The implication of TET1, miR-200 and miR-494 expression with tumor formation in colorectal cancer: through targeting WNT signaling

doi:10.21203/rs.3.rs-5049052/v1

Objective: Colorectal cancer (CRC) is a heterogeneous disease characterized by genetic and epigenetic alterations that contribute to tumor initiation and progression. Among these, dysregulation of the ten–eleven translocation (TET) DNA demethylases and the Wnt signaling pathway have been implicated in CRC pathogenesis. This study aimed to assess the expression level of selective miRNAs (miR-200 and miR-494), TET1 and Wnt1 in colorectal polyps, actual colorectal tumors, and normal adjacent tissues. We also evaluated the effect of 5-aza cytidine on the expression level of TET1 and wnt1 in the HT29 cell line.

Material and methods: TET1 and Wnt1 expression was assessed in 5-azacytidine-treated HT29 cells, a demethylating agent commonly used in cancer therapy. Additionally, we enrolled 114 individuals who underwent radical surgical colon resection, including 47 with cancerous tissues and 67 with polyps. We utilized qRT-PCR to measure mRNA levels of miR-200, miR-494, TET1 and Wnt1 in colorectal polyps, actual colorectal tumors, and normal adjacent tissues.

Results: TET1 expression was notably lower in both polyps and CRC tissue in comparison to adjacent normal tissue, with higher TET1 expression in tumors compared to polyps. Significant differences in miR-200 and miR-494 expression was observed in tumor samples compared to adjacent normal tissue. Furthermore, our in vitro experiments revealed that 5-azacytidine treatment upregulated TET1 and downregulated Wnt1 expression in CRC cell line, suggesting a potential therapeutic role for DNA demethylating agents in modulating TET1 and Wnt signaling in CRC development.

Conclusions: Overall, our findings provide further insight into the complex interplay between TET1, Wnt1 and selective miRNAs in CRC and their potential implications for diagnosis and treatment.

Colorectal cancer

Epigenetics

TET protein

Wnt pathway

5-aza

Colorectal cancer (CRC) results from multi-step carcinogenesis due to the accumulation of genetic and epigenetic changes in the cells lining the rectum or colon. In fact, CRC exhibits molecular heterogeneity. It results from the gradual accumulation of morphological, genetic, and epigenetic alterations leading to the transition from normal colonic epithelial cells to adenocarcinoma [1]. Epigenetic changes refer to modifications in the DNA molecule that do not alter the underlying sequence of nucleotides, but rather affect the way the DNA is packaged and expressed. The most extensively characterized epigenetic modification is methylation at the 5-carbon of cytosines, mostly in the context of CG dinucleotides [2]. It is believed that DNA methylation may modify the binding of transcription factors to their DNA target sites, which in turn may change the expression of downstream genes, even though the underlying molecular mechanisms of DNA methylation are not fully understood [3]. Ten-eleven translocation (TET) proteins are important mediators of active DNA methylation in coordination with DNA methyltransferases (DNMTs) [4]. Members of the TET family (TET1-TET3) are involved in demethylation process by acting as methyl cytosine dioxygenases, catalyzing the conversion of 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC) and 5-formylcytosine (5fC) to 5-carboxylcytosine (5caC) [5]. Furthermore, an increasing body of evidence suggests that TET proteins have an additional role in regulating cancer-related genes through mechanisms independent of their enzymatic activity [6]. Down-regulation or dysfunction of TET1 is are associated with cancer initiation, invasion and metastasis. Certainly, TET1 is frequently lacking in various cancers [7]. Additionally, studies have indicated a down-regulation of TET1 in early-stage colon tumors, where the decreased expression of TET1 during the initiation of colon cancer suppresses the promoters of WNT pathway inhibitors, leading to a persistent activation of the WNT pathway[8]. The mechanisms by which TET family members function and exert their action in colorectal carcinogenesis and progression have not yet been clearly described.

MicroRNAs (miRNAs) are a class of non-coding RNAs that serve as crucial regulators of important processes in the body. They connect to the 3' untranslated region (UTR) of messenger RNAs and are considered key controllers of gene expression. Disruptions in their function can lead to the emergence of aberrant gene expression patterns, potentially contributing to disorders such as cancer. In fact, miRNAs can act as tumor suppressors or oncogenes, thereby can play roles in the pathogenesis of many types of cancers such as CRC. A board range of miRNAs are involved in colorectal carcinogenesis through the regulation of genes involved in growth, proliferation, apoptosis, invasion, and metastasis of cancer cells [9]. Among these, it has been shown that miR-200b down-regulated in CRC while miR-494 was up-regulated, which is associated with tumor-promoting [10].

