Goose follicle collection and primary GC culture
Geese (from a maternal line of Tianfu goose) were raised under natural temperature and light conditions at the experimental waterfowl breeding farm of Sichuan Agricultural University. For follicle collection, six geese showing regular laying schedules were randomly selected as experimental samples and sacrificed 2 h after oviposition by post-anesthesia exsanguination. A pool of ovarian follicles was immediately collected from the goose abdominal cavities and placed into sterile normal saline. The follicles were then divided into groups according to their sizes (< 2, 2–4, 4–6, 6–8, and 8–10 mm in diameter) and stages of follicular hierarchy (F5, F4, F3, F2, and F1) according to previously reported nomenclature [28]. The outer connective tissue was removed from the follicles, which were then bisected to allow the yolk and adhering granulosa layer to flow out. The granulosa and theca layers were isolated as previously described [29]. They were then washed three times with PBS, quickly frozen in liquid nitrogen, and stored at − 80 °C for RNA extraction.
For primary GC culture, the granulosa layer was dispersed by incubation in 0.1% type II collagenase (Sigma, USA) in Dulbecco’s Modified Eagle Medium (DMEM, HyClone, USA) for 10 min in a 37 °C water bath. After incubation, the cells were dispersed with a pipette and pelleted by centrifugation at 1000 × g for 10 min (20 °C). The supernatant was discarded, and the cells were re-suspended in 3 ml of fresh basic medium without collagenase and centrifuged. The washing procedure was repeated twice. The GCs were dispersed in DMEM supplemented with 1% antibiotic/ antimycotic solution (Solarbio, China) and 3% fetal bovine serum (Gibco, USA). The number and viability of GCs were determined with a hemocytometer using the trypan blue exclusion assay. Viability of all GCs was greater than 90%. Cells were incubated in a water-saturated atmosphere of 95% air and 5% CO2 at 37 °C in an incubator (Thermo, USA).
RNA extraction and qRT-PCR
Total RNA was extracted using Trizol reagent (Invitrogen, USA) according to the manufacturer's instructions. The first-strand cDNA was synthesized from 1 µg of total RNA using a cDNA synthesis kit (Takara, Japan). qRT-PCR was conducted using synthesized cDNA with the SYBR PrimeScript RT-PCR kit (Takara, Japan) in the CFX96™ Real-Time System (Bio-Rad, USA); sets of gene-specific forward and reverse primers are listed in Table S1. Relative mRNA expression was determined using the 2(−ΔΔCt) method [30]. β-actin and GAPDH mRNA levels were used to normalize mRNA levels.
Modulation of SCD with small interfering RNA
Specific small interfering RNA (siRNA), used to silence SCD expression, was synthesized by GenePharma (Shanghai, China) and was transfected into GCs using the Lipofectamine™ RNAiMAX Transfection Reagent (Invitrogen Co.) according to the manufacturer’s recommendations. Briefly, the GCs were grown in medium (DMEM) without antibiotics one day before the experiment. On the day of transfection, pre-prepared siRNA-RNAiMAX complexes and incubated for 5 min at room temperature. The cells that we had prepared for SCD knockdown were removed from their medium and placed onto medium that was free of serum or antibiotics. The cells were then incubated with the siRNA-RNAiMAX complexes at 37 °C for 24, 48, and 72 h. siRNAs were delivered to cells at a final concentration of 20 nmol/L. Cells were collected for mRNA analysis to verify gene knockdown. Scrambled siRNA was used as a nonspecific negative control (NC). The following siRNA molecules were used: sense (5′-3′) UUCUCCGAACGUGUCACGUTT, antisense (5′-3′) ACGUGACACGUUCGGAGAATT (scrambled) as the control, sense (5′-3′) GCGAUACGUCUGGAGGAAUTT, antisense (5′-3′) AUUCCUCCAGACGUAUCGCTT (siRNA210), sense (5′-3′) GCGGAUCUUCUUGACUAUUTT, antisense (5′-3′) AAUAGUCAAGAAGAUCCGCTT (siRNA405), and sense (5′-3′) GCUCAACGCCACUUGGCUATT, antisense (5′-3′) UAGCCAAGUGGCGUUGAGCTT (siRNA774).
Overexpression of SCD with recombinant vector
To generate GFP-SCD, the RNA was obtained from normal goose ovarian tissue and used to generate cDNA clones of the SCD gene. A 981-bp cDNA fragment (GenBank Accession No. XM_013201691.1) was amplified using primers capped with XhoI and HindIII recognition sequences (Forward: 5′- CCGCTCGAGATGGAGAAGGACTTACTCAGTCATG − 3′; Reverse: 5′- CCCAAGCTTTCAGCCGCTCTTGTGACTCCC − 3′). This fragment was then inserted to construct the pEGFP-N1 plasmid. The construct was confirmed by enzymatic digestion and DNA sequencing. In the transient transfection experiment, 1 µg of the plasmid DNA was transfected into 1 × 106 GCs in six-well dishes using Lipofectamine® 3000 (Invitrogen Co) according to the manufacturer’s instructions; a GFP vector and an empty control served as negative controls. The expression levels of SCD mRNA were detected 24, 48, and 72 h later in order to evaluate transfection efficiency.
