Comparative analysis of EGFR mutations between circulating tumor DNA and tissue samples in non-small cell lung carcinoma patients using BEAMing PCR: results of a single institutional observational study

doi:10.21203/rs.3.rs-5070429/v1

In this study we measured the human epidermal growth factor receptor (EGFR) mutations in both tissue and circulating tumor DNA (ctDNA) by using beads, emulsion, amplification and magnetics polymerase chain reaction (BEAMing PCR). Noninvasive mutation detection by assessing circulating tumor DNA (ctDNA) offers many advantages over tumor biopsy. One hundred non-small cell lung cancer (NSCLC) patients were enrolled and both preoperative plasma samples and formalin-fixed and paraffin embedded (FFPE) samples were collected for the study. EGFR mutation status was determined by BEAMing PCR in ctDNA. Real-time quantitative PCR (qPCR) data were collected from our hospital database (EMR-qPCR, Electronic Medical Records) for comparative analysis. Additionally, qPCR was also done from FFPE tissues using Diatech EGFR qPCR kit. The positive concordance rate was 98.8%, 100% and 95.5% for exon 19, 20 and 21 respectively when BEAMing data were compared with EMR-qPCR data. Additionally, when BEAMing and Diatech qPCR data were compared we obtained 90%, 100%, 96% and 98% respectively for exon 19, 20, 21 (L858R) and 21 (L861Q). For both the comparisons, the value of Cohen’s kappa agreement showed significant results. The advantage of BEAMing is its ability to identify mutated DNA sequence in the cancer cells in the background of normal cell DNA contamination. This could be useful for disease monitoring and progression.

EGFR

NSCLC

ctDNA

BEAMing

qPCR

Lung cancer remains the leading cause of cancer related death worldwide despite several advances in therapies with only 15% patients survive beyond 5 year (1). Adenocarcinoma constitutes the most common histologic subtype among the non-small cell carcinomas (NSCLC) (2). Majority of these patients present with locally advanced or metastatic disease and are not fit for surgical resection. Epidermal growth factor receptor (EGFR) gene is located on the short arm of chromosome 7 (7p 11.2) and encodes a 170KDa type I trans-membrane growth factor receptor with tyrosine kinase (TK) activity (3). EGFR belongs to the HER/erbB family of receptor tyrosine kinases (RTKs), which includes HER1 (EGFR/erbB1), HER2 (neu, erbB2), HER3 (erbB3) and HER4 (erbB4). They have an extracellular, cystein-rich ligand binding domain; a single a-helix transmembrane domain; a cytoplasmic TK domain (in all receptors except HER3) and a carboxy terminal signaling domain (4).

Several oncogenic mechanisms, including EGFR gene mutation, increased gene copy number, and EGFR protein overexpression contributes to the dysregulation of EGFR-TK activity (5). There are two types of mutations reported mostly in the TK domain of EGFR (6, 7)-- short deletions in exon 19 and point mutations (G719S, L858R, and L861Q) in exons 19, 20 and 21. When not active, the EGFR kinase domain assumes a structure that prevents its activation (8). Mutationsresult in the destabilization of its domain conformation, constitutive activation of its kinase activity, and activation of its downstream signaling pathways (9,10) like AKT and STAT, which have crucial anti-apoptosis functions for cell survival (11). Mutations in EGFR gene have become crucial in predicting the effect of EGFR tyrosine kinase inhibitors (TKIs) in NSCLC patients.

EGFR mutation detection is usually carried out by invasive approaches like surgical resection of the tumor tissue or needle biopsy (12). Because of the highly heterogenous nature of the lung, analysis of the EGFR mutations could be confusing and misleading. Detection and monitoring of cancer-specific somatic gene mutations in the circulating tumor DNA (ctDNA), is a minimally invasive alternative to a tissue biopsy that has shown promise in overcoming some of the challenges associated with sampling from tissue (13)

Recent data have shown that EGFR mutations can be found in plasma-derived cell-free DNA (cfDNA) from NSCLC patients. Moreover, studies have confirmed that EGFR mutations from plasma can predict the clinical response to targeted therapy (14, 15). Several studies had suggested that the analysis of cell-free plasma DNA is a clinically useful alternative (16,17,18,19).