Wnt1 (wingless-related integration site) is one of the members of the WNT family that involve in the activation of the canonical WNT signaling pathway. It has been demonstrated that Wnt1 was able to induce resistance to treatment and inhibit apoptosis through stimulation of beta-catenin. In other words, it enhances the proliferation and migration of colorectal tumors which was associated with CRC development [11]. Some microRNAs target the WNT/beta-catenin signaling, thereby inhibiting the proliferation and invasion of CRC cells and inducing apoptosis[12]. Therefore, inhibiting Wnt1 may potentially suppress the growth of colorectal cancer through epigenetic modifications.

However, it is essential to elucidate the specific interactions and mechanisms between TET1, and miRs with WNT1 in CRC which can promote our knowledge about regulatory mechanisms during devolvement of CRC. Therefore, in this study, we aimed to investigate the expression levels of miR200b, miR-494, TET1 and Wnt1 in cancerous tissues, polyps, and corresponding adjacent normal tissues from CRC patients. In addition, we evaluated the effect of DNA methyltransferases inhibitor 5-azacitidine (5-aza) on the expression level of TET1 and Wnt1 in the HT29 cell line.

Cell culture and treatment

The HT29 human colon cancer cell line was purchased from the Pasteur Institute of Iran and cultured in RPMI 1640 medium (Gibco; Life Technologies, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; Sigma-Aldrich, St. Louis, MO, USA) and 100 IU/ml of penicillin/streptomycin (Thermo Fisher Scientific, Waltham, MA, USA) under sterile conditions and maintained at 37°C in an incubator under an atmosphere of 5% CO2. The medium was changed every other day, and cells were passaged once a week.

For the 5-aza treatment experiments, cells were treated with different concentrations of 5-aza (0.5, 1, 2.5, 5,10 and 20 µM) for 24, 48 and 72 hours. 5-aza was provided from Sigma (St. Louis, MO, USA) and dissolved in culture medium and phosphate-buffered saline (PBS).

Cell viability assay

Cell cytotoxicity and IC50 dose for 5-aza were detected using the MTT colorimetric assay. Cells were seeded at a density of 5000 cell/well in a 96-well plate. After overnight incubation, the cellswere treated in triplicate with dierent concentrations of curcumin (0.5, 1, 2.5, 5,10 and 20 µM), 5-aza (0, 10, 50, 100, 150, 200, and 300 M), and DMSO as the vehicle. After 72 h incubation, the medium was aspirated from the wells and 20 L of MTT solution (5 mg/mL in PBS) was added to each well, then incubated at 37C, 5% CO2, for 5 h, and the formazan crystal was solubilized using 200 L DMSO. The samples were read at 570 nm on a microplate reader (BioTek, USA).

Patient samples

Colorectal polyps, actual colorectal tumors, and normal adjacent tissues were collected between June 2019 and March 2020 from a cohort of 114 patients who underwent radical surgical resection of the colon at the Department of Gastroenterology and Liver Diseases (RIGLD) of Shahid Beheshti University of Medical Science, Iran. Histopathological unchanged colonic mucosa located at least 10–20 cm away from the cancerous lesions was obtained from the same patients. Age of CRC diagnosis ranged from 28 to 84 years (median: 64 years) (Table 1). Samples were immediately snap-frozen in liquid nitrogen and stored at − 80°C until DNA and RNA isolation. None of the patients received preoperative chemotherapy or radiotherapy. Informed consent was obtained from all participating individuals. The procedures of the study were approved by the ethical committee of RIGLD (Ethical Code of Education 1392/704). Written consent was obtained from all participants.

