Myofibre-specific knockout of TGF-β type I receptors triggers muscle hypertrophy and promotes contraction and oxidative metabolism

doi:10.21203/rs.3.rs-5136404/v1

Download PDF

Article

Myofibre-specific knockout of TGF-β type I receptors triggers muscle hypertrophy and promotes contraction and oxidative metabolism

https://doi.org/10.21203/rs.3.rs-5136404/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Transforming growth factor-β (TGF-β) signaling is associated with progressive skeletal muscle wasting and fibrosis, while double knockout of TGF-β type I receptors Acvr1b and Tgfbr1 results in hypertrophy. Gaining insights in how myofibre-specific knockout of these receptors affects muscle transcriptome, strength and mitochondrial activity could aid in the development of therapeutic interventions to improve muscle function. Here, we show that 3 months of myofibre-specific knockout of both receptors (dKO) in mice induced a 1.6-fold increase in gastrocnemius medialis mass and a 1.3-fold increase in maximal force. Soleus muscle mass and maximal force both increased 1.2-fold in dKO mice. Muscle hypertrophy in dKO mice was accompanied by a proportional increase in succinate dehydrogenase enzyme activity. Single receptor knockout caused minor phenotypical alterations. Transcriptome analyses revealed that gastrocnemius medialis had 1811 and soleus had 295 differentially expressed genes, mainly related to muscle contraction, hypertrophy, filament organization and oxidative metabolism. Hgf and Sln genes were strongly upregulated in both muscles of dKO mice, while Sntb1 was downregulated. This in combination of transcriptional changes are associated with muscle hypertrophy and increased mitochondrial biosynthesis. Our study highlights that myofibre-specific interference with both TGF-β type I receptors concurrently stimulates myofibre hypertrophy and mitochondrial activity.

Acvr1b

Tgfbr1

TGF-β type I receptor

contraction

skeletal muscle

succinate dehydrogenase

Muscle wasting diseases, including sarcopenia, cancer-induced cachexia, dystrophy, and physical inactivity, are associated with impaired physical performance which are largely due to reduced muscular strength and endurance ^1–9. Optimal muscle force is determined by muscle physiological cross-sectional area (CSA) and the distribution of different types of myosin heavy chains, whereas muscle endurance is largely determined by the myofibre oxidative metabolic capacity, capillary density and myoglobin concentration ¹⁰. Typical features for muscle wasting disorders are the impairment of both muscle strength and fatigue resistance ^11,12. Furthermore, in muscle wasting disorders, myofibres size is reduced, myofibres are lost and replaced by fibrotic tissue, and the force-generating capacity per CSA (i.e. specific force) and endurance capacity are decreased. It is therefore a clinical challenge to counterbalance these changes in muscle phenotype by concurrently stimulating myofibre hypertrophy and increasing myofibre oxidative capacity. Over a range of species, myofibre size has been shown to be inversely related to oxidative capacity ¹³, suggesting that both these traits are mutually exclusive. However, currently there is no effective treatment to restore muscle mass and aerobic metabolism simultaneously in muscle wasting disorders.

Interference with signalling pathways that affect muscle size and oxidative metabolism may ameliorate muscle dysfunction in many wasting conditions. Members of transforming growth factor-β (TGF-β) superfamily, such as TGF-β1, activin A, and myostatin, negatively regulate muscle mass and force, while they also contribute to muscle fibrosis ^14–17. TGF-β1 also inhibits mitochondrial function and oxidative metabolism in both myoblasts and myotubes ¹⁸. A hallmark of myopathies and muscle wasting disorders is the elevated TGF-β signalling ^1,4,6. Therefore, inhibition of TGF-β signalling could be a potential therapeutic approach to simultaneously increase muscle force and endurance.

TGF-β signalling is activated when type I receptors are phosphorylated and a complex is formed by its ligands and type II receptors. For the TGF-β type I receptor, TGF-β isoforms signal via TGF-β receptor type-1 (TGFBR1/ALK5), while activin A signals via activin receptor type-1B (ACVR1B/ALK4). Myostatin signals via both the TGFBR1 and ACVR1B ^19,20. Phosphorylated type I receptors phosphorylate Smad2/3, resulting in the inhibition of muscle cell growth and differentiation ²¹.

