Gene editing construct
The gene encoding the allograft inflammatory factor of B. glabrata, BgAIF (2,226 bp; accession number BGLB005061, https://www.vectorbase.org/) includes five exons interrupted by four introns (Fig. 1a). A guide RNA (gRNA) for Cas9-catalyzed gene editing specific for the target B. glabrata gene locus, BgAIF, was identified in the BGLB005061 sequence using the ‘CHOPCHOP’ v3 tool, https://chopchop.cbu.uib.no/, with default parameters compatible for the protospacer adjacent motif, NGG, of Cas9 from Streptococcus pyogenes [50–52] and screened for off-target sites against Biomphalaria glabrata genome [29]. Based on the guidance from the CHOPCHOP analysis, we chose the top ranked guide RNA (gRNA), AGACTTTGTTAGGATGATGC, specific for exon 4 of the AIF gene, with predicted high CRISPR/Cas9 efficiency for double-stranded cleavage in tandem with an absence of off-target activity in the genome of B. glabrata (Fig. 1a). A CRISPR/Cas9 vector encoding the gRNA targeting exon 4 of BgAIF under the control of the mammalian U6 promoter and encoding Cas 9, with nuclear localization signals 1 and 2, driven by the human cytomegalovirus (CMV) immediate early enhancer and promoter was assembled using the GeneArt CRISPR Nuclease Vector system (Thermo Fisher Scientific, Waltham, MA), according to the manufacturer’s protocol. The construct was termed pCas-BgAIFx4 (Fig. 1b). Chemically competent TOP10, E. coli cells (Invitrogen, Thermo Fisher Scientific) were transformed with pCas-BgAIFx4 by the heat shock method and cultured on LB-agar supplemented with ampicillin at 100 µg/ml. Subsequently, plasmids recovered from several single colonies of ampicillin-resistant E. coli transformants were confirmed for gRNA ligation and orientation by amplicon PCR-based Sanger direct nucleotide sequence analysis using a U6 gene-specific primer to confirm the integrity of inserted gRNA sequence (Fig. 1b).
Biomphalaria glabrata embryonic (Bge) cell line culture
The Bge cell line was provided by the Schistosomiasis Resource Center (SRC), Biomedical Research Institute (BRI), Rockville, MD. Historically, the Bge cell line was sourced by the SRC from the American Type Culture Collection (Manassas, VA), catalog no. ATCC CRL 1494, and thereafter maintained at BRI for > 10 years. Bge cells were maintained at 26ºC in air in ‘Bge medium’, which is comprised of 22% (v/v) Schneider’s Drosophila medium, 0.13% galactose, 0.45% lactalbumin hydrolysate, 0.5% (v/v) phenol red solution, 20 µg/ml gentamycin, and supplemented with 10% heat-inactivated fetal bovine serum [24, 53]. Bge cells were grown to 80% confluence before transfection by electroporation with pCas-BgAIFx4. The Bge cells were free of contamination with Mycoplasma, as established with a PCR-based test (LookOut® Mycoplasma PCR Detection kit, Sigma-Aldrich, St. Louis, MO).
Transfection Of Bge Cells By Square Wave Electroporation
Bge cells were harvested using a cell scraper, washed twice in Bge medium, counted, and resuspended at 20,000 cell/µl in Opti-MEM medium (Sigma-Aldrich, St. Louis, MO). Two million cells were transferred into 0.2 mm path length electroporation cuvettes (BTX Harvard Apparatus, Hollister, MA) containing 6 µg pCas-BgAIFx4 in ~ 100 µl Opti-MEM. The cells were subjected to electroporation using one pulse at 125 volts for 20 milliseconds, using a square wave pulse generator (ECM 830, BTX Harvard Apparatus). Immediately thereafter, the Bge cells were maintained in 12-well plates (Greiner Bio-One) at 26ºC. The mock control included Opti-MEM only for electroporation. The presence of transcripts encoding the B. glabrata actin (BgActin) and the Cas9 was monitored daily for nine days following transfection by electroporation (Fig. 1c).
Sequential Isolation Of Total Rna And Genomic Dna
To monitor the transfection of Bge cell by pCas9-BgAIFx4, we investigated the expression of Cas9 in Bge cells by reverse transcriptase PCR (RT-PCR). Both total RNA and genomic DNA were extracted sequentially from cell pellets, as previously described [54, 55]. In brief, each sample of total RNA sample was extracted using the RNAzol® RT reagent (Molecular Research Center, Inc., Cincinnati, OH) according to the manufacturer’s protocol. Subsequently, the DNA/protein pellet retained after recovery of RNA was resuspend in DNAzol® solution (Molecular Research Center, Inc), and total DNA recovered. The samples of RNA and DNA were dissolved in nuclease-free water and concentration and purity established by spectrophotometry (Nanodrop 1000, Thermo Fisher Scientific).