RNA isolation, reverse transcription, and real-time quantitative polymerase chain reaction (qRT-PCR) analysis

Total RNA extraction from tissue samples and HT29 and 5aza-HT29 utilized a Qiagen extraction kit (Germany) following the manufacturer's protocol.NanoDrop spectrophotometer (Thermo Scientific, USA), ensuring accurate measurement and analysis.—subsequent cDNA synthesis utilized 3 µg of RNA with a First Strand cDNA Synthesis Kit. Real-time PCR (RT-PCR) were conducted on a StepOnePlus Real-Time PCR System, employing TaqMan Gene Expression Assays for TET1 and Wnt1 genes. PCR conditions included denaturation at 95°C for 20 s, annealing at 60°C for 20 s, and extension at 72°C for 30 s, over 40 cycles. Real-time PCR efficiencies were determined via linear regression slope analysis. PCR efficiency ranged from 98–102%. All assays were performed in triplicate. Relative fold changes were calculated using the comparative 2^-ΔΔCT method, normalizing to reference genes GAPDH and U6. ΔΔCT represents the difference between the mean ΔCT of treatment and control groups, with ΔCT being the difference between mean Ct values of target and control genes. The StepOnePlus Real-Time PCR system (Applied Biosystems, USA) was used for PCR reactions, and relative gene expression was determined using the 2^-ΔΔCT method (Table 2 ).

Statistical analysis

Data analysis was conducted using GraphPad Prism version 8.4.3 (GraphPad Software, Inc., La Jolla, CA, USA). To determine statistical significance, either a two-tailed Student's t-test or one-way analysis of variance followed by Dunnett's multiple comparison test was applied. Pearson's correlation coefficient (r) was utilized for measuring correlation by SPSS. A significance level of P < 0.05 was used to determine statistical significance. The results are presented as the mean ± standard deviation, and the experiments were independently replicated at least three times.

Measurement of TET1 and wnt1 gene expression level by

Aberrant DNA methylation, a key characteristic of cancer cells, is considered an important mechanism leading to the activation or inactivation of tumor-related genes. Indeed, there are several genes that are frequently aberrantly methylated at different steps in the sequence from polyp to CRC [13]. The TET gene family, which is responsible for active DNA demethylation, has a pivotal role in regulating gene expression, improving cell differentiation, and preventing malignant transformation. TET1 downregulation, which is commonly observed in CRC, can be used as a marker to improve cancer diagnosis, a prognostic biomarker, a predictive biomarker for therapy response, a potential therapeutic target, and an insight into the underlying biology of the disease. Several reports have reported reduced TET1 transcript levels in cancerous tissues [14]. These data support previous observations of lower levels of TET1 in solid cancers [15]. To the best of our knowledge, this is the first report presenting such a result in polyps. This suggests that TET1 downregulation may play a key role in the field cancerization process in CRC. Moreover, the higher expression of the TET1 gene in CRC tissues suggests a potential role for TET genes in tumorigenesis. The expression levels of the TET1 and Wnt1 gene were measured in polyp and tumor samples, as well as in their corresponding adjacent normal tissues. The results showed no significant difference in the expression of the Wnt1 gene between polyp and adjacent normal tissues (P = 0.614) or between tumor and adjacent normal tissues (P = 0.311). The results revealed a significant decrease in TET1 gene expression in polyp (P = 0.026) and CRC samples (P = 0.046) compared to adjacent normal tissue. Furthermore, the expression of the TET1 gene was found to be significantly higher in tumor samples compared to polyp tissues (P = 0.040) (Fig. 1).

The WNT pathway regulates crucial processes such as proliferation, tissue differentiation, etc. Studies indicate that TET enzymes have a regulatory action in the WNT pathway, thus inhibiting the initiation and progression of carcinogenic pathways [16]. In this context, this study demonstrated that TET significantly inhibits the expression of WNT. These findings suggest that TET can suppress the WNT pathway in cancer cells, thereby preventing the initiation and progression of colorectal cancer.

In consist with our finding, Neri et al. found that TET1 regulates the Wnt signaling pathway in CRC, acting as a tumor suppressor. Specifically, Re-expressed TET1 selectively targets the DKK and SFRP genes in CRC cells, which serve as upstream inhibitors of Wnt signaling. Through a reduction in 5-mC and an increase in 5-hmC at their promoter regions, TET1 augments the expression of these genes [8]. These findings also suggest that TET1 may be involved in the pharmacological action of a DNA methyltransferase (DNMT) inhibitor. Therefore, the restoration of TET1 function could be a valuable therapeutic strategy for CRC treatment [17].