Targeting one of the ligands or receptors of TGF-β1, myostatin and activin A increases protein synthesis and skeletal muscle mass. Intravenous administration of myostatin propeptide increased gastrocnemius medialis muscle mass by 20% 17 weeks after injection, while soleus muscle mass was not affected ²². Inhibition of type II receptor signalling of myostatin and activin A in mice by administration of neutralizing antibody for 5 weeks induced larger increases in muscle masses of gastrocnemius and plantaris (i.e. by 50%) than by using propeptide of myostatin (i.e. by 10%) ²³. Moreover, targeting TGF-β type I receptors Acvr1b and Tgfbr1 in mice has been shown to induce an increase in gastrocnemius muscle mass by about 200%, while targeting of type II receptors only increased muscle mass by only 50% ²⁴. These findings indicate that targeting of TGF-β type I receptors stimulates muscle hypertrophy more pronouncedly than targeting of TGF-β family ligands or type II receptors. Noteworthy, the hypertrophy by interference with TGF-β signalling is much larger in type IIB myofibres than in type I myofibres which is presumably associated with higher expression levels of myostatin ²⁵, type II receptors ²⁶, and/or elevated Pkm2 expression in fast-type myofibres ²⁷. Although TGF-β signalling is well characterized, the mechanisms underlying the regulation of TGF-β1 receptors on muscle size, metabolisms and the muscle type-specific force-generating capacity are still unknown.

An increase in muscle mass does not necessarily imply a proportional increase in force-generating capacity. The myofibre hypertrophy by the knockout of myostatin in fast-type muscle is not proportionally associated with an increase in force-generating capacity, hence muscle specific force is reduced ^26,28,29. Although it has been reported that the reduced specific force in fast-type muscle of myostatin-null mice was associated with an increased myonuclear domain size, reduced muscle stiffness ³⁰ and diminished expression of collagen genes ³¹, the underlying molecular mechanism is unclear. Whether disproportional increase in force-generating capacity and myofibre size is attributable to the changes in transcript levels of muscle contractile components, and/or cell-matrix adhesion proteins requires a thorough investigation. Whole transcriptome analysis of both fast-and slow-type myofibres lacking TGF-β type I receptors may provide insight in the signalling pathways involved.

Another phenotypical characteristic of myofibres is the oxidative metabolic capacity which is a key determinant of the maximal sustainable muscle power ³². Several studies have shown that muscles of myostatin-null mice show increased cytochrome c oxidase enzyme activity and elevated Pgc1a gene expression levels ^33,34. In line with this, TGF-β1 supplementation reduced mitochondrial complex IV protein abundance in both myoblasts and myotubes in vitro ¹⁸. These findings suggest that blockade of TGF-β signalling by targeting type I receptors inhibiting myostatin and TGF-β1 signalling may concurrently increase muscle size and mitochondrial activity, and as such could be an effective treatment in muscle wasting disorders.

The aim of this study was to investigate the effects of targeting TGF-β type I receptors on (1) fast-and slow-type muscle phenotypes, (2) the force-generating capacity and the underling molecular mechanisms, (3) muscle oxidative metabolism. For this purpose, type I receptors Acvr1b and Tgfbr1 were knocked out individually and simultaneously (dKO). We assessed the transcriptome, in situ force-generating capacity in situ, and oxidative metabolism of both glycolytic, low oxidative gastrocnemius medialis and high oxidative soleus muscles. Here we show that targeting either Acvr1b or Tgfbr1 individually did not significantly increase muscle mass and force. In contrast, the myofibre-specific lack of both type I receptors resulted in substantial alterations in expression levels of genes related to muscle growth, contraction, myoblast differentiation, filament organization, connective tissue remodelling, and metabolism. Both gastrocnemius and soleus muscles of dKO mice were larger and stronger, while specific force was reduced in gastrocnemius. Strikingly, simultaneous knockout of type I receptors showed concurrent sizable myofibre hypertrophy and increased oxidative metabolism.

Fast-and slow-type muscles lacking both TGF-β type I receptors show different transcriptional profiles

