortical content of caspase-3 by 62.73% with respect to AlCl₃/d-gal control group (Fig 8).

Correlation analysis

Correlation analysis between Aβ and behaviour results

Correlation analysis between Aβ and behaviour results in testosterone-treated mice

Solid negative correlation between Aβ and time spent in the target quadrant, SAP, TAE, DI and PI was detected as shown (Fig 9 a, b, c, d and e, r = - 0.83, -0.86, - 0.83, -0.82 and - 0.83; respectively, p < 0.0001).

Correlation analysis between Aβ and behaviours results in testosterone-treated mice

Solid positive correlation between Aβ and oxidative stress biomarkers (MDA and NOX-1) was detected as shown (Fig 10 a, b, r = 0.95 and r = 0.93; respectively, p < 0.0001), inflammatory biomarkers (TNF-α, IL-1β and P38 MAPK) was detected as shown (Fig 10 c, d and e, r = 0.97, r = 0.97 and r = 0.95 respectively, p < 0.0001), tau was detected as shown (Fig 10 f, r = 0.97, p < 0.0001) and apoptotic biomarker (caspase-3) (Fig 10 g, r = 0.94, p < 0.0001). However, there was a solid negative correlation between Aβ and GSH (Fig 10 h, r = - 0.94, p < 0.0001), Nrf2 and HO-1 (Fig 10 i, j, r = - 0.90 and r = - 0.92, respectively, p < 0.0001), BDNF and CREB was detected as shown (Fig 10 K and L, r = - 0.93 and r = - 0.87, p < 0.0001) and GSK-3β, PI3K and AKT (Fig 10 m, n and o, r = - 0.94, r = - 0.91 and r = - 0.80 respectively, p < 0.0001).

Histopathological examination of brain tissue

Histopathological examination of hippocampus and cortex in mice using hematoxylin and eosin (H & E) staining

Histopathological examination of brain sections of mice from normal control group showed normal structure of both cerebral cortex (Fig 11 a) and hippocampus (Fig 11 b). Histopathological examination of brain sections of mice that received AlCl₃/d-gal followed by d-gal exhibited marked histopathological changes in both cerebral cortex and hippocampus. The cerebral cortex showed focal areas of malacia with gliosis (Fig 11 c). Hippocampus revealed dark degenerating neurons (Fig 11 d). While overcrowded mice showed variable histopathological changes in both cerebral cortex and hippocampus. The cerebral cortex showed cocal areas of malacia with gliosis accompanied by vasculitis (Fig 11 e). Hippocampus revealed dark degenerating neurons (Fig 11 f). Histopathological examination of brain sections of mice treated with a single dose of testosterone intoxicated by AlCl₃/d-gal showed absence of histopathological changes in cerebral cortex (Fig 11 g) and the hippocampus exhibited normal CA1 region (Fig 11 h). Histopathological examination of brain of overcrowded mice treated with testosterone-intoxicated by AlCl₃/d-gal showed numerous degenerated neurons in the cerebral cortex (Fig 11 i) and hippocampus revealed normal CA1 region (Fig 11 j). Regarding the pyknosis and degeneration score in both cerebral cortex and hippocampus (Fig 12), in comparison with AlCl₃/d-gal group, testosterone-treated groups showed significant reduction in pyknosis and degeneration score.

Histopathological examination of hippocampus and cortex in mice using Nissl staining

Histopathological examination of Nissl-stained sections from normal control group revealed normal lightly stained neurons in cerebral cortex (Fig 13 a) and different regions of hippocampus (Fig 13 b). Histopathological examination of Nissl-stained sections of mice received AlCl₃/d-gal exhibited numerous dark neurons in different regions in cerebral cortex (Fig 13 c), and CA3 and CA4 regions of hippocampus (Fig 13 d). Histopathological examination of Nissl-stained sections of overcrowded mice received AlCl₃/d-gal revealed numerous dark neurons in the cerebral cortex (Fig 13 e). Dark neurons were markedly detected (Fig 13 f). Histopathological examination of Nissl-stained sections of mice treated with testosterone intoxicated by AlCl₃/d-gal showed an apparently normal cerebral cortex (Fig 13 g) and few dark degenerating neurons in CA1 region of hippocampus was also observed (Fig 13 h). Histopathological examination of Nissl-stained of brain sections of overcrowded mice treated with testosterone intoxicated by AlCl₃/d-gal showed improvement that revealed an increased number of dark neurons in the cerebral cortex (Fig 13 i) and apparently normal different hippocampus areas (Fig 13 j). Concerning the estimated neuronal survival rate in cerebral cortex and hippocampus (Fig 14) in comparison with AlCl₃/d-gal-intoxicated group, testosterone-treated groups showed significant elevation in the estimated neuronal survival rate.

Glial fibrillary acidic protein (GFAP) examination

Examination of GFAP expression was conducted in different groups. Lower expression was determined in control group. Meanwhile, a significant increase in AlCl₃/d-gal group compared to other experimental groups. Also, a significant increase in GFAP in AlCl₃/d-gal overcrowded group compared to other experimental groups. Testosterone-treated group showed moderate GFAP expression in the cerebral cortex (Fig 15) and hippocampus (Fig 15). Overcrowded mice from testosterone-treated group showed moderate GFAP expression in the cerebral cortex (Fig 15) and hippocampus (Fig 15). Fig (16) illustrated Effect of testosterone on the histological score of the GFAP.