Effects of 5-Azacytidine on TET1 and Wnt1 genes expression by qRT-PCR

Our study also suggests that 5-aza may augment the expression of TET1 in CRC cells. 5-aza is a demethylating agent that has been shown to have therapeutic potential in various types of cancer, including CRC. To determine the impact of 5-aza on TET1 and Wnt1 gene expression, real-time RT-PCR was carried out. The results of the present study revealed the expression of TET1 in 5-aza treatment cells higher than control cells (P < 0.0001). Additionally, the treatment of HT29 cell by 5-aza (1.25 for 72 h) significantly attenuated the expression of the Wnt1 genes compare to the HT29 (p < 0.0001) (Fig. 2). The finding that 5-aza can increase the expression of TET1 in CRC cells is consistent with previous studies indicating that 5-aza can upregulate the expression of TET1 and other TET family members in various types of cancer cells [18]. Additionally, it was shown that 5-aza was able to suppress wnt/β-catenin, which was attributed to the attenuated growth and proliferation of cancer cell [19]. Therefore, downregulation of Wnt1 expression could be a consequence of the changes in DNA methylation patterns induced by 5-aza. The DNA methylation mechanism silences gene expression by adding methyl groups to specific regions of the genome. In CRC cell lines, 5-aza inhibits DNA methylation, potentially altering the methylation status of Wnt signaling pathway genes, thereby inhibiting Wnt1 expression.

However, we did not observe significant changes in Wnt1 expression in either polyp or tumor samples. The regulation of Wnt1 in CRC is a complex process influenced by various factors, including the tumor microenvironment, genetic characteristics of tumor cells, and interactions with other signaling pathways. It's important to note that studies on Wnt1 expression in CRC tissues have yielded mixed results. While most studies have reported increased Wnt1 expression in CRC tissues compared to normal colorectal mucosa, highlighting its significant role in promoting tumor growth, invasion, metastasis, and chemotherapy resistance, some studies have observed a lack of expression [20]. This suggests that the regulation of Wnt1 in CRC is multifaceted and can vary depending on specific factors.

Measurement of miR-200b and miR-494 expression level by qRT–PCR

The microRNA expression plays a pivotal role in the progression of CRC, and extensive scientific investigations have explored the mechanisms responsible for this alteration. DNA methylation is a significant contributor to the regulation of microRNA expression in CRC. This epigenetic modification commonly occurs during CRC progression and profoundly influences microRNA expression. We found that the expression of miR-494 in CRC tissues was found to be significantly increased compared to the adjunct tissues, which was associated with TET1 down-regulation in CRC tissues. Ain addition, this elevated miR-494 expression was inversely correlated with the expression of the adenomatous polyposis coli (APC) gene, and thus miR-494 directly targets APC in CRC. Interestingly, an overabundance of miR-494 has been observed to stimulate the Wnt/β-catenin signaling pathway by affecting APC, thereby promoting the growth of CRC cells [21]. The results showed a significant increase of miR-494 expression in its expression in the CRC tissue samples compared to adjacent normal tissue (P = 0.025). In our data, there wasn’t a significant upregulation compare to the adjunct samples. It appears that this may be attributed to the absence of distinct group separation among polyps in this study. Similarly, in a study involving invasive human hepatocellular carcinoma tumors, it was observed that miR-494 can induce the silencing of multiple invasion-suppressor miRNAs. This silencing mechanism operates by inhibiting genomic DNA demethylation through direct targeting of TET1. Consequently, this process contributes to the initiation of tumor vascular invasion [22]. Therefore, it seems miR-21 promoted growth of CRC cells by inhibiting TET1 expression and stimulating Wnt/β-catenin signaling pathway.

MiR-200b, implicates in suppression of CRC and is often silenced by DNA hypermethylation [23]. Extensive prior research has shown that the miR-200 family is subject to methylation, resulting in its silencing due to DNA hypermethylation in various cancers [24]. MiR-200 expression levels were assessed in both polyp and tumor samples, along with their respective adjacent normal tissues, with U6 serving as an internal control for normalization. The results revealed a significant decrease in the expression of the CRC tissue samples compared to adjacent normal tissue (P = 0.008) (Fig. 3). Our results revealed a significant downregulation of miR-200b in colorectal tumor tissues compared to adjacent normal tissues. This methylation-dependent silencing is consistent with our finding of reduced miR-200b expression in CRC tissues. Indeed, it can be hypothesis that down-regulation of TET1 is responsible for silencing of miR-200b. MiR-200b has been linked to the regulation of key signaling pathways involved in CRC development, particularly the Wnt signaling pathway [25]. However, the present data reveals that while miR-200b is downregulated in CRC tissue, there is not a significant downregulation observed in polyp samples. We recommend further evaluation in future studies. These findings may have important implications for uncovering molecular mechanism of CRC in future (Fig. 4).

