CDCA8 promotes the proliferation and migration of cervical cancer through regulating CDK1

doi:10.21203/rs.3.rs-5044022/v1

Download PDF

Research Article

CDCA8 promotes the proliferation and migration of cervical cancer through regulating CDK1

https://doi.org/10.21203/rs.3.rs-5044022/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Cervical cancer (CC) is the 4th most common female cancer globally. Although its overall incidence rate has been declining for decades, the occurrence of advanced diseases and cervical adenocarcinoma (usually undetectable by cytology) are increasing. Therefore, predictors and therapeutic targets for CC are urgently required. Cell division cycle-associated 8 (CDCA8) has been observed to participate in mitotic regulation as a component of the chromosomal passenger complex. Furthermore, the activity of cancer-related CDCA8 hyperactivation has been comprehensively studied; however, its association and underlying molecular mechanism in CC remain elusive. Therefore, this study investigated the association of CDCA8 with CC and revealed that CDCA8 is significantly overexpressed in CC patients and related to poor clinical prognosis. Moreover, CDCA8 knockdown using small hairpin RNA (shRNA) inhibited the CC cell line’s proliferation and migration, as well as enhanced apoptosis. In addition, CDCA8 knockdown was also related to reduced tumor growth in the mouse CC model. RNA sequencing and co-immunoprecipitation assay revealed that CDCA8 interacted with cyclin-dependent kinase 1 (CDK1). The study also observed that CDK1 overexpression inhibited the suppressive effect of CDCA8 knockdown on CC cell growth and migration. In summary, this study indicated that the CDCA8/CDK1 axis plays an essential carcinogenic role in CC, thereby providing a potential novel target for CC diagnosis and treatment.

cervical cancer

CDCA8

CDK1

proliferation

migration

Cervical cancer (CC) is one of the most common female cancers in the world with high incidence and mortality rates, especially in low- and middle-income countries(19). Although CC can be prevented by screening, it is the 2nd leading cause of death by cancer in women aged 20 to 39. It has been estimated that 4138 and 4152 women died of CC in 2018 and 2019, respectively, and half of them were aged 50 or younger(21). Furthermore, the diagnosis of young women is promoting the increase in the incidence rate of advanced diseases and cervical adenocarcinoma. Compared with squamous cell carcinoma, the cytology of CC is less effective in prevention and early detection(14). Therefore, improved CC biomarkers and novel targets are required to increase the efficiency of human papillomavirus (HPV) vaccination, as well as primary HPV or HPV/cytology tests, based on the recommendations of the American Cancer Society's recently updated guidelines(9). Currently, radiotherapy and surgery are the main therapeutic strategies against non-metastatic CC, and combining radiotherapy with chemotherapy can significantly improve the survival rate of patients. Therefore, comprehensive studies are required to evaluate the molecular mechanisms associated with the CC progression to develop new therapeutic and diagnostic targets.

The human cell division cycle associated 8 (CDCA8) gene complex encodes at least 4 proteins: Aurora B, inner centromere protein (INCENP), survivin, and CDCA8 components of the vertebrate chromosome passenger complex (CPC)(28). CDCA8 is overexpressed in various cancers and is a putative oncogene, which is associated with the survival and malignancy of different cancer cells(6, 24). The literature has indicated that the overall survival, poor prognosis, and tumor-specific survival of bladder cancer patients were significantly correlated with high CDCA8 expression in tumor tissues. Moreover, the CDCA8 knockdown inhibits the proliferation, migration, and invasion of bladder cancer in vivo by affecting the cell cycle and p53 signaling pathway(1, 10). In addition, in human hepatocellular carcinoma, CDCA8 knockdown inhibits cell growth and stem cell proliferation by inactivating oncogenic AKT/β- catenin signaling restoring and ATF3 tumor suppressor(15). The studies have indicated that CDCA8 promotes glioma proliferation and migration by binding and regulating E2F1(25). Furthermore, CDCA8 overexpression facilitates the vicious progression of ovarian, cutaneous melanoma, breast, and prostate cancers(11, 3, 2, 24). However, the potential mechanism and exact biological function of CDCA8 in CC remains elusive.