In the present study, we describe the results of an observational study using bead-based PCR assay (Beads, Emulsion, Amplification and Magnetics, BEAMing) to detect different activating (exon 19, 21) and resistant EGFR mutations (exon 20) in ctDNA derived from the peripheral blood of the lung cancer patients. We also evaluate our results to see the percent agreement between methods (standard qPCR) for the detection of EGFR mutations done on tumor tissues using commercially available kits. To our available information, this is one of the largest studies done at our hospital to compare available methodologies designed for noninvasive EGFR mutation testing and to evaluate the concordance between them. It promises a sensitive and reliable approach to detect mutations at an early stage of the disease.

(i) Patient samples and cell lines:

This study was approved by the Institutional Review Board of ACTREC-Tata Memorial Centre, India. Patients with activating EGFR mutations in tumor tissues were selected following a biopsy examination between 2017 and April 2020 (Table1). Peripheral blood was collected from 100 patients with lung cancer treated at Tata Memorial Centre-ACTREC, India. Research was conducted following Good Clinical Practice. All patients were provided with written informed consent prior to participation. Total genomic DNA isolated from PC9, H1975 and A549 NSCLC cell lines (kind gift from Dr. Amit Dutt, ACTREC) were used as controls. Formalin-fixed paraffin embedded tumor tissue was obtained from each subject and processed by the Surgical Pathology Laboratory using routine procedures.

(ii) Isolation of circulating tumor DNA (ctDNA):

Blood was drawn into EDTA tubes (for plasma). Each time 10ml blood was collected. Within one hour, the tubes were subjected to centrifugation at 820g for 10 min. 1ml aliquots of the plasma was transferred to 1.5ml tubes and centrifuged at 16,000g for 10 min to pellet any remaining cellular debris. Supernatants were transferred to fresh tubes and stored at -80°C. Total genomic DNA was extracted from 1ml plasma using DNA Micro kit (Qiagen) according to the manufacturer’s instructions.

(iii) Quantification of total plasma DNA:

The isolated ctDNA concentration was estimated using Nanodrop ND1000 spectrophotometer.

Table 1: Patient characteristics

Characteristics	Number (%)
Age (years)
Mean	53.07
Median	54
Sex
Male	67 (67%)
Female	33 (33%)
Pathological diagnosis
Adenocarcinoma	45
Metastatic adenocarcinoma	42
Metastatic squamous carcinoma	2
Mucoepidermoid carcinoma	1
Squamous carcinoma	8
Hepatoid carcinoma	1
Not determined	1

(iv) Sensitivity and specificity assay:

Sensitivity and specificity of the BEAMing reaction was done before starting the actual assay. In this, different percentages of mutant DNAs from cell lines harbouring specific mutations were mixed in the background of wild-type DNA. Emulsion based BEAMing PCR was done and hybridized samples were run in FACSArea III to detect mutant and wild type populations.

(v) BEAMing and EGFR mutation detection:

We have used different primer sets for the mutation analysis according to Taniguchi et al (21) (Table 2). The DNA purified from the plasma was used for each BEAMing assay. Initially an amplification with a high-fidelity DNA polymerase was performed in eight separate 25μl PCR reactions each containing template DNA from 250μl of plasma, 5× Phusion High Fidelity PCR buffer (NEB), 1.5U of Hotstart Phusion polymerase (NEB), 0.2μM of each primer, 0.25mM of each dNTP, and 0.5mM MgCl2. Temperature cycling was: 98°C 30s, 35 x (98°C 10 s, 57°C 10 s, 72°C 10s). PCR products were pooled and quantified using the Nanodrop spectrophotometer. Emulsion PCR was performed as follows (21). Briefly, a 150μl PCR mixture was prepared containing 18pg template DNA, 40U of Platinum Taq DNA polymerase (Invitrogen), 1× PCR buffer, 0.2mM dNTPs, 5mM MgCl₂, 0.05μM Tag1 (5’-tcccgcgaaattaatacgac-3'), 8μM Tag2 (5’-gctggagctctgcagcta-3') and ~6x10⁷ magnetic streptavidin beads (MyOne, Invitrogen) coated with Tag1 oligonucleotide (5’-dual biotin-T-Spacer18- tcccgcgaaattaatacgac-3'). The 150μl PCR reaction, 600μl oil/emulsifier mix (7% ABIL WE09, 20% mineral oil, 73% Tegosoft DEC (Evonik) and one 5 mm steel bead (Qiagen) were added to a 96 deep well plate 1.2ml (Abgene). Emulsions were prepared by shaking the plate in a TissueLyser (Qiagen) for 10s at 15Hz and then 7s at 17Hz. Emulsions were dispensed into eight PCR wells and temperature cycled at 94°C for 2 min; 3 cycles of 94°C for 10s, 68°C for 45s, 70°C for 75s; 3 cycles of 94°C for 10s, 65°C for 45s, 70°C for 75s, 3 cycles of 94°C for 10s, 62°C for 45s, 70°C for 75s; 50 cycles of 94°C for 10s, 57°C for 45 s, 70°C for 75 s. To break the emulsions, 150μl breaking buffer (10mM Tris-HCl, pH 7.5, 1% Triton-X 100, 1% SDS, 100mM NaCl, 1mM EDTA) was added to each well and mixed with a TissueLyser at 20Hz for 20s. Beads were recovered by spinning the suspension at 3,200g for 2min and removing the oil phase. The breaking step was repeated twice. All beads from 8 wells were consolidated and washed with 150μl wash buffer (20mM Tris-HCl, pH 8.4, 50mM KCl). The DNA on the beads was denatured for 5 min with 0.1M NaOH. Finally, beads were washed with 150μl wash buffer and resuspended in 150μl of the same buffer. The mutation status of DNA bound to beads was determined by allele-specific hybridization.

Table 2: Primer Sequences

Exon	Name	Sequence (5'-3')	Modifications	Target
Primers for Exon amplification
Exon 19	Tag1-19del	TCCCGCGAAATTAATACGACAAGTTAAAATTCCCGTCGCTATC		EGFR exon 19
	Tag2-19del	GCTGGAGCTCTGCAGCTAGACCCCCACACAGCAAAG		EGFR exon 19
Exon 20	Tag1-T790M	TCCCGCGAAATTAATACGACGCATCTGCCTCACCTCCAC		EGFR exon 20
	Tag2-T790M	GCTGGAGCTCTGCAGCTAAGCAGGTACTGGGAGCCAAT		EGFR exon 20
Exon 21	Tag1-L858R	TCCCGCGAAATTAATACGACAGCCAGGAACGTACTGGTGA		EGFR exon 21
	Tag2-L858R	GCTGGAGCTCTGCAGCTATGCCTCCTTCTGCATGGTAT		EGFR exon 21
Emulsion PCR primers
	Tag1-F	TCCCGCGAAATTAATACGAC
	Tag2-R	GCTGGAGCTCTGCAGCTA
Hybridization probe for BEAMing
Exon 19	19del_35_49_Cy5	GGAGATGTTTTGATAGCG	5′ Cy5	exon 19 E746-A750del
	19del_36_50_Cy5	CGGAGATGTCTTGATAGC	5′ Cy5	exon 19 E746-A750del
	19del_40_57 Cy5	TGGCTTTCGATTCCTTGA	5′ Cy5	exon 19 L747-S752del.P753S
	19del_AATTCC_ Cy5	TGTTGCTTCTCTTGGAATT	5′ Cy5	exon 19 E746-L747del.IP
	19del_36_55_T_ Cy5	GCTTTCGGAACCTTGATAG	5′ Cy5	exon 19 L747-S752del. E746V
	19del_35_53_ACT_ Cy5	GGAGAAGTTTTGATAGCG	5′ Cy5	exon 19 K745-E749del.A750K
	19del_39_56_CAG_ Cy5	TTTCGGCTGTTCCTTGAT	5′ Cy5	exon 19 L747-T751del.S752Q
	19del_39_48_C_ Cy5	GAGATGTTGGTTCCTTGAT	5′ Cy5	exon 19 L747-E749del.A750P
	19del_WT_488	TGTTGCTTCTCTTAATTCC	5′ Alexa488	exon 19 wild-type control
Exon 20	T790M_Mut- Cy5	atgagctgcAtgatgag	5′ Cy5	T790Mmutation
	T790M_WT-488	tgagctgcGtgatgag	5′ Alexa488	Wild-type control for T790M
Exon 21	L858R_Mut_LNA_ Cy5	gtttggccCgcccaaaat	5′ Cy5	L858Rmutation
	L858R_WT_LNA_488	gtttggccAgcccaaaat	5′ Alexa488	Wild-type control for L858R
	L861Q_Mut_Cy5	cacccagcTgtttggcc	5′ Cy5	L861Q mutation
	L861Q_WT_488	cacccagcAgtttggcc	5′ Alexa488	Wild-type control for L861Q