In the present investigation, the mechanisms underlying the neuroprotective effect of testosterone on AlCl₃/d-gal-induced Alzheimer-like disease in overcrowded mice were investigated. In this study, non-overcrowded mice and over-crowded mice were intoxicated by AlCl₃/d-gal, and treated with testosterone. The intoxication groups resulted in bad performance in behaviour tests. Also, it illustrated an elevation in oxidative stress and inflammatory biomarkers. Treatment with testosterone resulted in better improvement in behaviour study. Also, treatment with testosterone reduced oxidative stress such as MDA and NOX-1 and inflammatory biomarkers like TNF-α, IL-1β and P38 MAPK. In addition, a significant increase was illustrated in GFAP in AlCl₃/d-gal and AlCl₃/d-gal overcrowded groups. Testosterone in both overcrowded and non-overcrowded groups showed moderate GFAP expression in the cerebral cortex and hippocampus. Moreover, testosterone elevated Nrf2, HO-1, GSK-3β, PI3K and Akt levels, also, testosterone elevated CREB, BDNF, and GSH and marked reduction in Aβ, Tau and caspase-3. In the present investigation, the mechanisms underlying neuroprotective effect of testosterone on AlCl₃/d-gal-induced Alzheimer-like disease in overcrowded mice were investigated. In this study, non-overcrowded mice and over-crowded mice were intoxicated by AlCl₃/d-gal, and treated with testosterone. The intoxication groups resulted in bad performance in behaviour tests. Also, it illustrated an elevation in oxidative stress and inflammatory biomarkers. Treatment with testosterone resulted in better improvement in behaviour study. Also, treatment with testosterone reduced oxidative stress such as MDA and NOX-1 and inflammatory biomarkers like TNF-α, IL-1β and P38 MAPK. In addition, a significant increase was illustrated in GFAP in AlCl₃/d-gal and AlCl₃/d-gal overcrowded groups. Testosterone in both overcrowded and non-overcrowded groups showed moderate GFAP expression in the cerebral cortex and hippocampus. Moreover, testosterone elevated Nrf2, HO-1, GSK-3β, PI3K and Akt levels, also, testosterone elevated CREB, BDNF, and GSH and marked reduction in Aβ, Tau and caspase-3. In mice, AlCl₃/d-gal administration diminished memory performance in the MWM, Y-maze test and NOR tests. Similar results were previously reported (Elfouly et al. 2021). In contrast, mice treated with a single dose of testosterone undecanoate improved their spatial learning and memory in MWM, Y-maze, and NOR tests when compared to overcrowded groups. Similar results were reported where treatment with testosterone was shown to enhance spatial memory (Elfouly et al. 2021).

Androgen receptors (ARs) are involved in memory and learning. As the AR antagonist flutamide obviously inhibited testosterone effects on improving cognitive deficits in SAMP8 mice (Jian-xin et al. 2015), data suggested that the testosterone's neuroprotective effects on cognitive function may be mediated by direct binding to specific AR (Spritzer and Galea 2007).

The MWM test is widely used to assess animals' long-term and spatial/working memory performance. In the exploratory experiment, spatial memory retention is measured by the time spent in the target quadrant and the number of crossings in the target quadrant (Haider et al. 2020). The Y-maze place recognition tasks were used to assess spatial memory. A decline in spatial memory was accompanied with disrupted hippocampus-dependent functions, and these features are a primary feature of the cognitive impairments observed in AD patients. The Y-maze test is a behavioral study that depends on working memory alteration (Borbély et al. 2019). NOR has been comprehensively used for determining alterations in cognitive functions as it can measure preference of novelty in rodents. The preference of novel object could indicate the presence of a familiar object presentation in a rat's memory (Haider et al. 2020).

In the present study, administration of AlCl₃/d-gal reinforced hippocampal and cortical Aβ42 content, p-tau protein expression and BDNF in overcrowded groups. The current study's findings on Aβ content and tau protein expression are consistent with those of other researchers (Song et al. 2022). In the same context, testosterone undecanoate prevented the increase in Aβ42 content and p-tau protein expression caused by an overcrowded AlCl₃/d-gal group. Our findings are supported by the work of Yao et al. (2022).

Androgens may help slow the progression of AD. In male AD mouse models, gonadectomy increased Aβ levels while androgens significantly inhibited Aβ accumulation. By directly activating the androgen receptor, testosterone treatment of gonadectomized 3xTg-AD mice prevented the increase of Aβ accumulation in several brain regions and reduced tau hyperphosphorylation in the CA1 hippocampus (Rosario et al. 2012). Tau hyperphosphorylation is one of the downstream mechanisms of Aβ neurotoxicity (Wang et al. 2016a). Tau protein hyperphosphorylation increases tau protein resistance to proteolysis and the formation of insoluble paired helical filaments that deposit as NFTs. Furthermore, hyper-phosphorylation inhibits tau protein binding to microtubules, resulting in microtubule destabilization, axonal transport impairment, and, eventually, neuronal death (Esmaeli-Azad et al. 1994).

In the current study, AlCl₃/d-gal administration to mice decreased hippocampal and cortical content of BDNF compared to the overcrowded group. These findings are consistent with Labban et al. (2021). However, administration of testosterone undecanoate reversed AlCl₃/d-gal effects. This finding regarding BDNF is in agreement with previous research by Jia et al. (2016). BDNF is a crucial molecule involved in synaptic plasticity, learning and memory, and neurogenesis. BDNF signaling can stimulate long-term potentiation of hippocampal synapses and enhance spatial memory. Reduction in BDNF expression level had been reported in AD, especially in brain areas important for learning and memory, such as the hippocampus (Bali et al., 2017).