This study validated that CDCA8 was significantly overexpressed in CC patients. Furthermore, CDCA8 knockdown inhibits the proliferation and migration of CC cells in vitro and suppresses tumor growth in the mouse model. Moreover, RNA sequencing and molecular mechanism analysis revealed that CDCA8 interacted with CDK1 and regulated its expression, thereby mediating the malignancy of CC cells. Overall, this study indicated that the CDCA8/CDK1 axis is markedly overexpressed in CC and promotes tumor progression, suggesting that the CDCA8/CDK1 axis may serve as a new therapeutic target and prognostic marker for CC treatment and diagnosis.

Cell culture and transfections

Human CC cell lines C33A, CASKI, SiHa, and HeLa, as well as the human cervical epithelial immortalized cells (H8), were acquired from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences and cultured in Dulbecco-modified Eagle medium (Invitrogen) augmented with penicillin 100 (U/mL)/Streptomycin (100 g/mL) and 10% fetal bovine serum (Gibco, USA) at 37℃ and 5% CO2.

Immunohistochemistry

The detailed protocol for immunohistochemistry has been described in our previous research(26). Briefly, the samples in glass slides were dehydrated, deparaffinized in xylene, heated in a microwave with citrate buffer (pH 6.0) for 15 min, blocked with 10% normal goat serum for 30 min, and then treated with 3% H2O2 to inhibit endogenous peroxidase activity for 10 min. The slides were then incubated overnight at 4°C with an anti-CDCA8 antibody (1:100, Proteintech Group, Inc., Wuhan, China), stained with diaminobenzidine (DAB; Sigma-Aldrich), counterstained with hematoxylin, washed with PBS, mounted using permount, dehydrated, and cleared in xylene.

Data collection and processing

The normalized gene expression data on CESC (Cervical Squamous Cell Carcinoma and Cervical Adenocarcinoma) were acquired from the TCGA (The Cancer Genome Atlas) (http://gdac.broadinstitute.org/) database. The differential expression of CDCA8 was assessed based on limma |(log2 (fold change)| > 0.58 and BH-adjusted p-value < 0.05.

RNA extraction and quantitative reverse transcription-PCR (qRT-PCR)

Total cellular RNA was extracted using TRIzol reagent (Invitrogen, Waltham, MA), which was then utilized for generating cDNA using SuperScript III (ThermoFisher). The mRNA expression of CDCA8 and GAPDH was detected by qRT PCR using SYBR Green qRT PCR kit (Roche, Basel, Switzerland), Applied Biosystems Real-Time PCR system (Life Technologies, Carlsbad, CA), and QuantStudio 12 K Flex software. GAPDH was employed as a reference point. The 2−ΔΔCt method was utilized to calculate the relative gene expression levels. Each experiment is repeated thrice. The sequences of primers utilized were:

GAPDH: TGACTTCAACAGCGACACCCACACCCTGTTGCTGTAGCCAAA121bp.

CDCA8:TTGAGTCAGACAGGCAGAACCTTCCTCCAAGGGCGAAGTAG 120bp.

MTT assay

The transiently transfected cells (3,000/well) were seeded in 96-well plates and cultured for 1, 2, 3, 4, or 5 days. Then, 20 µL of MTT working solution in the medium was added to each well for 4 hours, followed by the removal of media and the addition of dimethyl sulfoxide (200 µL) to dissolve the formazan crystals. The absorbance was detected at 570 nm (A570) using a microplate reader (BioRad, Hercules, USA).