Fluorescently labeled probes complementary to the mutant and wild-type DNA sequences were designed for different mutations (Table 2). The size of the probes ranged from 15 to 18nt. All mutant probes were coupled to a Cy5 fluorophore and all wild-type probes were coupled to a Alexa488 fluorophore at their 5' ends (Integrated DNA Technologies). Each allele-specific hybridization reaction contained ~1x10⁷ beads in 30μl wash buffer, 66μl of 1.5× hybridization buffer (4.5M tetramethylammonium chloride, 75mM Tris-HCl pH 7.5, 6mM EDTA), and 4μl of a mixture of mutant and wild-type probes, each at 5μM in TE buffer. The hybridization mixture was heated to 70°C for 10s and slowly (0.1°C/s) cooled to 35°C. After incubating at 35°C for 2 min, the mixture was cooled (0.1°C/sec) to room temperature. The beads were collected with a magnet and the supernatant containing the unbound probes was removed using a pipette. The beads were resuspended in 100μl of 1× hybridization buffer and heated to 48°C for 5 min to remove unbound probes. After the heating step, beads were again separated magnetically and washed once with 100μl wash buffer. In the final step, the supernatant was removed and beads were resuspended in 200μl TE buffer for flow cytometric analysis. FACSAria III flow cytometry system (BD Bioscience) equipped with a high throughput autosampler was used for the analysis of each bead population. An average of 1×10⁶beads were analyzed for each plasma sample.

(vi) Real time PCR from formalin fixed paraffin embedded (FFPE) tissue DNA:

Paraffin blocks were collected from the Department of Pathology, Tata Memorial Hospital. Presence of tumor tissues in the blocks were confirmed by the Pathologists. A total of 50-100μm sections were used for the extraction of DNA. The sections were deparaffinized and stained with hematoxylin and eosin. All specimens had undergone histological examination to confirm the presence of tumor tissue. The dissected tumor tissues were digested overnight at 60°C in 180μl ATL buffer (Qiagen) and 20μl Proteinase K (50 mg/ml; Invitrogen). DNA was isolated using the QIAamp FFPE DNA Kit (Qiagen) following the manufacturer’s protocol. The median quantity of extracted FFPE-DNA was estimated using a Nanodrop spectrophotometer. The presence of the most commonly found EGFR mutations was determined by real-time quantitative PCR (qPCR) based-approach using Easy EGFR PCR kit (Diatech Pharmacogenetics srl, Italy).

(vi) Statistical Analysis:

Statistical analysis was performed using IBM SPSS Windows version 20.0 software. Diagnostic measures such as sensitivity, specificity and accuracy were calculated. McNemar’s test was used to test the statistical significance of the difference between BEAMing compared to EMR qPCR data as well as with Easy line qPCR data. Kappa statistics were used to assess symmetry scores for the two methods. The interpretation of the kappa values was based on data according to Altman (21) (22).

(i) Concentration of ctDNA:

We could effectively isolate ctDNA from the plasma of all the samples. The lowest and highest concentration was 5.2 and 31.23ng/mL with a mean of 15.74 (Figure 1). Moreover, the mean of A260/280 ratio of the samples was 1.81 (Figure 2).

(ii) Analysis of accuracy and sensitivity of BEAMing using cell line DNA:

We first determined the accuracy and sensitivity of the assay using a mixture of DNA from PC9 cell line for exon 19 mutation and H1975 cell line for exon 20 and 21 mutations. Each PCR mixture contained a total of 100 ng of DNA, which were used as templates for the genomic and subsequently BEAMing emulsion PCR assay. Wild type EGFR DNA from A549 cells were mixed with mutated EGFR DNA fragment (PC9 for Exon 19, H1975 for Exon 20 and 21 in separate tubes) at 1% and 0.1% ratio. These preparations were then subjected to BEAMing PCR. The mutated DNA fractions were estimated by the ratio of the numbers of beads labelled with Alexa 647 (mutant) to those labelled with Alexa 488 (wild-type). For the limit of detection, our assay was able to detect mutant EGFR alleles for samples containing as little as 0.1ng of mutant DNA per 100ng of DNA. Below this concentration, there was no amplification of the mutant allele (Figure 3).