To genetically inactivate Acvr1b and Tgfbr1 in a myofibre-specific manner, tamoxifen-induced Cre recombinase was used in six-week-old HSA-MCM:Acvr1b^fl/fl, HSA-MCM:Tgfbr1^fl/fl, HSA-MCM: Acvr1b^fl/fl:Tgfbr ^fl/fl mice. Cre positive HSA-MCM mice were injected with tamoxifen as the control group (Fig. 1. A). Animals were sacrificed after three months (Fig. 1. B). Gene expression levels of Acvr1b in gastrocnemius were significantly reduced in gastrocnemius of Acvr1b KO mice and dKO mice compared to those of control. Gene expression levels of Tgfbr1 were reduced in gastrocnemius of the Tgfbr1 KO mice and dKO mice compared to those of control mice. For soleus muscle, although RNA-seq and q-PCR did not show differences in gene expression levels of Acvr1b or Tgfbr1 between groups (Fig. 1. C, D), spatial quantification of expression levels of Acvr1b and Tgfbr1 using ISH of RNA scope confirmed the reduced number of Acvr1b/Tgfbr1 mRNA per nuclear in both gastrocnemius and soleus of Acvr1b KO/Tgfbr1 KO mice and dKO mice (Supplementary Fig. 5). Both muscle mass and maximal contractile force were increased in soleus muscles of dKO mice which indicates that muscle function and phenotype were altered by the knockout of both Acvr1b and Tgfbr1. Body mass of dKO animals was increased progressively and reached a plateau at ~ 7 weeks after tamoxifen injection, while the other two groups showed typical growth curves that were similar to that of the wild type (Fig. 1. E). Both gastrocnemius and soleus muscle mass of the dKO mice were higher than those of the other groups (Fig. 1. F, G and Supplementary Table 1). RNA-seq analysis revealed that major alterations in gene expression were in gastrocnemius of dKO mice but not in muscles lacking either Acvr1b or Tgfbr1 (Fig. 1. H, I). For gastrocnemius of dKO mice 1811 genes were differentially expressed (enriched by Deseq2 with a false discovery rate P \(\:<\:\)0.05 and fold change\(\:\:\ge\:\:\)1.5) whereas dKO soleus muscles showed 295 differentially expressed genes (DEGs). Many DEGs in dKO muscles were not observed in muscles of single receptor knockout (Fig. 1. J, Supplementary Fig. 1. A, B and Supplementary Table 2, 3). Gene ontology (GO) enrichment analysis revealed that pathways related to muscle contraction, growth, filament organization, stem cell differentiation, matrix remodelling, and metabolism were predominantly altered in gastrocnemius muscles of dKO mice, rather than in soleus muscle (Fig. 1. K).

Knockout of TGF-β type I receptors in gastrocnemius and soleus muscles differentially affects muscle force-generating capacity

RNA-seq analysis showed that TGF-β type I receptor knockout in both gastrocnemius and soleus muscles induced DEGs which were associated with skeletal muscle contraction (Fig. 2. A). For dKO gastrocnemius, expression levels of genes that encode contractile filaments were decreased. In particular, dKO gastrocnemius showed lower expression levels of genes encoding thick filament-associated proteins (Mylk2, Myl2, Myh7) and slow-myofibre type troponin and tropomyosin (Tnnc1, Tnni1, Tnnt1, Tpm3). Besides, gastrocnemius of dKO mice had decreased gene expression levels of genes involved in protein degradation (Foxo1, Foxo4) (Supplementary Data). In addition, targeting both type I receptors in gastrocnemius increased gene expression levels of giant sarcomeric protein (Obsl1) and proteins modulating contractility such as Mybph and Actc1. Genes encoding acetylcholine receptors subunit proteins of the postsynaptic neuromuscular junction (Chrna1, Chrng, Chrnd) were more expressed in gastrocnemius than in soleus muscle of dKO mice (Fig. 2. A, Supplementary Data). Based on these altered gene expression landscapes, we next studied the muscle functional contractile properties. Figure 2. B-E show typical examples of twitch and tetanus force tracings of a gastrocnemius and a soleus of a dKO and a control mouse. The lack of Acvr1b significantly increased maximal isometric tetanic force in gastrocnemius. Post hoc analysis showed that the maximal tetanic force of gastrocnemius in dKO mice (2123.46 ± 142.71 mN) was 1.3-fold higher than that of control mice (1669.65 ± 105.47 mN) (Fig. 2. F). The specific force of gastrocnemius in dKO mice was 77% (17.25 ± 1.19 mN/mg) of that of control mice (22.32 ± 1.45 mN/mg) (Fig. 2. H), indicating disproportional increases in muscle size and force. Maximal tetanic force in soleus muscle of dKO mice was higher compared to that in Acvr1b KO and control animals (Fig. 2. G), while specific force was unaltered (Fig. 2. I), indicating that the increase in force-generating capacity was proportional to the increase in mass. Passive force of both muscles at optimal length did not differ between groups (Fig. 2. J, K). Force-frequency relations were assessed to determine whether muscle calcium sensitivity was affected by TGF-β receptor knockout. A slight leftward shift in force-frequency relation was observed in gastrocnemius lacking Tgfbr1, however it did not occur in soleus (Fig. 2. L, M).

