Animals
Approval of animals experiments was obtained from Guidelines for the Ethics Care of Laboratory Animals of Shandong Provincial Third Hospital. We injected Y79 cells into nude mice to form subcutaneous tumors, and subsequently with administration of rhsi-GDF15 (0.1 mg/kg) [18] via coccygeal veins. Twenty days later, we sacrificed the mice were through cervical dislocation and harvested tumors. We applied precision balances to measure tumor weights and calculated tumor volumes as length × width × width/2 [19].
Cell culture and transfection
HRECs were obtained from American Type Culture Collection (ATCC, Manassas, VA) and maintained in endothelial growth medium (C1556; Sigma–Aldrich, St. Louis, MO) plus penicillin–streptomycin and 10% fetal bovine serum (FBS). HRECs were cultured on dishes coated by 10mg/ml of fibronectin. Y79, RB116 and WERI-Rb1 (ATCC) were cultured in RPMI1640 medium supplemented with 10% FBS [20]. Si-GDF15 was obtained from Hollybio Biotechnology Company (Shanghai, China) and transfected into cells by lipofectamine 3000 (Invitrogen) as past studies described [21].
Si-GDF15-F: AGUCUUUGGCUAACAAGUCAU
Si-GDF15-R: GACUUGUUAGCCAAAGACUGC
Real-time PCR
As manufacturer’s protocol described, we applied TRIzol (Invitrogen) to extract total RNA from cells of different groups. Transcriptor First Strand cDNA Synthesis Kit (Roche, USA) was applied to reversely transcript 1µgRNA into cDNA for cDNA synthesis. We used FastStart Universal SYBR Green Master (ROX) and ABI PRISM 7500 Real-time PCR System (Applied Biosystems, Foster City, CA, USA) to conduct qPCR after mixing the specific primers and 20 ng cDNA. The primer sequences applied in our study were as follows:
GAPDH-primer-F: CTCTGCTCCTCCTGTTCGAC
GAPDH-primer-R: CGACCAAATCCGTTGACTCC
HIF-1α-primer-F: GAACGTCGAAAAGAAAAGTCTCG
HIF-1α-primer-R: CCTTATCAAGATGCGAACTCACA
SDF-1-primer-F: ATTCTCAACACTCCAAACTGTGC
SDF-1-primer-R: ACTTTAGCTTCGGGTCAATGC
Scratch assay
We further assessed cell migration with scratch assay. In brief, we plated HRECs or retinoblastoma cells onto 6-well plates and preserved them to 90% confluence. As described previously, subsequently we scratched the cell monolayers with a 100 µl pipette tip to establish a non-cell regions [22]. Cells were washed by phosphate buffer saline three times and subsequently incubated in DMEM (mixing 4% FBS) for 48h. We applied ImageJ software (National Institutes of Health, Bethesda, MA, USA) to photograph the non-cell areas and measure the rate of the closured space.
CCK8 assay
We applied Cell Counting Kit‑8 assay to evaluate the cell viabilities of HRECs. According to previous studies, growing cells (3x103 /ml, 50 µl) were inoculated on a 96-well plate and cultured at room temperature for 72 h. After the beginning of incubation, we added WST-8 Solution (10 µl/well) to every well each 24 hours. After incubation at 37˚C for another 4 hours, we added DMSO (200 µl) to every well, and measured the optical density at 460 nm using a microplate reader to evaluate the cell viability with the different conditions [21].
Flow cytometry and apoptosis detection
We applied the Annexin V‑fluorescein isothiocyanate (FITC) Apoptosis Detection kit (Jingmei Biotech Co., Ltd., Beijing, China) to evaluate the role of rhGDF15 or GDF15 downregulation in the apoptosis process. The FACScan flow cytometer (Accuri™ C6; BD Biosciences) was used to assess the apoptosis rates; Apoptotic cell rate = the late apoptosis rate + the early apoptosis rate (the sum of right upper quadrant-percentage of late apoptotic cells and right lower quadrant - percentage of early apoptotic cells).
Tube formation assay
The conditioned mediums of HRECs or transfected with si-GDF15 (48h subsequent to transfection). We added 1×105 HRECs into the collected conditioned mediums and then put them in a 24-well plate. We applied the bright-field microscope to detect the results of tube formation 24h subsequent to culture.
Western blot
We extracted the total proteins by centrifugation from different tissues or cells samples. The lysate proteins (50 µg) were separated through SDS-PAGE and then transferred to the nitrocellulose membranes. Nitrocellulose membranes were sealed by 5% skim dry milk for 2h and subsequently incubated by various primary antibodies. The protein bands were incubated by horseradish peroxidase-conjugated antibodies and detected by enhanced chemiluminescence reagent. The p-AKT (Ser473, 1:1000, dilution), p-AKT (Thr308, 1:1000, dilution), AKT (1:1000, dilution), p-ERK1/2 (Thr202/Tyr204, 1:1000, dilution), ERK1/2 (1:1000, dilution), HIF-1α (1:1000, dilution), SDF-1 (1:1000, dilution) were obtained from Abcam (Cambridge, MA, USA).
Statistical analysis
We analyzed all data as the mean ± standard deviation (SD). The statistical significances were assessed by Student's t test or ANOVA using SPSS 21.0 (IBM SPSS, USA). P<0.05 could be regarded as significant difference.