In the current study, administration of AlCl₃/d-gal to mice promoted the hippocampal and cortical homogenate GSK-3β, PI3K protein expression and Akt content in the mice when compared to overcrowded groups. Similar results were reported by other studies Zameer et al. (2021). Meanwhile, administration of testosterone undecanoate reversed AlCl₃/d-gal effects. This is in agreement with Chen et al. (2019). To the best of our knowledge, no previous studies about the effect of testosterone on Akt were performed and the results of the present study are the first report. GSK-3β is a constitutive proline-directed serine threonine kinase actively involved in a distinct range of physiological processes such as gene transcription and has also been identified to play a pivotal role in sporadic as well as familial AD (Maqbool et al. 2016). The PI3K/Akt pathway has a pivotal role in neuronal survival. Activation of such pathway leads to inhibition of NF-κB and subsequently, all its downstream pro-inflammatory cytokine cascade such as TNF-α (Athauda and Foltynie 2016).

In the present study, administration of AlCl₃/d-gal resulted in oxidative damage as manifested by a massive increase in hippocampal and cortical homogenate MDA content and NOX-1 gene expression as well as a marked decline in the hippocampal and cortical homogenate content of GSH when compared to overcrowded groups. The results of the current study are in accordance with previous report (Hu et al. 2022). Also, Cui et al. (2020) illustrated that AlCl₃ treatment significantly increased MDA content in stressed rats. However, treatment with testosterone undecanoate reversed the AlCl₃/d-gal effects. Results concerning MDA and GSH are in accordance with previous study Yan et al. (2019). Aβ pathology was found to increase ROS levels, which in turn produced more Aβ (Leuner et al. 2012). The significance of these findings implies that AlCl₃ can cause increased oxidative stress and neuronal injury, as well as a decrease in antioxidative defense mechanisms, making the brain more vulnerable to future oxidative insults (Shunan et al. 2021). Glutathione is the most abundant sulfhydryl-containing compound in cells and the brain's most important cellular free radical scavenger (Wood et al. 2004). Decreased GSH content has been reported in brain of patients suffering from a number of neurological diseases, thereby linking GSH depletion by free radicals in the pathogenesis of these ailments (Sian et al. 1994).

Concerning the results of hippocampal NOX-1, Mansour et al. (2021) reported that rats exposed to d-gal/OVX exhibited increased activation of the hippocampal gene expression of NOX-1. To the best of our knowledge, no previous studies about the effect of AlCl₃/d-gal and testosterone on NOX-1 was performed and the results of the present study are the first report. Oxidative stress, specifically that caused by NOX induction, has been linked to the development of AD (Bedard and Krause 2007). NOX enzyme activity is strongly linked with cognitive performance, such that increases in NOX enzyme activity reduce cognitive function (Ansari and Scheff 2011). NOX induction causes an increase in Aβ levels (Bruce-Keller et al. 2010). Qin et al. (2002) demonstrated that microglia mediated Aβ-induced neurotoxicity by inducing NOX.

In the present investigation, AlCl₃/d-gal administration to mice curbed the hippocampal and cortical homogenate Nrf2, HO-1 and CREB contents in comparison to overcrowded groups. The present findings regarding Nrf2 and HO-1, find support in the work of Song et al. (2022). While, treatment with testosterone undecanoate produced an antioxidant effect as manifested by reinforcement the Nrf2 and HO-1 when compared to overcrowded AlCl₃/d-gal group. The findings are consistent with previous research by Zhang et al. (2019). Nrf-2 functions as a sensitive sensor that regulates the constitutive and inducible expression of phase II detoxification and antioxidant enzymes in cells to maintain cellular redox homeostasis and improve the oxidative state of the body (Vomund et al. 2017). Nrf2 reduced phosphorylated tau protein levels (Jo et al. 2014). The activation of Nrf2/HO-1 pathway diminished Aβ-induced neurotoxicity in cell lines (Wang et al. 2016b) and animal models (Ali et al. 2018). Nuclear factor-B (NF-B) has also been shown to co-transport into nuclei with Keap1 in relation to trapping Nrf2. Alternatively, Nrf2 could suppress inflammatory pathways by activating anti-inflammatory mediators (e.g., interleukin 10 (IL-10)) and inhibiting inflammatory mediators (TNF-, IL-6, IL-1) (Saha et al. 2020).

In the current study, AlCl₃/d-gal administration to mice decreased hippocampal and cortical content of CREB as compared to the overcrowded group. These findings are consistent with Labban et al. (2021). However, testosterone undecanoate administration to mice reversed this effect. This finding concerning CREB is in agreement with a previous study (Ibrahim et al. 2020).

CREB (cAMP response element binding protein) is a critical nuclear transcription factor that regulates BDNF transcription. A decrease in CREB phosphorylation results in a decrease in BDNF levels, which leads to working memory dysfunction (Bavithra et al. 2015). CREB is also a component of the intracellular signaling that regulates the circadian rhythms of long-term memory effectors in the hippocampus. However, CREB expression levels decline with age and in some neurodegenerative diseases such as AD (Bae et al. 2019).

In the current study, administration of AlCl₃/d-gal to mice enhanced hippocampal and cortical homogenate content of TNF-α, IL-1β and p38 MAPK when compared to overcrowded groups. Results regarding TNF-α and IL-1β, support the work of Pelegrin et al. (2023). In line with Chin and Ima-Nirwana (2017), treatment with testosterone undecanoate in the current study exerted a significant anti-inflammatory effect as manifested by the reduction of the elevated the hippocampal and cortical content of TNF-α, IL-1β and p38 MAPK when compared to overcrowded AlCl₃/d-gal group.