Expression Of Cas9 In Bge Cells
To investigate transcription from the pCas-BgAIFx4 vector following transfection of Bge cells, levels of transcribed Cas9 were investigated by semi-quantitative RT-PCR. Total RNA from the non-transfected cell, mock (Opti-MEM electroporated-) and pCas-BgAIFx4 DNA electroporated-Bge cells were treated with DNase I (Ambion, Thermo Fisher Scientific) to digest any residual vector pCas-BgAIFx4 DNA and contaminating genomic DNAs. The RNAs were reverse transcribed to cDNA using the First Strand cDNA Synthesis kit (New England Biolabs, Ipswich, MA). RT-PCRs specific for the actin gene of B. glabrata, BgActin was also included as positive control. The primer pairs used for the BgActin and the Cas9 coding sequences were: BgActin, actin-F: 5’- GTCTCCCACACTGTACCTATC-3’, actin-R: 5’- CGGTCTGCATCTCGTTTT-3’; Cas9, Cas9-F: 5’- GAGTGAACTTCCCGCCGAAT-3’ and Cas9-R: 5’-GGTCTTGACGAGACGATGCT-3’ (Fig. 1b). Amplicons and molecular size standards were separated by electrophoresis through Tris-acetate-EDTA-buffered agarose 1% stained with ethidium bromide (Fig. 1c).
Analysis of programmed mutation of the allograft inflammatory factor gene of B. glabrata
Genomic DNA samples from the mock-transfected and pCas-BgAIFx4-transfected cells were amplified by PCR using AIF-F and AIF-R primers that flank the CRISPR/Cas9 programmed double-stranded break (DSB) site (Fig. 1a). Amplicons were isolated using the PCR cleanup and gel extraction kit (ClonTech, Takara USA, Mountain View, CA) and the nucleotide sequence of amplicons determined by Sanger direct sequencing (GENEWIZ, South Plainfield, NJ). Chromatograms of the sequence reads from the control and experimental groups in each replicate experiment were subjected to online analysis using the TIDE algorithm, https://tide.deskgen.com/ [56, 57] and also using the Inference of CRISPR v2 Edits analysis (ICE) software, https://ice.synthego.com/#/ (Synthego Corporation, Redwood City, CA) [58]. Estimates of CRISPR efficiency, insertion-deletion (INDEL)-substitution percentages, and the nucleotide sequence of mutant alleles were obtained using both the TIDE and the ICE platforms (Fig. 2a, 2b).
Quantitative real time PCR analysis of transcription of BgAIF
To evaluate the differential levels of the BgAIF transcript among the groups, total RNA was extracted and treated with DNase I, as above. DNase I treated-RNA (200 ng) was reverse transcribed to cDNA, followed by quantitative RT-PCR, using the ViiA7 Real Time PCR System (Applied Biosystems, Scientific), and the SSoAdvanced Universal SYBR Green Supermix reagents (Bio-Rad), according to the manufacturer’s recommendations. The following nucleotide primers were used: BgAIF specific forward primer, 5’-CCTGCTTTTAACCCGACAGA-3’ and reverse primer, 5’-TGAATGAAAGCTCCTCGTCA-3’. Differential BgAIF gene expression were calculated after normalizing with BgActin (primers as above) and comparison with the non-treated cells (control group). The ΔΔCt method was used to calculate the differential gene expression [59], with assistance of the GraphPad Prism 8 software (San Diego, CA) (Fig. 2c).
Schistosome Sporocysts
Miracidia of NMRI strain of S. mansoni were hatched from eggs that were harvested from livers of schistosome infected mice (Schistosomiasis Resource Center, Biomedical Research Institute, Rockville, MD) under axenic conditions [28], primary sporocysts were transformed from the miracidia in vitro, as described [26]. Briefly, miracidia were immobilized by chilling on ice for 25 min, following be pelleting using centrifugation, 500⋅ g at 4 °C, 60 sec. The miracidia were washed with ice cold Chernin’s balanced salt solution with 1 mg/ml of glucose and trehalose and antibiotic, 10 µl/ml of 100⋅ penicillin/streptomycin (Thermo Fisher Scientific), termed CBSS+. Approximately 5,000 miracidia per well of 24-well plate were cultured in CBSS + at 26 °C for 24 hrs, after which the sporocysts were washed remove shed ciliated epidermal plates and other debris, followed by transfer to a 1.5 ml microcentrifuge tube [26].
Sporocyst-bge Cell Binding Assay And Cell Adhesion Index (cai)
To investigate the if BgAIF would affect the ability of cell adhesion to S. mansoni sporocyst, we co-cultured the non-transfected Bge cell or BgAIF depleted- cell (ΔBgAIF-Bge) with in vitro transformed sporocysts, then the cell adhesion index (CAI) were calculated as described [26]. CAI is a semi-quantitative method of cell adhesion to primary sporocyst using the four degree of scores ranging from one to four (low to high amount of cell adhere to parasite surface). In brief, we mixed single cell suspension of 500,000 Bge cells with 200 freshly prepared-sporocysts (total volume 200 µlof CBSS+) in sterile, siliconized tubes (Bio Plas, Thomas Scientific, Swedesboro, NJ). The Bge cell-sporocyst co-culture was maintained at 26 °C for 24 hrs. Cellular morphology and adhesion of the cells the surface of the parasite was monitor and recorded using a n inverted microscope (20 × magnification on Zeiss Axio Observer A1) (Carl Zeiss LLC, White Plains, NY) after gently transferring the parasite-cell suspension to the tissue culture plate (Greiner Bio-One). Scoring of the cell index was carried out in a blinded fashion to the investigator reading the score, > 50 sporocysts from each experimental group were counted each time, and triplicates of each treatment group were scored. Seven independent biological replicates of this CAI-based sporocyst-Bge cell binding assay were carried out. In total, > 400 sporocysts were examined from each treatment and control group. Averages for the CAI values were calculated from the cell adhesion scores ranging from 1 to 4 (examples presented in Fig. 3a) according to the formula, CAI = total binding value per number of sporocysts [26].