Determination of SCD activity
The SCD activity was measured using the Goose Stearoyl-CoA Desaturase Activity Assay Kit (NJJCBIO, China). Briefly, each cell culture medium was diluted five times with sample diluent; 50 µl of the resultant dilution was then added to the enzyme label plate. Plates were incubated at 37 °C for 30 min, washed five times with wash buffer, and air-dried at room temperature. Standard reagent (50 µl) was added to the plates, which were then washed five times. After adding 50 µl reagent A and 50 µl reagent B, the plates were incubated at 37 °C for 10 min in the dark. Finally, 50 µl stop buffer was added; the optical density (OD) value was then measured by microplate reader at a wavelength of 450 nm and calculated.
Cell sample preparation for metabolomics
In total, 18 samples consisting of three biological replicates were randomly and independently analyzed to reduce analysis bias. After the samples were thawed on ice, 1 mL pre-cooled extractant (70% methanol aqueous solution) was added and whirled for 1 min. The mixture was placed in liquid nitrogen for 3 min, removed from ice for 3 min, and whirled for an additional 2 min. This procedure was repeated three times. The mixture was again centrifuged at 12000 r/min at 4 °C for 10 min, and then the supernatant was collected into the sample bottle for LC-MS/MS analysis.
High-performance liquid chromatography (HPLC) conditions
All samples were randomly analyzed to reduce analysis bias; the sample extracts were analyzed using a liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI-MS/MS) system (UPLC, Shim-pack UFLC SHIMADZU CBM A system, https://www.shimadzu.com/; MS, QTRAP® System, https://sciex.com/). The analytical conditions were as follows: UPLC column (Waters ACQUITY UPLC HSS T3 C18; 1.8 µm, 2.1 mm × 100 mm); column temperature, 40 °C; flow rate, 0.4 mL/min; injection volume, 2 µL; solvent system, water (0.04% acetic acid): acetonitrile (0.04% acetic acid); gradient program, 95:5 V/V at 0 min, 5:95 V/V at 11.0 min, 5:95 V/V at 12.0 min, 95:5 V/V at 12.1 min, and 95:5 V/V at 14.0 min.
Quality control (QC) samples comprised a mixture of extracts from each sample; this mixture was divided into three samples, which were analyzed using the same method as for the experimental samples. The mixed samples were injected after every five experimental samples throughout the analytical run to provide a set of data from which repeatability could be assessed.
ESI-QTRAP-MS/MS
Linear ion trap (LIT) and triple quadrupole (QQQ) scans were conducted on a triple quadrupole linear ion trap mass spectrometer (QTRAP® LC-MS/MS System) that was equipped with an ESI Turbo Ion-Spray interface, operating in positive and negative ion mode, and controlled by Analyst 1.6.3 software (Sciex). The ESI source operation parameters were as follows: source temperature 500 °C; ion spray voltage (IS) 5500 V (positive), − 4500 V (negative); ion source gas I (GSI), gas II (GSII), and curtain gas (CUR) were set at 55, 60, and 25 psi, respectively; the collision gas (CAD) was high. Instrument tuning and mass calibration were performed with 10 and 100 µmol/L polypropylene glycol solutions in QQQ and LIT modes, respectively. A specific set of multiple reaction monitoring (MRM) transitions were performed for each period according to the metabolites eluted within this period.
Qualitative and quantitative analysis of metabolites
Qualitative analysis of primary and secondary MS data was carried out by comparing the accurate precursor ion (Q1) and product ion (Q3) values, retention time (RT), and fragmentation patterns with those obtained by injecting standards under identical conditions for available standards (Sigma-Aldrich, USA http://www.sigmaaldrich.com/united-states.html), or by using a self-compiled database (MWDB; MetWare Biological Science and Technology Co., Ltd. Wuhan, China). The quantitative analysis of metabolites was based on the MRM mode. The characteristic ions of each metabolite were screened with the QQQ mass spectrometer to obtain the signal strengths. Integration and correction of chromatographic peaks was performed using Progenesis QI software (Waters Co., Milford, MA, USA). The corresponding relative metabolite contents were represented as chromatographic peak area integrals. In addition, potential metabolites were identified using public databases including Human Metabolome Database (http://www.hmdb.ca), MassBank (http://www.massbank.jp), and Metlin (https://metlin.scripps.edu).
Data processing and analysis
Metabolites were used for hierarchical clustering analysis (HCA) and heat map analysis, which were conducted using R package, version 3.3.1. Subsequently, PCA and aoOPLS-DA were conducted using SIMCA-P14.0 software (Umetrics, Umeå, Sweden) to process data from the LC-MS/MS analysis. Significant differences between metabolites of experimental and control groups were identified using variable importance in projection (VIP) from OPLS-DA (VIP > 1). Kyoto Encyclopedia of Genes and Genomes (KEGG) database (http://www.genome.jp/kegg/) was used to identify enriched pathways of the differing metabolites.
The qRT-PCR and enzyme activity data from the three independent biological replicates were analyzed by one-way ANOVA using SPSS 19.0 (SPSS Inc., Chicago, IL, USA) for the comparison of multiple means. All data are expressed as means ± SD and significance was assumed at p < 0.05. Further, all the data were illustrated using GraphPad Prism 6.01 (GraphPad Software, San Diego, CA).