In addition, Aβ development may account for the observed elevation of hippocampal TNF-α (Medeiros et al. 2007). Aβ plaques stimulate a chronic inflammatory reaction by upregulating and activating microglia and astrocytes in the hippocampus which act like inflammatory cells by releasing pro-inflammatory cytokine, including TNF-α and IL-6 (González-Reyes et al. 2017). P38 MAPK is a stress-activated kinase that is also thought to be the most important regulator of Aβ-induced toxicity, neuroinflammation, and cytokine overproduction. Activation of the p38 MAPK signaling pathway is linked to neuronal death or apoptosis, which is thought to be the root cause of cognitive dysfunction (Kheiri et al. 2018).

Administration of AlCl₃/d-gal to mice resulted in a significant increase in hippocampal and cortical homogenate caspase-3 content in the mice when compared to the overcrowded group. The current study's findings on caspase-3 content are consistent with Liu et al. (2022). In contrast, our study showed that testosterone undecanoate treatment decreased caspase-3 content in mice when compared to the overcrowded AlCl₃/d-gal group as previously reported (Muthu and Seppan 2021).

Caspase-3 is the main initiator of apoptosis and its activation is closely linked to the pathogenesis of AD. Li et al. (2016) hypothesized that inhibiting caspase activity may lessen Aβ generation and inhibit the cell apoptosis in AD.

In the current study, there was strong negative correlation between Aβ and behavioural tests mentioned in this investigation. Also, there was a strong negative correlation between Aβ and GSH, Nrf2 and HO-1, BDNF and CREB, GSK-3β, PI3K, but weak correlation with AKT was found. In contrast, strong positive correlation was found between Aβ and oxidative stress biomarkers (MDA and NOX-1), inflammatory biomarkers (TNF-α, IL-1β and P38 MAPK), tau and apoptotic biomarker (caspase-3).

One study reported found a correlation between the accumulation of Aβ1–42 peptides in the brains of rats and cognitive decline (Saviano et al. 2021). Several studies have indicated a positive correlation between improved cognitive performance and elevated serum testosterone levels (Driscoll et al. 2005; Jia et al. 2013; Jian-xin et al. 2015).

These results confirmed that testosterone displayed a potent neuroprotective, anti-inflammatory, anti-apoptotic and antioxidant activities against AlCl₃/d-gal-induce Alzheimer’s like symptom in overcrowded mice.

In the present study, the biochemical evidence of neurotoxicity, inflammation and oxidative stress were in corroboration with the histopathological findings. The cerebral cortex showed focal areas of malacia with gliosis accompanied by vasculitis. The different regions of hippocampus revealed dark degenerating neurons especially in CA3 region. Regarding Nissl staining, AlCl₃/d-gal group, the cerebral cortex revealed numerous dark neurons. Dark neurons were markedly detected in CA3 of the hippocampus. However, treatment with testosterone ameliorated AlCl₃/d-gal-induced neurodegeneration, but it failed to restore the histopathological picture observed in normal control group. Section stained by Nissl showed moderate improvement in testosterone-treated mice.

In the present investigation, administration of AlCl₃/d-gal increased GFAP immunoreactivity in overcrowded mice. In this study, treatment with testosterone decreased GFAP immunoreactivity points to the inactivation of astrocytes that confirmed the antioxidant/anti-inflammatory effect of testosterone. Results concerning GFAP are in agreement with previous researches which reported that administration of AlCl₃/d-gal resulted in a significant increase in GFAP (Mahdi et al. 2021; Zhao et al. 2022; Zakaria et al. 2024). Accordingly, this is the first study that conducted the GFAP with treatment of testosterone and the results of the present study are the first report.

In summary, the current research reveals that treatment with testosterone can ameliorate cognitive dysfunction and decrease Aβ1–42 and p-tau accumulation by regulating P38-MAPK in AlCl₃/d-gal-intoxicated mice. Furthermore, testosterone increased the pro-survival pathway PI3K/Akt and inhibited the neuroinflammatory pathway via inhibition of NOX-1 and TNF-α. Although testosterone exerted neuroprotective effect in several AlCl₃/d-gal models of AD, through multiple attractive mechanisms, several issues remain to be rectified, such as the efficacy of testosterone in other AD models, such as amyloid/p-tau bearing rodents.

Acknowledgements

The authors of the manuscript acknowledge Prof. Dr. Laila Rashed, Department of Biochemistry, Faculty of Medicine, Cairo University for the effort in quantitative real-time PCR. The authors are also grateful to Prof. Dr. Mohamed Refaat, Department of Pathology, Faculty of Veterinary Medicine, Cairo University, for his effort in performing the histological and immunohistochemical staining examinations.

Author contributions

Shaimaa Rabie: Writing – original draft, Methodology, Investigation, Formal analysis, Data curation, Conceptualization. Micheal K. Ibrahim: Conceptualization, Methodology, Validation, Writing – review & editing, Supervision. Hala F. Zaki: Conceptualization, Methodology, Validation, Writing – review & editing, Supervision. Helmy M. Said: Conceptualization, Methodology, Validation, Writing – review & editing, Supervision. All authors contributed to and have approved the final manuscript. All authors have read the journal's authorship statement and agree to it. In accordance with your journal's policy, we confirm that the material contained in the manuscript is original, has not been published and is not being submitted elsewhere. This manuscript is being submitted online in accordance with your policies for this type of submission.

Funding

Open access funding is provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB). This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Data availability

Data are available from the corresponding author upon reasonable request.

Conflict of interest

The authors declare that there is no conflict of interest.