(iii) Mutation assay by BEAMing and its comparison with hospital qPCR data:

BEAMing PCR was carried out on 100 ctDNA samples for the detection of different mutations on EGFR exon 19, 20 and 21. Real time PCR (Therascreen) data were collected from our hospital database (EMR-qPCR, Electronic Medical Records). Additionally, qPCR assay was done with the available FFPE tissues using EasyLine qPCR kit (Diatech-qPCR). In BEAMing, after the hybridization, the samples were run in FACSAria III for the presence of mutations. Percentage true positives and true negatives was calculated with respect to the EMR-qPCR and Diatech-qPCR data (Table 3 and 4). When BEAMing data were compared with EMR-qPCR data, our results showed 98.8%, 100% and 95.4% positive concordance for exon 19, 20 and 21 respectively (Table 3). Moreover, when BEAMing and Diatech-qPCR data were compared, we found 90%, 100%, 96% and

Table 3. BEAMing vs EMR-qPCR crosstabulation for EGFR exon19, 20 and 21

		BEAMing-Exon 19
		Negative	Positive	Total	P value¹	Kappa	P value²
EMR-qPCR Exon 19	Negative	65 (74.7%)	1 (1.1%)	66 (75.9%)	1	0.969	<0.001
	Positive	0 (0%)	21 (24.1%)	21 (4.1%)
	Total	65 (74.7%)	22 (25.3%)	87 (100%)

		BEAMing-Exon 20
		Negative	Positive	Total	P value¹	Kappa	P value²
EMR-qPCR Exon 20	Negative	94 (98.9%)	0 (0%)	94 (98.9%)	1	1	<0.001
	Positive	0 (0%)	1 (1.1%)	1 (1.1%)
	Total	94 (98.9%)	1 (1.1%)	95 (100%)

		BEAMing-Exon 21
		Negative	Positive	Total	P value¹	Kappa	P value²
EMR-qPCR Exon 21	Negative	75 (86.2%)	1 (1.1%)	76 (87.4%)	0.625	0.774	<0.001
	Positive	3 (3.4%)	8 (9.2%)	11 (12.6%)
	Total	78 (89.7%)	9 (10.3%)	87 (100%)
¹P value calculated using McNemar test
²P value calculated for Kappa statistics

98% positive concordance for exons 19, 20, 21-L858R and 21-L861Q respectively (Table 4). The main aim was to compare our EMR-qPCR data with BEAMing assay using ctDNA to see it as an early and additional or supplementary diagnostic approach of EMR-qPCR as well as Diatech qPCR, thereby saving time and repeat biopsies. When BEAMing and EMR-qPCR were compared, the values for Cohen’s kappa was 0.969, 1.000 and 0.774 (Table 3) for exon 19, 20 and 21 respectively. This represents the proportion of agreement between the two methodologies beyond the agreement occurring due to chance. In this case, the P-value of p<0.001 suggests that the kappa value is statistically highly significant from zero. This does not imply statistically significant agreement and we interpreted the magnitude of agreement from the reported kappa value. To assess the level of agreement between two methodologies we interpreted the kappa value based on definitions outlined by Altman (22). Our results showed good (0.969 and 0.774 for exon 19 and 21 respectively) and very good strength of agreement (1.000 for exon 19) between the two methodologies (BEAMing vs EMR-qPCR). Moreover, kappa score was also calculated for different exons when BEAMing and Diatech-qPCR methods were compared. For exon 19, the kappa score was 0.648 and for exon 21-L858R it was 0.778. Both the values showed significant symmetry. No statistics were computed because Diatech kit-Exon 20 vs BEAMing-Exon 20 and Diatech kit_L861Q Exon 21 were constants (Table 4). Since the P value is larger than the significance level (P<0.001), we cannot reject null hypothesis and assume that there is no significant difference between BEAMing vs EMR-qPCR and BEAMing vs Diatech-qPCR assay. Hence, from above results we conclude that there is concordance between BEAMing and EMR-qPCR and Diatech-qPCR. However, we also detected few false positives and false negatives in our assay (Table 3 and 4). This could be because of deamination of nucleotides in FFPE samples which causes the C:G>T:A change, that, in turn, yields a false-positive mutation result (22). To prevent this, uracil DNA glycosylase (UDG), which cleaves deaminated cytosine (uracil) should be used which was not included in the kit. The results for comparison between exon 20 T790M qPCR and BEAMing and Diatech kit data were not estimable since, all the cases were negative in one of the comparative machines.