To determine effects on excitation-contraction coupling, contractile twitch characteristics of gastrocnemius and soleus muscles were determined. Gastrocnemius twitch characteristics did not differ between groups (Supplementary Table 4). The maximal twitch force of dKO soleus was significantly higher compared to that of control mice. No significant differences were observed in twitch/tetanus ratio, time-to-peak twitch tension, normalised maximum rise in tension or half-relaxation time between groups. Together, these results indicate that force-generating capacity of muscle lacking both Acvr1b and Tgfbr1 was increased, albeit fast-type muscle showed a disproportional increase in muscle mass and force-generating capacity.

Simultaneous knockout of TGF-β type I receptors increases myofibre size and induces transcriptional changes related to sarcomere organization and transmembrane complex

Since muscle force was increased after knockout of both TGF-β type I receptors, we assessed muscle histological, cellular and molecular determinants of muscle phenotype. In the high oxidative region of gastrocnemius muscle, myofibre type distribution of dKO mice was shifted from type I and IIA myofibres to IIX and IIX/IIB compared to that in Acvr1b KO animals (Fig. 3. A-C, Supplementary Fig. 2), while myofibre type distribution was not different in muscles of single knockout mice. FCSA of dKO animals was 1.5-fold (3584 ± 193 µm²) and 3.2-fold (10651 ± 803 µm²) larger in the high and low oxidative regions of gastrocnemius muscle, respectively, compared to that of the other groups (Fig. 3. E-F). The number of myonuclei per myofibre in high oxidative region of gastrocnemius in dKO mice was increased with the increase in FCSA, while in the low oxidative region of gastrocnemius in dKO mice, nuclear number per myofibre was similar as that in control, resulting in 2.9-fold larger myonuclear domain compared to that in control muscles (Fig. 3. H, I). For soleus muscles of dKO mice, myofibre type I/IIA percentage was slightly increased in soleus (Fig. 3. D) and FCSA (2822 ± 216 µm²) was ~ 1.5-fold higher (Fig. 3. G). Myonuclear number and myonuclear domain in soleus muscle of dKO mice were not different from those in control (Fig. 3. H, I).

We hypothesized that the muscle hypertrophy in dKO mice was caused by higher rates of protein anabolism and reduced catabolism. Hepatocyte growth factor (Hgf) expression was increased in gastrocnemius muscles in dKO mice compared to that in Tgfbr1 KO mice (Fig. 3. K). However, expressions levels of genes encoding protein synthesis and protein degradation were not affected, including insulin-like growth factor 1 (Igf1ea) (Fig. 3. J), mechano growth factor (Igf1ec) (Supplementary Fig. 1. D) and E3 ubiquitin protein ligase (Trim63) (Fig. 3. L).

Next, using qPCR we investigated whether the altered force-generating capacity in dKO mice was associated with the change in expression level of genes encoding proteins in organization of contractile structures. Gene expression levels of Obsl1 and Mybph were increased in both gastrocnemius and soleus muscle of dKO mice (Fig. 3. M, N), while those of Ttn, Obscn and Ankrd2 were not different between groups (Supplementary Fig. 1. D-F), suggesting adaptation of sarcomere architecture in hypertrophic muscle. Gene expression levels of scaffold proteins that interact with dystrophin glycoprotein complex (DGC) were assessed. DGC plays a major role in maintaining membrane integrity and interaction of sarcolemma to extracellular matrix (ECM) ³⁵. Although gene expression level of δ-sarcoglycan (Sgcd) was not changed (Supplementary Fig. 1. G), β1-syntrophin (Sntb1) expression levels were substantially lower in dKO gastrocnemius compared to those in control mice but not in soleus muscles (Fig. 3. O). Reduced levels of Sntb1 expression may interrupt force transmission from the sarcomeres to the ECM during muscle contraction. In addition, gene expression levels of adenosine A1 receptor (Adora1) and calcium voltage-gated channel subunit alpha1 S (Cacna1s) did not differ between control mice and both muscles lacking either Acvr1b or Tgfbr1, indicating limited effects of blocking type I receptors on presynaptic neuromuscular junction and sarcoplasmic reticulum calcium release (Supplementary Fig. 1. H, I). In addition, sarcolipin expression (Sln) showed a 20-fold increase in gastrocnemius and soleus muscles of dKO mice (Supplementary Data). Moreover, expression of stem cell-specific transcription factor Pax7 was increased in soleus and the early marker for myogenic commitment, Myod, was increased in both gastrocnemius and soleus muscles of dKO mice (Fig. 3. P, Q). Although muscle mass was increased substantially in dKO mice, RNA concentration (ng/mg) was not different compared to other groups (Supplementary Fig. 1. J). Together, these data indicate that gastrocnemius muscles without both Acvr1b and Tgfbr1 show a substantial larger myofibre size without accretion of nuclei and show a shift towards a more fast-twitch myofibre phenotype. The myofibre hypertrophy was associated with increased gene expression of Hgf and altered gene expression related to sarcomeric organization and transmembrane complexes.