Ethical approval

All procedures were approved by the institutional ethics committee for the care and use of animals. Animal handling and experimental protocols were approved by the Research Ethics Committee of Faculty of Pharmacy, Cairo University (approval number: PT 2862). Additionally, the study was carried out in accordance with ARRIVE guidelines and carried out according to the National Research Council’s Guide for the Care and Use of Laboratory Animals.

Open Access

This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http:// creat iveco mmons. org/ licen ses/ by/4. 0/.

Ago Y, Tanaka T, Ota Y et al )2014( Social crowding in the night-time reduces an anxiety-like behavior and increases social interaction in adolescent mice. Behav Brain Res 270: 37-46. https://doi.org/10.1016/j.bbr.2014.04.047
Ali T, Kim T, Rehman SU et al )2018( Natural dietary supplementation of anthocyanins via PI3K/Akt/Nrf2/HO-1 pathways mitigate oxidative stress, neurodegeneration, and memory impairment in a mouse model of Alzheimer’s disease. Mol Neurobiol 55: 6076-6093. https://doi.org/10.1007/s12035-017-0798-6
Ansari MA, Scheff SW (2011) NADPH-oxidase activation and cognition in Alzheimer disease progression. Free Radic Biol Med 51(1): 171-178. https://doi.org/10.1016/j.freeradbiomed.2011.03.025
Athauda D, Foltynie T (2016) The glucagon-like peptide 1 (GLP) receptor as a therapeutic target in Parkinson's disease: mechanisms of action. Drug Discov Today 21(5): 802-818. https://doi.org/10.1016/j.drudis.2016.01.013
Attia HN, Ahmed KA (2020) Protective role of functional food in cognitive deficit in young and senile rats. Behav Pharmacol 31(1): 81-96. https://doi.org/10.1097/FBP.0000000000000522
Bae HJ, Sowndhararajan K, Park HB et al (2019) Danshensu attenuates scopolamine and amyloid-β-induced cognitive impairments through the activation of PKA-CREB signaling in mice. Neurochem Int 131: 104537. https://doi.org/10.1016/j.neuint.2019.104537
Bahaa El-Dein IM, Mohamed FA, Ahmed MA et al (2020) Sex Differences in Metabolic Responses to Chronic Immobilization Stress in Rats. Bull of Egyp Soc Physiol Sci 40(1): 148-165. https://doi.org/10.21608/BESPS.2019.18674.1036
Bali P, Lahiri D, Banik A et al (2017) Potential for stem cells therapy in Alzheimer’s disease: do neurotrophic factors play critical role? Curr. Alzheimer Res 14(2): 208-220. https://doi.org/10.2174/1567205013666160314145347
Bancroft JD, Gamble M (2008) Theory and practice of histological techniques. 6th Edition, Churchill Livingstone, China.
Bavithra S, Sugantha Priya E, Selvakumar K et al (2015) Effect of melatonin on glutamate: BDNF signaling in the cerebral cortex of polychlorinated biphenyls (PCBs)—exposed adult male rats. Neurochem Res 40: 1858-1869. https://doi.org/10.1007/s11064-015-1677-z
Bedard K, Krause KH (2007) The NOX family of ROS-generating NADPH oxidases: physiology and pathophysiology. Physiol Rev 87(1): 245-313. https://doi.org/10.1152/physrev.00044.2005
Beutler E, Duron O, Kelly BM (1963) Improved method for determination of blood glutathione. J Lab Clin Med: 61:882-8.
Borbély É, Payrits M, Hunyady Á et al (2019) Important regulatory function of transient receptor potential ankyrin 1 receptors in age-related learning and memory alterations of mice. Geroscience 41: 643-654. https://doi.org/10.1007/s11357-019-00083-1
Bruce-Keller AJ, Gupta S, Parrino TE, et al (2010) NOX activity is increased in mild cognitive impairment. Antioxid Redox Signal 12(12): 1371-1382. https://doi.org/10.1089/ars.2009.2823
Carroll JC, Iba M, Bangasser DA et al (2011) Chronic stress exacerbates tau pathology, neurodegeneration, and cognitive performance through a corticotropin-releasing factor receptor-dependent mechanism in a transgenic mouse model of tauopathy. J Neurosci 31(40): 14436-14449. https://doi.org/10.1523/JNEUROSCI.3836-11.2011
Chen FF, Song FQ, Chen YQ et al (2019) Exogenous testosterone alleviates cardiac fibrosis and apoptosis via Gas6/Axl pathway in the senescent mice. Exp Gerontol 119: 128-137. https://doi.org/10.1016/j.exger.2019.01.029
Chin KY, Ima-Nirwana S (2017) The effects of testosterone deficiency and its replacement on inflammatory markers in rats: a pilot study. Int J Endocrinol Metab 15(1): e43053. https://doi.org/10.5812/ijem.43053
Cui Y, Che Y, Wang H (2020) Bergamot essential oil attenuate aluminum-induced anxiety-like behavior through antioxidation, anti-inflammatory and GABA regulation in rats. Food ChemToxicol 145: 111766. https://doi.org/10.1016/j.fct.2020.111766
Driscoll I, Hamilton DA, Yeo RA et al (2005) Virtual navigation in humans: the impact of age, sex, and hormones on place learning. Horm Behav 47(3): 326-335. https://doi.org/10.1016/j.yhbeh.2004.11.013