In conclusion, our study sheds light on the dysregulation of TET1 and Wnt signaling in CRC. It underscores the critical role of TET1 in CRC initiation and progression, as well as the therapeutic potential of 5-aza in CRC by modulating TET1 expression. Notably, 5-aza upregulated TET1 expression and downregulated Wnt1 expression in CRC cell lines. This upregulation of TET1 expression may be attributed to the inhibition of DNA methyltransferase by 5-aza, increasing substrates for TET1 and enhancing its activity.

Furthermore, the expression of miR-200b and miR-494 which are involved in Wnt pathway and affecting in TET1 and Wnt1 were evaluated in both polyp and CRC tissue. However, further studies are needed to elucidate the precise mechanisms underlying of TET1 and Wnt signaling in CRC and to explore their potential as diagnostic and therapeutic targets. However, these findings may have important implications for the development of novel therapeutic strategies for CRC.

Wnt1: wingless-related integration site

CRC :Colorectal cancer

TET: Ten-eleven translocation

5-aza :5-azacitidine

APC: adenomatous polyposis coli

Competing interests

The authors declare no competing interests.

Ethics approval

We complied with the guidelines for human studies. Ethics approval for this study was granted by the Gastroenterology and Liver Research Center of Shahid Beheshti University of Medical Sciences (1392/704).

Consent to participate

Written consent was obtained from all participants’ identity is to be avoided.

Consent for publication

The authors affirm that human research participants provided informed consent for publication of the images in Figures.

Funding

This project was completely supported and funded by the Gastroenterology and Liver Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences.

Author Contribution

Authors' contributionsEhsan Nazemalhosseini Mojarad and Sanaz savabkar participated in the study design. Sanaz savabkar, Neda Zali, Meysam Jalili, and Morteza Valinezhad collected the tissue samples. Raziye Tajali, Neda Zali, Farnaz ghasemian prepared lab work and did cellular experiments. Raziye Tajali, Neda Zali, Meysam Jalili and Morteza Valinezhad participated in RT-qPCR analysis and statistical analysis. Fatemeh Naderi noukabadi, Sanaz savabkar participated in the data gathering. Fatemeh Naderi noukabadi and Makan Cheraghpour contributed extensively to interpreting the data and the conclusion. All authors participated in writing the original draft and performed editing and approving the final version of the manuscript for submission.

Acknowledgements

The authors are grateful to the Gastroenterology and Liver Diseases Research Centre, Shahid Beheshti University of Medical Sciences, for all their financial support and patience.