Colony formation assays

Cells (1000/well) were seeded in 6-well plates, with 3 wells per group. After 14 days of cultivation at 37℃, colonies were stained with crystal violet solution and washed thrice with PBS. Then, colonies with > 50 cells in each well were counted under the microscope.

Wound-healing assays

Transfected cells were cultured in 6-well plates in a complete medium until 90 - 100% confluency. Then, a P200 pipette tip was used to wound the cell monolayers. The cells were then washed to remove debris with PBS and imaged from the same wounded area at 0, 24, and 48 hours.

Transwell migration assays

Cells (4 × 105/well) were seeded in the top chamber of a 24-well Transwell plate (Corning Incorporated, USA) in 1% FBS-containing medium for transfection. In the bottom chamber, a complete medium was added. After incubating for 24 hours in normal conditions, cells on the upper part of the filter were swabbed using a cotton swab, while the cells on the lower surface of the filter were fixed with 4% paraformaldehyde for 20 min, stained with 1% crystal violet for 30 min, and then visualized under the light microscope. The average number of migrating cells was calculated from 5 different fields of view.

Western blot analysis

Briefly, the cells were lysed using RIPA buffer (150 mM NaCl, 25 mM Tris HCl, pH 7.4, 0.1% SDS, 1% Triton X-100, 1% deoxycholate, 2mm EDTA) augmented with protease and phosphatase inhibitor cocktail (Roche, France). The acquired proteins (50 µg) were then subjected to SDS-PAGE separation and treated with specific antibodies for immunoblotting (Supplementary Table 1).

Co-immunoprecipitation (co-IP)

Briefly, the IP lysis buffer containing protease inhibitor cocktail was used to lyse SiHa cells NC or Flag CDK1 overexpression cells. The protein lysates were then incubated overnight at 4°C with CDCA8 or Flag primary antibody and then with protein A/G agarose beads for 4 h at 4°C. In addition, 5% cell extract was saved as the input. After overnight incubation, the immunocomplexes were washed thrice with PBST (pH 7.4 PBS with 0.1% Tirton-X100) and then resolved by SDS-PAGE. The bound proteins (CDK1 or CDCA8) were eluted by boiling with 2 × SDS loading buffer.

Tumorigenicity assays in nude mice

The Shanghai Lab Animal Research Center (Shanghai, China) provided the naive mice (age = 4 - 6 weeks), which were housed in the Experiment Animal Center of the Central South University (Changsha, China) at a 12:12-hour light-dark cycle in a temperature-controlled room and ad libitum access to food and water. Stably transfected cells (2 × 106) were added to 0.2 mL RPMI-1640 culture medium and subcutaneously injected into the upper right back of mice for tumorigenicity testing. Each mouse's tumor volume was measured every 3 days using formula 3.14/6 × L × W × W. All mice were sacrificed by cervical dislocation at the end of the experiment at 3 weeks after the injections, and the tumor size was measured with a caliper. Surviving animals after the experiment were handed over to qualified institutions for harmless treatment. The Animal Care and Use Committee of Xiangya Second Hospital of Central South University (Changsha, Hunan, China) (approval number: 20240576) approved all animal operations which strictly followed institutional policies and approved experimental operation guidelines.

Statistical analyses

SPSS 16.0 software was used for all of the statistical analyses. To determine the significance differences between the experimental and control groups, two-sided unpaired Student's t-tests were used. A p-value of 0.05 was deemed statistically significant.