Eid F, Helal EG, Taha NM (2010) Effect of crowding stress and/or sulpiride treatment on some physiological and histological parameters in female albino rats. Egypt J Hosp Med 41(1): 566-589. https://doi.org/10.21608/EJHM.2010.16955
Elfouly A, Awny M, Ibrahim M et al (2021) Effects of Long-Acting Testosterone Undecanoate on Behavioral Parameters and Na+, K+-ATPase mRNA Expression in Mice with Alzheimers Disease. Neurochem Res 46(9): 2238-2248. https://doi.org/10.1007/s11064-021-03357-3
Esmaeli-Azad B, McCarty JH, Feinstein SC (1994) Sense and antisense transfection analysis of tau function: tau influences net microtubule assembly, neurite outgrowth and neuritic stability. J Cell Sci 107(4): 869-879. https://doi.org/10.1242/jcs.107.4.869
González-Reyes RE, Nava-Mesa MO, Vargas-Sánchez K et al (2017) Involvement of astrocytes in Alzheimer’s disease from a neuroinflammatory and oxidative stress perspective. Front Mol Neurosci 10: 427. https://doi.org/10.3389/fnmol.2017.00427
Haider S, Liaquat L, Ahmad S et al (2020) Naringenin protects AlCl₃/D-galactose induced neurotoxicity in rat model of AD via attenuation of acetylcholinesterase levels and inhibition of oxidative stress. Plos one 15(1): e0227631. https://doi.org/10.1371/journal.pone.0227631
Hu Y, Fang X, Wang J et al (2022) Astragalin attenuates AlCl₃/D-galactose-induced aging-like disorders by inhibiting oxidative stress and neuroinflammation. NeuroToxicology 91: 60-68. https://doi.org/10.1016/j.neuro.2022.05.003
Huo DS, Sun JF, Zhang B et al (2016) Protective effects of testosterone on cognitive dysfunction in Alzheimer’s disease model rats induced by oligomeric beta amyloid peptide 1-42. J Toxicol Environ Health 79(19): 856-863. https://doi.org/10.1080/15287394.2016.1193114
Ibrahim MK, Tikamdas R, Kamal M et al (2020) Testosterone Undecanoate effects on behavior and Cognitive Functions in male swiss Albino mice exposed to Chronic Social Defeat. Res J Pharm Technol 13(12): 6041-6049. https://doi.org/10.5958/0974-360X.2020.01053.7
Jaeger EC, Miller LE, Goins EC et al (2020) Testosterone replacement causes dose-dependent improvements in spatial memory among aged male rats. Psychoneuroendocrinology 113: 104550. https://doi.org/10.1016/j.psyneuen.2019.104550
Jia JX, Cui Cl, Yan XS et al (2016) Effects of testosterone on synaptic plasticity mediated by androgen receptors in male SAMP8 mice. J. Toxicol Environ Health, Part A 79(19): 849-855. https://doi.org/10.1080/15287394.2016.1193113
Jia J, Kang L, Li S et al (2013) Amelioratory effects of testosterone treatment on cognitive performance deficits induced by soluble Aβ1–42 oligomers injected into the hippocampus. Horm behav 64(3): 477-486. https://doi.org/10.1016/j.yhbeh.2013.08.002
Jian-xin J, Cheng-li C, Song W et al (2015) Effects of testosterone treatment on synaptic plasticity and behavior in senescence accelerated mice. J Toxicol Environ Health A 78(21-22): 1311-1320. https://doi.org/10.1080/15287394.2015.1085839
Jo C, Gundemir S, Pritchard S et al (2014) Nrf2 reduces levels of phosphorylated tau protein by inducing autophagy adaptor protein NDP52. Nat Commun 5(1): 3496. https://doi.org/10.1038/ncomms4496
Justice NJ (2018) The relationship between stress and Alzheimer's disease. Neurobiol Stress 8: 127-133. https://doi.org/10.1016/j.ynstr.2018.04.002
Kamel AS, Abdelkader NF, Abd El-Rahman SS et al (2018) Stimulation of ACE2/ANG (1–7)/Mas axis by diminazene ameliorates Alzheimer’s disease in the D-galactose-ovariectomized rat model: role of PI3K/Akt pathway. Mol Neurobiol 55: 8188-8202. https://doi.org/10.1007/s12035-018-0966-3
Kang JE, Cirrito JR, Dong H et al (2007) Acute stress increases interstitial fluid amyloid-β via corticotropin-releasing factor and neuronal activity. Proc Natl Acad Sci 104(25): 10673-10678. https://doi.org/10.1073/pnas.0700148104
Kawahara M, Kato-Negishi M (2011) Link between aluminum and the pathogenesis of Alzheimer's disease: the integration of the aluminum and amyloid cascade hypotheses. Int J Alzheimers Dis 2011. https://doi.org/10.4061/2011/276393
Kei S (1978) Serum lipid peroxide in cerebrovascular disorders determined by a new colorimetric method. Clin Chim Acta 90(1): 37-43. https://doi.org/10.1016/0009-8981(78)90081-5
Kheiri G, Dolatshahi M, Rahmani F et al (2018) Role of p38/MAPKs in Alzheimer’s disease: implications for amyloid beta toxicity targeted therapy. Rev Neurosci 30(1): 9-30. https://doi.org/10.1515/revneuro-2018-0008
Kraeuter AK, Guest PC, Sarnyai Z (2019) The Y-maze for assessment of spatial working and reference memory in mice. Methods Mol Biol 2019:1916:105-111. https://doi.org/10.1007/978-1-4939-8994-2_10
Kumar RS, Narayanan SN, Nayak S (2009) Ascorbic acid protects against restraint stress-induced memory deficits in Wistar rats. Clinics 64: 1211-1217. https://doi.org/10.1590/S1807-59322009001200012