Eccentric force is reduced during serial eccentric contractions in gastrocnemius lacking both TGF-β type I receptors despite an increase in connective tissue content

Since the lack of dystrophin of DGC in muscle has been shown to enhance muscle susceptibility to injury in muscle ³⁶, it remains unclear whether reduced expression of another component of the DGC, the Sntb1, in dKO mice caused a decline in tetanic force during a series of eccentric contraction. We show that in the absence of both type I receptors, eccentric force-generating capacity was better preserved in soleus than in gastrocnemius. For gastrocnemius of dKO animals, the eccentric force curve was significantly lower than for muscles of the other groups (Fig. 4. A). For soleus, eccentric force curves were not different between groups (Fig. 4. B). After 15 eccentric contractions, in both muscles, the decline in maximal isometric tetanic force compared to the initial P_o prior to the series of eccentric contractions did not differ between groups (Supplementary Fig. 3). Since muscle connective tissue plays a role in protecting muscle against injury ^37,38, we then tested whether the decline in force during eccentric contractions was associated with a relatively lower content of connective tissue in the muscles of dKO mice.

In both gastrocnemius and soleus muscles of dKO mice, endomysium was thicker than in those muscles of control mice (Fig. 4. C-E). Thickness of primary and secondary perimysium in dKO gastrocnemius was increased compared to control, but not in soleus muscle (Fig. 4. F, G). However, the percentages of endomysium area per FCSA in both gastrocnemius and soleus muscles of each genotype were not different from those in control (Fig. 4. H, I). Note that excessive connective tissue deposition and small regions of myofibres with central nuclei were found in most low oxidative regions of gastrocnemius of dKO mice, but not in soleus (Fig. 4. J). These regions are indicative of higher regenerative activities of cells in dKO fast-type muscle. We expreted that the increased ECM deposition and the regenerating myofibres in gastrocnemius of dKO mice were accompanied by an increase in gene expression related to the pro-fibrotic and inflammation. In contrast, in the absence of both Acvr1b and Tgfbr1, Tgfb1 expression was not increased in gastrocnemius but was increased in soleus muscles (Fig. 4. K). Gene expression of Adgre, which encodes the macrophage marker protein F4/80, was upregulated in both gastrocnemius and soleus muscles of dKO mice (Fig. 4. L). These results indicate that simultaneous receptors knockout of both TGF-β type I receptors in both gastrocnemius and soleus muscles promotes ECM deposition proportionally with the increase in myofibre size. The decline in eccentric contractile force of fast-type gastrocnemius of dKO mice may be associated with the presence of newly formed myofibres in these muscles rather than with the change in ECM.

Simultaneous receptors knockout increases integrated succinate dehydrogenase (SDH) activity and maintains mitochondrial enzyme activity in both gastrocnemius and soleus muscles