Upregulation of CDCA8 expression in CC patients and its association with poor prognosis

To explore the relationship between CDCA8 levels and clinical characteristics of CC patients, CDCA8 expression in human CC malignancies was assessed by using 116 CC tumor biopsies and 74 normal human cervical tissues. Immunohistochemistry analysis revealed that CDCA8 protein was present in 99 of 116 CC tumors (85%); however, it was positively expressed in 6 of 74 (8%) normal human cervical tissues (Fig. 1A, Table 1, Supplementary Fig. 1). Moreover, the expression pattern of CDCA8 in human cervical carcinoma was also analyzed using the TCGA-CESC database, which revealed that compared with normal tissues, CDCA8 was significantly upregulated in CESC tumors (Fig. 1B). In addition, among the 300 CC patients analyzed in GSE44001 (48 high and 252 low CDCA8 levels samples), lower disease-free survival (DFS) was significantly correlated with higher CDCA8 expression levels (p < 0.001) (Fig. 1C). This study also evaluated CDCA8 mRNA and protein levels in different CC cell lines (C33A, CASKI, SiHa, HeLa) and the H8 human cervical epithelial immortalized cells. qRT PCR and western blotting indicated that CDCA8 mRNA and protein levels in CC cells were significantly higher than in H8 cells (Fig. 1D-E). Overall, higher CDCA8 expression has been observed to be associated with more aggressive CC progression.

Table 1

Expression patterns of CDCA8 in human cervical cancer tissue arrays that contained 116 tumor tissues and 74 normal human cervical tissues revealed in immunohistochemistry analysis
CDCA8 expression	Tumor tissue		Normal tissure		P-value
CDCA8 expression	Cases	Percentage	Cases	Percentage	P-value
High	116	85%	74	8%	< 0.0001

CDCA8 promoted cervical cancer cell proliferation and migration in vitro

To determine the role of CDCA8 in the proliferation and migration of CC, shRNA plasmid targeting CDCA8 was transfected into SiHa and HeLa cells, which had the highest expression of CDCA8 among all CC cells. Furthermore, the transfection efficiency analysis indicated that compared with the control vector group, the CDCA8 mRNA and protein expression in SiHa and HeLa cell shRNA groups were significantly reduced (shCtrl, Fig. 2A-B). In addition, the MTT and cell apoptosis analyses indicated that CDCA8 knockdown significantly inhibited tumor cell proliferation in SiHa and HeLa cells compared to the control group (Fig. 2C-D). The colony formation experiment further confirmed the role of CDCA8 in the strict transformation and growth of malignant cells. It was also revealed that CDCA8 knocked down significantly reduced the colony formation ability of the SiHa and HeLa cells compared to the control group (Fig. 2E-F). Moreover, wounding healing and transwell migration assay indicated that CDCA8 knockdown inhibited tumor cell migratory ability of SiHa and HeLa cells (Fig. 2G-J). These data indicated that the CDCA8 down-regulation inhibited the proliferation and migration of CC cells.

CDCA8 knockdown suppressed tumorigenesis in mice

To investigate the oncogenic effects of CDCA8 in inducing tumorigenesis in vivo, stable CDCA8 knockdown or control Hela cell lines were established. In addition, nude mice received the cells via subcutaneous injection. The tumor growth curve of CDCA8 knockdown cells injected mice indicated that tumor growth was significantly inhibited (Fig. 3A). Tumor volume was estimated by measuring tumor diameter through bioluminescence imaging, which indicated that CDCA8 shRNA-transfected mice had fewer tumors with smaller volumes (Fig. 3B-C). On the 20th day, the mice were euthanized, and their tumors were dissected and weighed. Compared to the control group, CDCA8 knocked down significantly reduced the mass volume and weight of the tumor (Fig. 3D-E).

CDCA8 interacts with CDK1

To investigate the carcinogenic mechanism of CDCA8 in CC, RNA sequencing analysis was performed to determine the differentially expressed genes (DEGs) and signaling pathways altered by CDCA8 knockdown in Hela cells. The CDCA8 knockdown resulted in 773 significantly upregulated and 634 downregulated genes (Fig. 4A). Furthermore, the top 10 down-regulated molecules including CDK1, CDK6, EIF3B, and MCM2 were validated by RNA-seq data, qRT-PCR, and western blotting. Among them, CDK1 was down-regulated in all the RNA-seq, qRT-PCR, and western blotting data (Fig. 4B-D). Moreover, the TCGA-CESC database revealed that CDK1 expression was dramatically up-regulated in human CESC tumors than normal tissues and prominently correlated with CDCA8 expression (Fig. 4E-F). In addition, similar to CDCA8, CDK1 expression was significantly upregulated in all CC cell lines compared to H8 cells (Fig. 4G). To confirm whether CDCA8 interacts with CDK1, co-IP was performed using CDK1-FLAG and CDCA8 antibodies respectively, which revealed the interaction between CDCA8 and CDK1 in the Hela cells (Fig. 4H-I).