Labban S, Alghamdi BS, Alshehri FS et al (2021) Effects of melatonin and resveratrol on recognition memory and passive avoidance performance in a mouse model of Alzheimer’s disease. Behav Brain Res 402: 113100. https://doi.org/10.1016/j.bbr.2020.113100
Leuner K, Schütt T, Kurz C et al (2012) Mitochondrion-derived reactive oxygen species lead to enhanced amyloid beta formation. Antioxid Redox Signal 16(12): 1421-1433. https://doi.org/10.1089/ars.2011.4173
Li H, Kang T, Qi B et al (2016) Neuroprotective effects of ginseng protein on PI3K/Akt signaling pathway in the hippocampus of D-galactose/AlCl₃ inducing rats model of Alzheimer’s disease. J ethnopharmacol 179: 162-169. https://doi.org/10.1016/j.jep.2015.12.020
Li M, Masugi-Tokita M, Takanami K et al (2012) Testosterone has sublayer-specific effects on dendritic spine maturation mediated by BDNF and PSD-95 in pyramidal neurons in the hippocampus CA1 area. Brain Res 1484: 76-84. https://doi.org/10.1016/j.brainres.2012.09.028
Liu Y, Meng X, Sun L et al (2022) Protective effects of hydroxy-α-sanshool from the pericarp of Zanthoxylum bungeanum Maxim. On D-galactose/AlCl₃-induced Alzheimer's disease-like mice via Nrf2/HO-1 signaling pathways. Eur J Pharmacol 914: 174691. https://doi.org/10.1016/j.ejphar.2021.174691
Mahdi O, Chiroma SM, Hidayat Baharuldin MT et al (2021) Win55, 212-2 attenuates cognitive impairments in AlCl₃+ d-galactose-induced alzheimer’s disease rats by enhancing neurogenesis and reversing oxidative stress. Biomedicines 9(9): 1270. https://doi.org/10.3390/biomedicines9091270
Mansour HM, Fawzy HM, El-Khatib AS et al (2021) Lapatinib ditosylate rescues memory impairment in D-galactose/ovariectomized rats: Potential repositioning of an anti-cancer drug for the treatment of Alzheimer's disease. Exp Neurol 341: 113697. https://doi.org/10.1016/j.expneurol.2021.113697
Maqbool M, Mobashir M, Hoda N (2016) Pivotal role of glycogen synthase kinase-3: a therapeutic target for Alzheimer's disease. Eur J Med Chem 107: 63-81. https://doi.org/10.1016/j.ejmech.2015.10.018
Medeiros R, Prediger RD, Passos GF et al (2007) Connecting TNF-α signaling pathways to iNOS expression in a mouse model of Alzheimer's disease: relevance for the behavioral and synaptic deficits induced by amyloid β protein. J Neurosci 27(20): 5394-5404. https://doi.org/10.1523/JNEUROSCI.5047-06.2007
Muthu S, Seppan P (2021) Apoptosis in hippocampal tissue induced by oxidative stress in testosterone deprived male rats. Aging Male: 1-13. https://doi.org/10.1080/13685538.2021.1892625
Pandareesh M, Anand T, Khanum F (2016) Cognition enhancing and neuromodulatory propensity of Bacopa monniera extract against scopolamine induced cognitive impairments in rat hippocampus. Neurochem Res 41: 985-999. https://doi.org/10.1007/s11064-015-1780-1
Pelegrin ÁF, de Paiva Gonçalves V, de Souza Carvalho J et al (2023) Testosterone replacement relieves ligature-induced periodontitis by mitigating inflammation, increasing pro-resolving markers and promoting angiogenesis in rats: A preclinical study. Arch Oral Biol 146: 105605. https://doi.org/10.1016/j.archoralbio.2022.105605
Qin L, Liu Y, Cooper C et al (2002) Microglia enhance β‐amyloid peptide‐induced toxicity in cortical and mesencephalic neurons by producing reactive oxygen species. J Neurochem 83(4): 973-983. https://doi.org/10.1046/j.1471-4159.2002.01210.x
Ramsden M, Shin T, Pike C (2003) Androgens modulate neuronal vulnerability to kainate lesion. Neuroscience 122(3): 573-578. https://doi.org/10.1016/j.neuroscience.2003.08.048
Romeo RD, Staub D, Jasnow AM et al (2005) Dihydrotestosterone increases hippocampal N-methyl-D-aspartate binding but does not affect choline acetyltransferase cell number in the forebrain or choline transporter levels in the CA1 region of adult male rats. Endocrinology 146(4): 2091-2097. https://doi.org/10.1210/en.2004-0886
Rosario ER, Carroll JC, Pike CJ (2012) Evaluation of the effects of testosterone and luteinizing hormone on regulation of β-amyloid in male 3xTg-AD mice. Brain Res 1466: 137-145. https://doi.org/ 10.1016/j.brainres.2012.05.011
Saha S, Buttari B, Panieri E et al (2020) An overview of Nrf2 signaling pathway and its role in inflammation. Molecules 25(22): 5474. https://doi.org/10.3390/molecules25225474
Sakata K, Tokue A, Kawai N (2000) Altered synaptic transmission in the hippocampus of the castrated male mouse is reversed by testosterone replacement. J Urol 163(4): 1333-1338. https://doi.org/10.1016/S0022-5347(05)67773-7
Saviano A, Casillo GM, Raucci F et al (2021) Supplementation with ribonucleotide-based ingredient (Ribodiet®) lessens oxidative stress, brain inflammation, and amyloid pathology in a murine model of Alzheimer. Biomed Pharmacother 139: 111579. https://doi.org/10.1016/j.biopha.2021.111579