Table 4. BEAMing vs Diatech-qPCR crosstabulation for EGFR exon19, 20 and 21

		BEAMing-Exon 19
		Negative	Positive	Total	P value¹	Kappa	P value²
Diatec-qPCR Exon 19	Negative	39 (78%)	1 (2%)	40 (80%)	0.375	0.648	<0.001
	Positive	4 (8%)	6 (12%)	10 (20%)
	Total	43 (86%)	7 (14%)	50 (100%)

		BEAMing-Exon 20
		Negative	Positive	Total	P value¹	Kappa	P value²
EMR-qPCR Exon 20	Negative	50 (100%)	0 (0%)	50 (100%)	---	---	----
	Positive	0 (0%)	0 (0%)	0 (0%)
	Total	50 (100%)	0 (0%)	50 (100%)

		BEAMing-Exon 21
		Negative	Positive	Total	P value¹	Kappa	P value²
Diatech-qPCR Exon 21ˍL858R	Negative	44 (88%)	1 (2%)	45 (90%)	1	0.778	<0.001
	Positive	1 (2%)	4 (8%)	5 (10%)
	Total	45 (90%)	5 (10%)	50 (100%)

		BEAMing-Exon 21
		Negative	Positive	Total	P value¹	Kappa	P value²
Diatech-qPCR Exon 21ˍL861Q	Negative	48 (98%)	1 (2%)	49 (100%)	---	---	---
	Positive	0 (0%)	0 (0%)	0 (0%)
	Total	48 (98%)	1 (2%)	49 (100%)

¹P value calculated using McNemar test
²P value calculated for Kappa statistics

Circulating tumor DNA testing to genotype NSCLC patients has facilitated improved care of EGFR mutation positive NSCLC lung cancer patients. In several studies ctDNA is widely considered an ideal material for obtaining tumor genetic information that can guide clinical treatment, especially in detecting genetic mutations. We have reported here that ctDNA is a promising biomarker for the early detection of EGFR mutations as well as following the course of therapy in NSCLC patients. We could effectively isolate and measure the ctDNA concentration from as many as 100 patient samples. However, whether ctDNA levels are exactly proportional to the tumor burden cannot be ascertained conclusively because of varying level and because there is no independent way to measure systemic total burden at this time (Figure 1 & 2). Many studies have shown the sensitivity of detecting gene mutations in plasma ctDNA is largely dependent on detection techniques. Among many techniques, BEAMing PCR was able to detect a very small amount of mutant DNA sequences in a larger pool of fragments containing wild-type DNA, in order of a single mutant allele in a background of 10,000 wild-type alleles, and it is able to enabling copy-number quantification (23, 24). The technique is based on a combination of emulsion digital PCR and flow cytometry, with beads, emulsification, amplification and magnetics to achieve the necessary level of sensitivity.

In the present study we were comparing the detection percentage and concordance between tissue EGFR qPCR techniques (both Therascreen and Diatech kit) with that of ctDNA BEAMing PCR. We had used the primer sets designed by Taniguchi et al (21) which could able to detect 8 different exon 19 mutations in addition to T790M exon 20 and L858R and L861Q exon 21 mutations. All the wild type primers were labeled with Alexa Fluor 488 probe and all the mutant probes were labeled with Cy5 probe (Table 2). As the fraction of mutant alleles in the isolated DNA were minimal, we first designed the sensitivity assay by mixing different percentages of mutant DNA in the background of wild type DNA to see whether BEAMing PCR could detect the mutant alleles. Our results showed that this assay could detect mutant alleles as low as 0.1% in the background of 99.9% of wild type allele. BEAMing PCR was done in all the samples. However, comparisons with Diatech qPCR could be done with lesser number of samples because of non-availability tumor tissues in the paraffin blocks (Table 3). Concordance percentage was high when BEAMing data were compared with both the qPCR data (Table 3 & 4). Since the P value is larger than significance level α=0.001, null hypothesis cannot be rejected and we can assume that there is no significant difference between BEAMing and EMR-qPCR or Diatech-qPCR methodology. Hence, from above results we conclude that there is high symmetry these methodologies. However, this study has several limitations. This was a single-institution study where sample size was small. Repeat biopsies were not performed where tissues were inadequate to do the qPCR. Based on the positive and meaningful results in this study, we can hereby conclusively say that BEAMing PCR from ctDNA is an effective and sensitive assay to know the mutation status of the EGFR gene in NSCLC patients. However, large sample studies involving thousands of patients in a multicentric setup is required to effectively determine the mutation. This will further validate the conclusion of the present study.