CDCA8 plays its oncogenic role through CDK1

To validate that CDK1 may be a functional target of CDCA8 and promote CC cell proliferation and migration, the CDK1 re-overexpression and stably knocked down CDCA8 Hela cell lines were generated (Fig. 5A). It was revealed that re-overexpression of CDK1 considerably reversed the reduction in cell viability and clonogenic ability caused by the CDCA8 knockdown (Fig. 5B-C). Moreover, CDK1 overexpression restored the effect of CDCA8 knockdown-induced cell apoptosis (Fig. 5D). In addition, wounding healing and transwell migration experiments indicated that CDK1 alleviated the inhibition of Hela cell migration caused by CDCA8 knockdown (Fig. 5E-F).

Although the overall incidence rate of CC has been declining for decades, the occurrence of long-term diseases and cervical adenocarcinoma (usually not found by cytology) are increasing, predominantly in young women(14). Therefore, novel and effective tumor biomarkers for accurate diagnosis and better prognosis prediction of CC are urgently required. This study revealed that CDCA8 was significantly expressed in CC patients and cell lines, and its high expression was notably linked with lower DFS. Moreover, CDCA8 knockdown markedly reduced tumor growth in CC mouse models and in vitro proliferation and migration of CC cells. Mechanistically, CDCA8 interacts with and regulates CDK1 expression, thereby increasing the malignancy of CC cells. Overall, these data revealed that CDCA8/CDK1 may act as powerful prognostic markers and can be a novel therapeutical target for CC.

The cell division cycle-associated protein (CDCA) family consists of eight members (CDCA1-8)(22), They are mainly located in the chromosome and centromere regions of the nucleus and mediate cell division, sister chromatid cohesion, and mitotic mitosis, as well as modulate cell proliferation cycle via protein, chromatin, and microtubule bindings(16, 5). Moreover, CDCAs and their interaction-related proteins have been observed to modulate the proliferation of tumor and immune cells in the tumor microenvironment, thereby regulating the occurrence and development of tumors, and affecting patient prognosis(4, 12, 17). Furthermore, CDCA8 is essential for spindle formation and microtubule stabilization, thereby modulating the cell cycle and mitotic cell division(1). The previous literature has indicated that CDCA8 overexpression is significantly correlated with poor prognosis in various cancers, including prostate cancer(24), bladder cancer(1), malignant glioma(25), ovarian cancer(11), lung cancer(5),liver cancer(20), thyroid cancer(27), breast cancer(18), and cutaneous melanoma(3, 13). These reports indicated that CDCA8 is a promising and effective molecular marker for the early diagnosis of cancers. However, studies investigating the role of CDCA8 in CC are lacking. Here, the immunohistochemistry staining of human CC tissue arrays revealed that CDCA8 expression was higher in CC biopsy tissues than in normal cervical tissues. Furthermore, CDCA8 was notably upregulated in CESC tumors than in the normal tissues in the TCGA database, and a higher expression level of CDCA8 was associated with lower DFS. In vitro analyses revealed that CDCA8 knockdown inhibited the proliferation and migration of CC cells, and inhibited tumor growth in a mouse model, indicating that CDCA8 promoted the occurrence and progression of CC. Therefore, CDCA8 suppression may be a novel strategy for treating CC.