Shunan D, Yu M, Guan H et al (2021) Neuroprotective effect of Betalain against AlCl₃-induced Alzheimer's disease in Sprague Dawley Rats via putative modulation of oxidative stress and nuclear factor kappa B (NF-κB) signaling pathway. Biomed Pharmacother 137: 111369. https://doi.org/ 10.1016/j.biopha.2021.111369
Sian J, Dexter DT, Lees AJ et al (1994) Alterations in glutathione levels in Parkinson's disease and other neurodegenerative disorders affecting basal ganglia. Ann Neurol 36(3): 348-355. https://doi.org/ 10.1002/ana.410360305
Song X, Zhao Z, Zhao Y et al (2022) Protective Effects of Bacillus coagulans JA845 against D-Galactose/AlCl₃-Induced Cognitive Decline, Oxidative Stress and Neuroinflammation. J Microbiol Biotechnol. https://doi.org/10.4014/jmb.2111.11031
Spritzer MD, Galea LA (2007) Testosterone and dihydrotestosterone, but not estradiol, enhance survival of new hippocampal neurons in adult male rats. Dev neurobiol 67(10): 1321-1333. https://doi.org/10.1002/dneu.20457
Vlassara H (1994) Pathogenic effects of advanced glycation: biochemical, biologic, and clinical implications for diabetes and aging. Lab invest 70: 138-151.
Vomund S, Schäfer A, Parnham MJ et al (2017) Nrf2, the master regulator of anti-oxidative responses. Int J Mol Sci 18(12): 2772. https://doi.org/ 10.3390/ijms18122772
Vorhees CV, Williams MT (2006) Morris water maze: procedures for assessing spatial and related forms of learning and memory. Nat Protoc 1(2): 848-858. https://doi.org/10.1038/nprot.2006.116
Walton J, Wang MX (2009) APP expression, distribution and accumulation are altered by aluminum in a rodent model for Alzheimer’s disease. J Inorg Biochem 103(11): 1548-1554. https://doi.org/10.1016/j.jinorgbio.2009.07.027
Wang ZX, Tan L, Liu J et al (2016a) The essential role of soluble Aβ oligomers in Alzheimer’s disease. Mol Neurobiol 53: 1905-1924. https://doi.org/10.1007/s12035-015-9143-0
Wang Y, Miao Y, Mir AZ et al (2016b) Inhibition of beta-amyloid-induced neurotoxicity by pinocembrin through Nrf2/HO-1 pathway in SH-SY5Y cells. J Neurol Sci 368: 223-230. https://doi.org/10.1016/j.jns.2016.07.010
Wei H, Li L, Song Q et al (2005) Behavioural study of the D-galactose induced aging model in C57BL/6J mice. Behav Brain Res 157(2): 245-251. https://doi.org/10.1016/j.bbr.2004.07.003
Wood GE, Young LT, Reagan LP et al (2004) Stress-induced structural remodeling in hippocampus: prevention by lithium treatment. Proc Natl Acad Sci 101(11): 3973-3978. https://doi.org/10.1073/pnas.0400208101
Xing Z, He Z, Wang S et al (2018) Ameliorative effects and possible molecular mechanisms of action of fibrauretine from Fibraurea recisa Pierre on d-galactose/AlCl₃-mediated Alzheimer's disease. RSC adv 8(55): 31646-31657. https://doi.org/10.1039/c8ra05356a
Yan XS, Yang ZJ, Jia JX et al (2019) Protective mechanism of testosterone on cognitive impairment in a rat model of Alzheimer’s disease. Neural Regen Res 14(4): 649-657. https://doi.org/10.4103/1673-5374.245477
Yao M, Rosario ER, Soper JC et al (2022) Androgens Regulate Tau Phosphorylation Through Phosphatidylinositol 3-Kinase–Protein Kinase B–Glycogen Synthase Kinase 3β Signaling. Neuroscience. https://doi.org/ 10.1016/j.neuroscience.2022.06.034
Zakaria FN, Moklas MAM, Baharuldin MTH et al (2024) Delta-9-tetrahydrocannabinol Ameliorates D-galactose/Aluminium Chloride-Induced Alzheimer’s-Like Cognitive Deficit in Rats via Neurogenesis in their Hippocampus. J Young Pharm 16(1): 33-41. https://doi.org/10.5530/jyp.2024.16.5
Zameer S, Ali J, Vohora D et al (2021) Development, optimisation and evaluation of chitosan nanoparticles of alendronate against Alzheimer’s disease in intracerebroventricular streptozotocin model for brain delivery. J Drug Target 29(2): 199-216. https://doi.org/10.1080/1061186X.2020.1817041
Zhang G, Cui R, Kang Y et al (2019) Testosterone propionate activated the Nrf2-ARE pathway in ageing rats and ameliorated the age-related changes in liver. Sci Rep 9(1): 1-9. https://doi.org/10.1038/s41598-019-55148-0
Zhao W, Wang J, Latta M et al (2022) Rhizoma Gastrodiae Water Extract Modulates the Gut Microbiota and Pathological Changes of P-TauThr231 to Protect Against Cognitive Impairment in Mice. Front Pharmacol 13: 903659. https://doi.org/ 10.3389/fphar.2022.903659

Download PDF

Reviewers agreed at journal
17 Nov, 2024
Reviewers invited by journal
06 Sep, 2024
Editor assigned by journal
06 Sep, 2024
First submitted to journal
05 Sep, 2024

You are reading this latest preprint version

Neuroprotective potential of testosterone against aluminium chloride and d-galactose-induced Alzheimer-like pathology aggravated by overcrowding in mice: Role of Nrf2, HO-1, TNF-α, GSK-3β, PI3K and AKT pathway

Status:

Version 1

Abstract

Figures

Introduction

Material and Methods