In summary, although clinical and radiographic characteristics associated with different histology subtypes of NSCLC have been identified, histology alone is unlikely to remain as the primary determinant in the selection of appropriate treatment. Results from a pilot study in breast cancer suggest that blood-based mutation analysis might be used to track patients’ response to therapy (25). This technique would provide an alternative to invasive biopsies that retrieve tumor tissue for analysis. Moreover, future treatment decisions for lung cancer are likely to be based on molecular subtypes reflecting tumor biology rather than clinical features or histologic subtypes. Discoveries linking two areas of seemingly unconnected research tend to reframe existing knowledge in ways that permit new interpretations and new understanding of the field of study addressed by this research.

NSCLC: Non-small cell lung carcinoma, EGFR: Epidermal growth factor receptor, BEAMing: Beads Emulsion Amplification and Magnetics, ctDNA: Circulating tumor DNA

Acknowledgments:

We would likely to thank Evonik corporation, Germany for providing the Tegosoft and Abil WE09. We thank Dr. Indraneel Mittra for providing the necessary laboratory space to carry out the work. Our special thanks to Mr. Satish Munnolli for plagiarism check of the manuscript with the iThenticate software and Ms. Pallavi Rane for helping in the statistical analysis of the data.

Funding Statement:

This study was supported by Department of Biotechnology, Govt of India (Grant No: BT/PR10867/MED/30/1419/2014) and TMC-TRAC (IEC No: 900117).

Conflict of Interest:

The authors declare that the research was conducted following good clinical practices and there is no conflict of interest amongst them.

Author’s Contribution:

RB conceived and designed the experiments, analyzed the data and written and approved the final manuscript. DM and NB performed the experiments and analyzed the data. KP, VN, AJ, CSP and JK was responsible for treatment and selection of patients. RKK and SR provided the tissue blocks and contributed for identifying the tumor samples by histopathology. All authors read and approved the final manuscript.

Ethics declarations:

This study was approved by ACTREC-TMC institutional review board and all participants provided informed consent.