Previous studies have reported that the CDCA8 acts as a proto-oncogene in cancers and has been observed to promote the proliferation and migration of bladder cancer and glioma cells by affecting the cell cycle and p53 signaling pathways or by regulating E2F1, respectively(10, 25). Here, RNA-sequencing and further validating analyses revealed that in CC, CDK1 is the potential target gene regulated by CDCA8. CDK1 is a kinase and a crucial regulatory factor that induces cells to undergo the G2 phase and mitosis(8). Furthermore, CDK1 was observed to be transcriptionally activated by Sp1 and induced radioresistance of CC cells by inhibiting G2/M phase arrest(7). Moreover, miR-143-3p and miR-495-3p were reported to collectively inhibit CDK1, thereby suppressing CC occurrence and progression(23). These data revealed that CDK1 is crucially involved in CC; however, its upstream regulation mechanism remains unknown. This study revealed that CDCA8 interacted with CDK1, and CDCA8 knockdown down-regulates CDK1 expression. In addition, CDK1 overexpression was observed to inhibit cell proliferation and migration induced by CDCA8 inhibition, indicating that CDCA8 promoted the development of CC directly by regulating CDK1.

In summary, this research indicated that the CDCA8/CDK1 axis was significantly dysregulated in CC tumors. Furthermore, high CDCA8 expression levels were associated with poor prognosis in CC patients. Moreover, CDCA8 partially promoted CC cell proliferation and migration by regulating CDK1 both in vitro and in vivo. Therefore, the CDCA8/CDK1 axis may act as a novel prognostic marker for the diagnosis of CC patients, and its inhibition could act as a potential therapeutic strategy in these patients.

CESC

Cervical squamous cell carcinoma and endocervical adenocarcinoma

CDCA

cell division cycle-associated protein

CDCA8

Cell division cycle-associated 8

CPC

chromosomal passenger complex

co-IP

co-immunoprecipitation

CDK1

cyclin-dependent kinase 1

DEGs

differentially expressed genes

DFS

Disease-free survival

HPV

human papilloma virus

INCENP

inner centromere protein

shRNA

small hairpin RNA

TCGA

The Cancer Genome Atlas

Acknowledgments

The authors thank all staff at the Department of Oncology of the Shunde Affiliated Hospital to Guangzhou University of Chinese Medicine, Foshan, China, and the Second Xiangya Hospital of Central South University, Changsha, China.

Ethical Approval

The Animal Care and Use Committee of Xiangya Second Hospital of Central South University (Changsha, Hunan, China) (approval number: 20240576) approved all animal operations which strictly followed institutional policies and approved experimental operation guidelines.

Consent to Participate

Yes

Consent for Publication

Yes

Author Contributions

WZ: supervised and conceptualized. JT and XL: data analysis and curation. CC: initial draft writing, reviewing, and editing. The final manuscript was read and approved by all authors.

Funding

The financial support for this study was provided by Wu Jieping Medical Foundation (320.6750.2021-02-20) in China.

Competing Interests

The authors have stated that there is no competing interest.

Availability of data and materials

All data and materials in the manuscript will be made available by the corresponding authors.