Vital, M., et al., Genetic and epigenetic characteristics of patients with colorectal cancer from Uruguay. Pathology-Research and Practice, 2023. 241: p. 154264.
Moore, L.D., T. Le, and G. Fan, DNA methylation and its basic function. Neuropsychopharmacology, 2013. 38(1): p. 23-38.
Yassi, M., et al., DMRFusion: a differentially methylated region detection tool based on the ranked fusion method. Genomics, 2018. 110(6): p. 366-374.
Tahiliani, M., et al., Conversion of 5-methylcytosine to 5-hydroxymethylcytosine in mammalian DNA by MLL partner TET1. Science, 2009. 324(5929): p. 930-935.
Branco, M.R., G. Ficz, and W. Reik, Uncovering the role of 5-hydroxymethylcytosine in the epigenome. Nature Reviews Genetics, 2012. 13(1): p. 7-13.
Bray, J.K., et al., Roles and regulations of TET enzymes in solid tumors. 2021. 7(7): p. 635-646.
Wu, M.-Z., et al., Hypoxia drives breast tumor malignancy through a TET–TNFα–p38–MAPK signaling axis. Cancer research, 2015. 75(18): p. 3912-3924.
Neri, F., et al., TET1 is a tumour suppressor that inhibits colon cancer growth by derepressing inhibitors of the WNT pathway. Oncogene, 2015. 34(32): p. 4168-4176.
Mohammadpour, S., et al., Non-coding RNAs in Precursor Lesions of Colorectal Cancer: Their Role in Cancer Initiation and Formation. Current Molecular Medicine, 2024.
Zhang, Y., et al., MicroRNA-494 promotes cancer progression and targets adenomatous polyposis coli in colorectal cancer. Molecular cancer, 2018. 17: p. 1-11.
Wang, F.-W., et al., APC-activated long noncoding RNA inhibits colorectal carcinoma pathogenesis through reduction of exosome production. The Journal of clinical investigation, 2019. 129(2): p. 727-743.
Zhang, W., et al., miRNA-185 serves as a prognostic factor and suppresses migration and invasion through Wnt1 in colon cancer. European journal of pharmacology, 2018. 825: p. 75-84.
Grady, W.M. and S.D. Markowitz, The molecular pathogenesis of colorectal cancer and its potential application to colorectal cancer screening. Digestive diseases and sciences, 2015. 60: p. 762-772.
Rawłuszko-Wieczorek, A.A., et al., Clinical significance of DNA methylation mRNA levels of TET family members in colorectal cancer. Journal of cancer research and clinical oncology, 2015. 141: p. 1379-1392.
Tian, Y., et al., Association of TET1 expression with colorectal cancer progression. 2017. 52(3): p. 312-320.
Qi, J., et al., Targeting Wnt/β-catenin signaling by TET1/FOXO4 inhibits metastatic spreading and self-renewal of cancer stem cells in gastric cancer. Cancers, 2022. 14(13): p. 3232.
Kai, M., et al., TET1 depletion induces aberrant CpG methylation in colorectal cancer cells. 2016. 11(12): p. e0168281.
Manzoni, E.F., et al., 5-azacytidine affects TET2 and histone transcription and reshapes morphology of human skin fibroblasts. Scientific reports, 2016. 6(1): p. 37017.
Zhang, H., et al., 5-Azacytidine suppresses the proliferation of pancreatic cancer cells by inhibiting the Wnt/β-catenin signaling pathway. Genet Mol Res, 2014. 13(3): p. 5064-72.
Nie, X., et al., Emerging roles of Wnt ligands in human colorectal cancer. 2020. 10: p. 1341.
Zhang, Y., et al., MicroRNA-494 promotes cancer progression and targets adenomatous polyposis coli in colorectal cancer. 2018. 17(1): p. 1-11.
Chuang, K.H., et al., MicroRNA‐494 is a master epigenetic regulator of multiple invasion‐suppressor microRNAs by targeting ten eleven translocation 1 in invasive human hepatocellular carcinoma tumors. 2015. 62(2): p. 466-480.
Klicka, K., et al., The role of miR-200 family in the regulation of hallmarks of cancer. 2022. 12: p. 965231.
Casalino, L. and P.J.G. Verde, Multifaceted roles of DNA methylation in neoplastic transformation, from tumor suppressors to EMT and metastasis. 2020. 11(8): p. 922.
Chen, L., et al., miR‑200b‑3p inhibits proliferation and induces apoptosis in colorectal cancer by targeting Wnt1. 2018. 18(3): p. 2571-2580.

Table 1. Basic characteristics of subjects

Variable

N

Sex

Male

Female

53

61

Age

≤ 50

> 50

15

99

BMI

9/24-5/18

9/29-25

9/34-30

59

48

7

Smoking

Yes

No

7

107

Tumor

Polyp

47

67

Location

Colon

Rectum

105

9

Blood pressure

Yes

No

11

103

IBD

Yes

No

10

104

Table 2. Details of the primer pairs used in this study.

Gene or miRNA name	Primer	Sequences (5'→3')
TET1	Forward	TCTTGTCCTCCCAAAGTGCT
TET1	Reverse	TGCCTGTCATGCTGTCTT
Wnt1	Forward	GCCCAGGTTGTAATTGAAGC
Wnt1	Reverse	TGAGAAAGTCCTGCCAGTTG
GAPDH	Forward	CCTTCATTGACCTCAACTACATG
GAPDH	Reverse	TGGGATTTCCATTGATGACAAGC
miR-200b	Forward	AAGTAACCTCCAGAGCCC
miR-200b	Reverse	GTGGGTCTCAGGATCGG
miR-494	Forward	CATAGCCCGTGAAACATACACG
miR-494	Reverse	GTGCAGGGTCCGAGGT
U6	Forward	TGACCTGAAACATACACGGGA
U6	Reverse	TATCGTTGTACTCCACTCCTTGAC

No competing interests reported.

The implication of TET1, miR-200 and miR-494 expression with tumor formation in colorectal cancer: through targeting WNT signaling

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Cell culture and treatment

Cell viability assay

Patient samples

RNA isolation, reverse transcription, and real-time quantitative polymerase chain reaction (qRT-PCR) analysis

Statistical analysis

Results and Discussion

Measurement of TET1 and wnt1 gene expression level by

Measurement of miR-200b and miR-494 expression level by qRT–PCR

Conclusions

Abbreviations

Declarations