Visbal, A.L., Williams, B.A., Nichols, F.C., III, Marks, R.S. et al. Gender differences in non–small-cell lung cancer survival: an analysis of 4,618 patients diagnosed between 1997 and 2002. Ann. Thorac. Surg. 78, 209-215 (2004)
Travis, W.D., Brambilla, E., et al. Pathology and Genetics of Tumors of the Lung, Pleura, Thymus and Heart, Oxford, UK. (Oxford Univ Press, 2004)
Yarden, Y. and Sliwkowski, M.X. Untangling the ErbB signaling network. Nat. Rev. Mol. Cell Biol. 2, 127–37 (2001)
Wells, A. EGF receptor. Int. J. Biochem. Cell Biol. 31, 637–43 (1999)
Ciardiello, F. and Tortora, G. EGFR antagonists in cancer treatment. N. Engl. J. Med. 358, 1160–74 (2008)
Lynch, T.J., Bell, D.W., Sordella, R., Gurubhagavatula, S., et al. Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small cell lung cancer to gefitinib. N. Engl. J. Med. 350, 2129–39 (2004)
Paez, J.G., Janne, P.A., Lee, J.C., Tracy, S., et al. EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science 304, 1497–500 (2004)
Zhang, X., Gureasko, J., Shen, K., Cole, P.A. and Kuriyan, J. An allosteric mechanism for activation of the kinase domain of epidermal growth factor receptor. Cell 125, 1137–1149 (2006)
Yun, C.H., Boggon, T.J., Li, Y., Woo, M.S., et al. Structures of lung cancer–derived EGFR mutants and inhibitor complexes: mechanism of activation and insights into differential inhibitor sensitivity. Cancer Cell 11, 217–27 (2007)
Kumar, A., Petri, E.T., Halmos, B. and Boggon, T.J. Structure and clinical relevance of the epidermal growth factor receptor in human cancer. J. Clin. Oncol. 26, 1742–51 (2008)
Sordella, R., Bell, D.W., Haber, D.A., Settleman, J. Gefitinib-sensitizing EGFR mutations in lung cancer activate antiapoptotic pathways. Science 305, 1163–67 (2004)
Tiseo, M., Rossi, G., Capelletti, M., Sartori, G., Spiritelli, E., Marchioni, A. et al. Predictors of gefitinib outcomes in advanced non-small cell lung cancer (NSCLC): study of a comprehensive panel of molecular markers. Lung Cancer 67, 355–360 (2010).
Diaz, L.A.Jr., Bardelli, A. Liquid biopsies: genotyping circulating tumor DNA, J Clin Oncol, 32, 579-586 (2014)
Seki, Y., Fujiwara, Y., Kohno, T., Yoshida, K., Goto, Y., Horinouchi, H. et al. Circulating cell-free plasma tumour DNA shows a higher incidence of EGFR mutations in patients with extrathoracic disease progression. ESMO Open 3, e000292 (2018).
Vallee, A., Marcq, M., Bizieux, A., Kouri, C. E., Lacroix, H., Bennouna, J. et al. Plasma is a better source of tumor-derived circulating cell-free DNA than serum for the detection of EGFR alterations in lung tumor patients. Lung Cancer 82, 373–374 (2013).
Buder, A., Tomuta, C., Filipits, M. The potential of liquid biopsies. Curr Opin Oncol. 28(2):130–134 (2016)
Oxnard, G.R., Paweletz, C.P., Kuang, Y., Mach, S.L., O’Connell, A., Messineo, M.M., et al. Noninvasive detection of response and resistance in EGFR-mutant lung cancer using quantitative next-generation genotyping of cell-free plasma DNA. Clin Cancer Res. 20(6):1698–705 (2014)
Sacher, A.G., Paweletz, C., Dahlberg, S.E., Alden, R.S., O’Connell, A., Feeney, N., et al. Prospective validation of rapid plasma genotyping for the detection of EGFR and KRAS mutations in advanced lung cancer. JAMA Oncol. 2(8):1014–1022 (2016)
Buder, A., Hochmair, M.J., Schwab, S., Bundalo, T., Schenk, P., Errhalt, P., et al. Cell-free plasma DNA-guided treatment with osimertinib in patients with advanced EGFR-mutated NSCLC. J Thorac Oncol. 13(6):821–830 (2018)
Taniguchi, K., Uchida, J., Nishino, K., et al. Quantitative detection of EGFR mutations in circulating tumor DNA derived from lung adenocarcinomas. Clin. Can. Res. 17, 7808-7815 (2011)
Altman, D.G. Practical statistics for medical research. New York, NY: Chapman & Hall/CRC Press (1999)
Chen Y.L., Lin, C.C., Yang, S.C., Chen, W.C., Chen, J.R., Hou, Y.H., Lu, C.C., et al. Five Technologies for Detecting the EGFR T790M Mutation in the Circulating Cell-Free DNA of Patients With Non-small Cell Lung Cancer: A Comparison, Front Oncol 9:631 (2019)
Diehl, F., Schmidt, K., Choti, M.A., Romans, K., et al. Circulating mutant DNA to assess tumor dynamics. Nat. Med. 14, 985–990 (2008)
Diehl, F., Li, M., Dressman, D., et al. Detection and quantification of mutations in the plasma of patients with colorectal tumors. Proc. Natl. Acad. Sci. USA 102, 16368-73 (2005)
Dawson, S.J., Tsui, D.W.Y., Murtaza, M., Biggs, H., Rueda, O.M., et al. Analysis of Circulating Tumor DNA to Monitor Metastatic Breast Cancer, N Engl J Med. 368, 1199-1209 (2013)

No competing interests reported.

Comparative analysis of EGFR mutations between circulating tumor DNA and tissue samples in non-small cell lung carcinoma patients using BEAMing PCR: results of a single institutional observational study

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1