Muscle oxidative phosphorylation capacity relates inversely to myofibre size over a range of specie. A high mitochondrial enzyme activity and a larger myofibre size are mutually exclusive ^13,39. To study whether TGF-β signalling affects mitochondrial oxidative metabolism, we hierarchically clustered genes in the transcriptome that were associated with oxidative metabolism from RNA-seq analysis. Expression levels of genes related to intracellular oxygen transport and mitochondrial enzyme activity were reduced in both muscles of dKO mice by RNA-seq, i.e. myglobin (Mb) and peroxisome proliferator-activated receptor gamma coactivator 1-alpha (Ppargc1a) (Fig. 5. A, Supplementary Data). SDH activity was quantified to obtain an estimate of the oxidative capacity (Fig. 5. B). The integrative SDH activity is the SDH activity times FCSA, which indicates total oxidative enzyme activity per myofibre per FCSA. For gastrocnemius, SDH activities in both low and high oxidative regions in Tgfbr1 KO animals were higher than those in Acvr1b KO mice (Fig. 5. C, D). In the low oxidative region of gastrocnemius, integrated SDH activity of dKO mice was higher than that in the other three groups (Fig. 5. C). In the high oxidative regions of gastrocnemius, integrated SDH activity was higher in dKO mice than that in control and Acvr1b KO mice, but did not differ from Tgfbr1KO mice (Fig. 5. D). For soleus, SDH activity in Tgfbr1 KO mice was higher compared to that in all other groups (Fig. 5. E). Integrated SDH activity in Tgfbr1 KO and dKO mice was increased compared to that in Acvr1b KO mice (Fig. 5. E). We observed a substantial rightward shift in the relationship between FCSA and SDH in Tgfbr1 KO and dKO mice (Fig. 5. F). This indicates that knockout of Tgfbr1 increases muscle oxidative capacity and that SDH activity within myofibres is higher and independent of the hypertrophy in dKO mice. q-PCR was performed to further determine the expression levels of genes encoding mitochondrial respiratory chain enzymes and proteins involved in angiogenesis. Despite reduced gene expression shown by RNA-seq, q-PCR could not show changes in expression levels of Sdhb, Mtco2, Ppargc1a and Vegfa in either gastrocnemius or soleus of dKO mice compared to control mice (Fig. 5. G-J). In addition, cytochrome c oxidase activity per volume cytoplasm in of both muscles in dKO mice was not different from control mice (Fig. 5. K, Supplementary Fig. 4. A). Together with the unaltered SDH activity, these findings indicate that mitochondrial biosynthesis capacity was enhanced in each hypertrophic myofibre of dKO mice.

Another determinant of the oxidative capacity is the oxygen supply. Capillary density (mm^-2) was only less in the high oxidative region in gastrocnemius. Capillary to myofibre ratios in the low oxidative regions in gastrocnemius and in soleus muscles of dKO mice were higher than those in muscles of control mice (Fig. 5. L, Supplementary Fig. 4. B, C). Genes related to angiogenesis, such as Angptl2, Plau and Dll1, were upregulated in dKO mice as shown by RNA-seq analysis (Supplementary Data). Given the improved vascular organization, we next examined the intracellular oxygen transport capacity. Although gene expression levels of Mb were reduced in dKO gastrocnemius, myoglobin concentration was only reduced in high oxidative region. Since the high oxidative region comprises less than 40% region of a gastrocnemius (Fig. 5. M, N, Supplementary Figure. 2), this suggests that facilitated intracellular oxygen transport was enhanced in the majority of the myofibres. Taken together, the data imply that despite the substantial hypertrophy, oxidative phosphorylation activity was improved in muscles lacking both TGF-β type I receptors.

Here, we investigated the changes in muscle transcriptome, contractile force and phenotype of both fast, glycolytic and slow, oxidative muscle with myofibre-specific receptor knockout of either individual or both Acvr1b and Tgfbr1. Our data show that simultaneous myofibre-specific knockout of both TGF-β type I receptors induced the most differentially expressed genes in gastrocnemius muscle, including genes related to muscle growth, contraction, differentiation, filament organization, matrix remodelling, and metabolism, while the transcriptome in soleus of dKO mice was affected to a lesser extent. Moreover, double knockout of both TGF-β type I receptors induced substantial hypertrophy which was accompanied by an increase in muscle force-generating capacity. In contrast, knockout of individual receptors had little effect on the changes of muscle mass and strength. For fast-type muscle in dKO mice, muscle mass was increased by 60%, while maximal isometric contraction force was only increased by 30%, resulting in a 23% reduction in specific force. For slow-type soleus muscle, the magnitude of hypertrophy was substantially lower (23%), the maximal isometric contractile force was increased by 66%, yielding an unaltered specific force. Strikingly, for both fast- and slow-type muscles of dKO mice increased myofibre CSA was accompanied by increased integrated SDH and cytochrome C oxidase activity in muscles, indicating increased oxidative capacity. In addition, capillary to myofibre ratio was increased and myoglobin concentration was unchanged within myofibres in low oxidative region of gastrocnemius and soleus lacking both type I receptors, suggesting enhanced oxygen supply and sustained intracellular oxygen transportation in hypertrophic muscle. Our study reveals a critical role of TGF-β type I receptors in the regulation of muscle type-specific strength, phenotype, metabolism and provides targets and cues for the development of treatment for muscle wasting disorders.