Bi Y, Chen S, Jiang J, Yao J, Wang G, Zhou Q, Li S (2018) CDCA8 expression and its clinical relevance in patients with bladder cancer. Medicine, 97
Bu Y, Shi L, Yu D, Liang Z, Li W (2019) CDCA8 is a key mediator of estrogen-stimulated cell proliferation in breast cancer cells. Gene 703:1–6
Chao Ci BT, Lyu D, Liu W, Qiang D, Ji X, Qiu X, Chen L, Wei Ding (2019) Overexpression of CDCA8 promotes the malignant progression of cutaneous melanoma and leads to poor prognosis, vol 43. INTERNATIONAL JOURNAL OF MOLEcULAR MEdIcINE, pp 404–412
Chen C, Chen S, Luo M, Yan H, Pang L, Zhu C, Tan W, Zhao Q, Lai J, Li H (2020) The role of the CDCA gene family in ovarian cancer. Annals Translational Med 8:190–190
Chen C, Chen S, Pang L, Yan H, Luo M, Zhao Q, Lai J, Li H (2020) Analysis of the Expression of Cell Division Cycle-Associated Genes and Its Prognostic Significance in Human Lung Carcinoma: A Review of the Literature Databases. BioMed Research International, 2020, 1–14
Cui XH, Peng QJ, Li RZ, Lyu XJ, Zhu CF, Qin XH (2021) Cell division cycle associated 8: A novel diagnostic and prognostic biomarker for hepatocellular carcinoma. J Cell Mol Med 25:11097–11112
Deng Y-R, Chen X-J, Chen W, Wu L-F, Jiang H-P, Lin D, Wang L-J, Wang W, Guo S-Q (2019) Sp1 contributes to radioresistance of cervical cancer through targeting G2/M cell cycle checkpoint CDK1. Cancer Manage Res 11:5835–5844
Diril MK, Ratnacaram CK, Padmakumar VC, Du T, Wasser M, Coppola V, Tessarollo L, Kaldis P (2012) Cyclin-dependent kinase 1 (Cdk1) is essential for cell division and suppression of DNA re-replication but not for liver regeneration. Proceedings of the National Academy of Sciences, 109, 3826–3831
Fontham ETH, Wolf AMD, Church TR, Etzioni R, Flowers CR, Herzig A, Guerra CE, Oeffinger KC, Shih YCT, Walter LC, Kim JJ, Andrews KS, DeSantis CE, Fedewa SA, Manassaram-Baptiste D, Saslow D, Wender RC, Smith RA (2020) Cervical cancer screening for individuals at average risk: 2020 guideline update from the American Cancer Society, vol 70. A Cancer Journal for Clinicians, CA, pp 321–346
Gao X, Wen X, He H, Zheng L, Yang Y, Yang J, Liu H, Zhou X, Yang C, Chen Y, Chen M, Zhang S (2020) Knockdown of CDCA8 inhibits the proliferation and enhances the apoptosis of bladder cancer cells. PeerJ, 8
Gonghua Qi CZ, Ma H, Li Y, Peng J, Chen J, Beihua Kong (2021) CDCA8, targeted by MYBL2, promotes malignant progression and olaparib insensitivity in ovarian cancer. Am J Cancer Res 11:389–415
Gu P, Yang D, Zhu J, Zhang M, He X (2022) Bioinformatics analysis of the clinical relevance of CDCA gene family in prostate cancer. Medicine, 101
Guo R, Ying J, Jia L, Zhuang N, Jiang H, Xiong J (2022) Regulators CDCA8 as potential targets and biomarkers for the prognosis of human skin cutaneous melanoma. J Cosmet Dermatol 21:6034–6048
Islami F, Fedewa SA, Jemal A (2019) Trends in cervical cancer incidence rates by age, race/ethnicity, histological subtype, and stage at diagnosis in the United States. Prev Med 123:316–323
Jeon T, Ko MJ, Seo Y-R, Jung S-J, Seo D, Park S-Y, Park KU, Kim KS, Kim M, Seo JH, Park I-C, Kim M-J, Bae J-H, Song D-K, Cho CH, Lee J-H, Lee Y-H (2021) Silencing CDCA8 Suppresses Hepatocellular Carcinoma Growth and Stemness via Restoration of ATF3 Tumor Suppressor and Inactivation of AKT/β–Catenin Signaling. Cancers, p 13