Fast-type gastrocnemius muscle lacking both TGF-β type I receptors shows the largest number of DEGs and highest increase in muscle mass

Targeting both Acvr1b and Tgfbr1 in fast-type muscles resulted in the largest number of DEGs and sizable muscle hypertrophy compared to control (wild-type) muscles. Simultaneous receptor knockout induced modest DEGs and a lesser extent of hypertrophy in the soleus. Although transcriptomic profiles in both gastrocnemius and soleus of single knockout mice were different from those of wild-type mice, the lack of either Acvr1b or Tgfbr1 induced modest muscle hypertrophy and phenotype alterations. These results imply functional redundancy of ACVR1B and TGFBR1 in skeletal muscle. The larger number of DEGs and muscle hypertrophy in gastrocnemius of dKO mice may contribute to the higher gene expression levels of Acv1b and Tgfbr1 than in soleus. Since gene expression level of Acvr1b and Tgfbr1 in the soleus of control mice was 10% and 40% of that in gastrocnemius of control mice, respectively (Fig. 1. C, D), low expression levels of TGF-β type I receptors likely resulted in a less pronounced effect of gene knockout on muscle transcriptomic profile and phenotype. In addition, most of the DEGs in fast-type muscle of dKO mice were associated with muscle contraction, muscle growth and differentiation, sarcomere organization, matrix remodeling, and metabolism (Fig. 1. K). These findings indicate that TGF-β signalling plays an important role in several cellular processes and physiological activities in skeletal muscle.

In addition to the largest number of DEGs, double knockout of TGF-β type I receptors induced the largest hypertrophy in fast-type muscle. Previously we have shown that 5 weeks after tamoxifen-induced knockout of both TGF-β type I receptors in skeletal muscle, type IIB myofibre CSA of tibialis anterior muscle was increased by twofold, while type I myofibre CSA was not changed ⁴⁰. Here, three months after inducible knockout of both type I receptors, FCSA was increased in both fast-and slow-type muscles. Interestingly, FCSA in low oxidative region of gastrocnemius muscles which consist predominantly of type IIB myofibre was increased by 3.2-fold in dKO mice (Fig. 2. E), while FCSA in high oxidative region of gastrocnemius and soleus of dKO mice was increased by 1.5-fold (Fig. 2. G). These observations are in line with previous observations that fast-type myofibres of human and rodents have a stronger potential to hypertrophy in response to hypertrophic stimuli by resistance exercise ^41,42 or mechanical overload ⁴³. In addition, the increased Hgf expression, particularly in gastrocnemius muscles of dKO mice, may have contributed to the substantial muscle hypertrophy in this muscle which exceeded that shown in soleus. HGF induces both protein synthesis signalling in muscle cells and activates MuSCs ^44,45, the increased expression of Hgf in gastrocnemius of dKO mice likely stimulated an increase in protein synthesis rate and may have supported regeneration of myofibres in the outer region (Fig. 4. J). Since Hgf expression was still upregulated after 3 months of dKO mice, it is highly conceivable that HGF was a key factor in the continuous elevated protein synthesis in fast-type muscle.

Maximum isometric force is increased while specific force is reduced in fast-type muscle in the absence of both TGF-β type I receptors

Despite the substantial muscle hypertrophy induced by double knockout of TGF-β type I receptors in gastrocnemius, muscle maximum isometric force was not proportionally increased, resulting in reduced specific force. In contrast, specific force was not decreased in soleus (Fig. 2. H, I). The faster rate of hypertrophy and the discrepancy in hypertrophy and force-generating capacity in fast-type myofibres raise the question what the mechanism is underling these differences between fast-type and slow-type myofibres and what the explanation is for the differential effects on force-generating capacity. Several factors determine the maximal force-generating capacity of a muscle (e.g., myofibre type composition, cross bridge density, and muscle architecture) ⁴⁶.