Kobayashi YU, Takano A, Miyagi Y, Tsuchiya E, Sonoda H, Shimizu T, Okabe H, Tani T, Fujiyama Y, Daigo Y (2014) Cell division cycle-associated protein 1 overexpression is essential for the malignant potential of colorectal cancers. Int J Oncol 44:69–77
Li Z, Liu Z, Li C, Liu Q, Tan B, Liu Y, Zhang Y, Li Y (2021) CDCA1/2/3/5/7/8 as novel prognostic biomarkers and CDCA4/6 as potential targets for gastric cancer. Translational Cancer Res 10:3404–3417
Nam Nhut Phan C-YW, Li K-L, Chen C-F, Chiao C-C, Yu H-G, Huang P-L (2018) Yen-Chang Lin. Distinct expression of CDCA3, CDCA5, and CDCA8 leads to shorter relapse free survival in breast cancer patient. Oncotarget, 9, 6977–6992
Paul Gopu FA, Cyriac S, Karakasis K, Amit M, Oza (2021) Updates on systemic therapy for cervical cancer. Indian J Med Res 154:293–302
Shuai Y, Fan E, Zhong Q, Chen Q, Feng G, Gou X, Zhang G (2021) CDCA8 as an independent predictor for a poor prognosis in liver cancer. Cancer Cell Int, 21
Siegel RL, Miller KD, Fuchs HE, Jemal A (2021) Cancer Statistics, 2021. Cancer J Clin 71:7–33
Spruck C, Strohmaier HM (2014) Seek and Destroy: SCF Ubiquitin Ligases in Mammalian Cell Cycle Control. Cell Cycle 1:248–252
Tang J, Pan H, Wang W, Qi C, Gu C, Shang A, Zhu J (2021) MiR-495-3p and miR-143-3p co-target CDK1 to inhibit the development of cervical cancer. Clin Transl Oncol 23:2323–2334
Wan S, He Y, Zhang B, Yang Z, Du F-M, Zhang C-P, Fu Y-Q, Mi J (2022) Overexpression of CDCA8 Predicts Poor Prognosis and Promotes Tumor Cell Growth in Prostate Cancer. Frontiers in Oncology, 12
Wang X, Wang H, Xu J, Hou X, Zhan H, Zhen Y (2021) Double-targeting CDCA8 and E2F1 inhibits the growth and migration of malignant glioma, vol 12. Cell Death & Disease
Wen Zou ZY, Li D, Liu Z, Zou Q, Yuan Y (2019) AQP1 and AQP3 Expression are Associated With Severe Symptoms and Poor-prognosis of the Pancreatic Ductal Adenocarcinoma. Appl Immunohistochem Mol Morphol 27:40–47
Xiang C, Sun W-h, Ke Y, Yu X, Wang Y (2022) CDCA8 Contributes to the Development and Progression of Thyroid Cancer through Regulating CDK1. J Cancer 13:2322–2335
Yi Y, Li Y, Li C, Wu L, Zhao D, Li F, Fazli L, Wang R, Wang L, Dong X, Zhao W, Chen K, Cao Q (2022) Methylation-dependent and -independent roles of EZH2 synergize in CDCA8 activation in prostate cancer. Oncogene 41:1610–1621

No competing interests reported.

CDCA8SupplementaryFigure1.pdf
Sup figure 1: The expression of CDCA8 in cervical cancer tissues (A) and normal tissue (B) was detected by immunohistochemistry using tissue array.
SupplementaryTable1.docx
Supplementary Table 1: Information about antibody of western blot in this article
TumorsinAnimalModels.zip
WBrawpictures.zip

Download PDF

Reviews received at journal
19 Nov, 2024
Reviewers agreed at journal
17 Nov, 2024
Reviews received at journal
15 Nov, 2024
Reviewers agreed at journal
06 Nov, 2024
Reviewers agreed at journal
24 Oct, 2024
Reviewers invited by journal
24 Oct, 2024
Editor assigned by journal
21 Sep, 2024
Submission checks completed at journal
09 Sep, 2024
First submitted to journal
06 Sep, 2024

You are reading this latest preprint version

CDCA8 promotes the proliferation and migration of cervical cancer through regulating CDK1

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1