The disproportional changes in muscle size and strength in the fast-type myofibres may be explained by two mechanisms. One explanation may be an unbalanced increase in contractile protein content and in systems for excitation-contraction coupling (ECC). Although fast-type myofibres generate higher specific forces than slow-type myofibres ^47,48, the increase in myofibre CSA occurred concurrently with a reduction in specific force ⁴⁹. Previously it has been shown that supplementation of insulin stimulates hypertrophy of mature single myofibres in vitro, while the increase in maximal force remains half of the percentage of increase in CSA when the number of sarcomeres in series is unchanged ⁵⁰. It is conceivable that the production of contractile machinery and functional improvement is delayed compared to the increase in muscle mass ⁵¹. This observation is in line with the concurrently reduced specific force and myosin content in myostatin-null mice, indicating a reduced number of functional bound cross-bridges ³⁰. Here in the current study, the reduced gene expressions of Mylk2, Myl2, Myh7 and Myh6 in gastrocnemius of dKO mice suggests a reduced expression of proteins involved in the contractile machinery. The imbalance in contractile and total protein content in myofibres of dKO mice likely contributed to the reduction in specific force of gastrocnemius. In addition, in our transcriptomic analysis, sarcolipin (Sln), a negative regulator of sarcoplasmic reticulum ATPase (SERCA), showed a 20-fold increase in gastrocnemius muscles of dKO mice, suggesting an enhanced inhibition of cytosolic calcium reuptake in the sarcoplasmic reticulum. Inhibition of SERCA protein activity disrupts the ECC process, which has been related to increased cytosolic calcium and muscle weakness ⁵². It has been shown that overexpression of Sln reduced peak twitch force and tetanic force in soleus muscle ⁵³, and also reduced contractility of cardiac myocytes due to the reduced calcium uptake rate of sarcoplasmic reticulum ⁵⁴. The substantially increase in Sln expression level in gastrocnemius may explain the reduced specific force. The differences in the fold increase of Sln expression between gastrocnemius and soleus (20-fold vs. 2.3-fold) of dKO mice potentially have contributed to the differences in muscle force generating compacity (i.e. specific force).

A second explanation could be the impaired replacement of dysfunctional contractile and cytoskeletal proteins. Our RNA-seq data show that gene expression of Foxo1 was decreased in gastrocnemius of dKO mice, indicating inhibition of protein degradation (Supplementary Data). The inhibition of protein degradation rate may lead to accumulation of dysfunctional myofibrils both quantitively and qualitatively, causing a reduced force production ⁵⁵. These observations are in line with the reduced specific force in EDL muscle of myostatin-null mice, which was accompanied by reduced expression levels of atrogin-1 and ubiquitinated myosin heavy chain ⁵⁶. Similarly, muscle-specific knockout of Foxo1, 3 and 4 in mice increased myofibre CSA while maximal gastrocnemius contraction force was also reduced ⁵⁷. Skinned myofibre segment experiments are warranted to reveal the contribution of the impact of dysfunctional proteins in the reduction of specific force.

Lack of both type I receptors reduces eccentric contraction force in gastrocnemius muscles while has minor effects on muscle force-frequency relationship

Susceptibility to eccentric contraction-induced injury was examined for both the soleus and gastrocnemius muscles. For all groups, the relative force exerted during the series of eccentric contractions was less in gastrocnemius muscles of dKO mice rather than in soleus muscles of dKO mice compared to other groups, suggesting that fast, glycolytic muscle is more susceptible to eccentric loading induced strength loss (Fig. 4. A). This observation was in line with those of other studies showing a larger drop in force in fast, low oxidative EDL muscles compared to slow, high oxidative soleus muscles after eccentric contractions, followed by a higher release of lactase dehydrogenase, indicating more sarcolemmal damage in the fast-type muscle ^26,58. Type II myofibres are more damaged after eccentric contraction than type I myofibres ⁵⁹. Cytoskeletal elements play critical roles in maintaining myofibre structural integrity. Fibre type relative differences in Z-line composition, the titin isoform stiffness, nebulin size, dystrophin content and length have been argued to contribute to the higher vulnerability to injury and the force loss ⁶⁰. However, we did not observe any differences in the expression of related genes.

Another factor that may have contributed to the enhanced susceptibility to injury is related to the increase in gene expression of Mybph (Fig. 3. N). Mybph encodes a homologue of MYBPC. MYBPH is presumed as a putative skeletal muscle biomarker of amyotrophic lateral sclerosis and signals the onset of disruption of actin-myosin interaction ⁶¹. Upregulation of Mybph is a feature of severe myopathy ^62,63. The extent to which the elevated Mybph expression in dKO muscles contributes to the susceptibility of eccentric contraction-induced strength loss remains to be determined.

In addition, we observed an increase in Obsl1 expression in both fast- and slow-type muscles of dKO mice (Fig. 3. M). Obsl1 encodes for obscurin-like 1 (OBSL1) which is a homologue of obscurin. Both obscurin and OBSL1 bind to myomesin and titin in the M-band to stabilize sarcomere structure ⁶⁴. The increased Obsl1 expression suggests an adaptation of the cytoskeleton in response to the high forces that was exerted by hypertrophic myofibres. Despite the elevated levels of Obsl1 in dKO mice, the substantial loss in gastrocnemius muscle strength of dKO suggests that assembly of cytoskeleton proteins was not optimal in fast-type muscle. As the function of OBSL1 is not fully understood yet, the disruption of sarcomeric alignment and actin-myosin function during eccentric contraction in fast-type muscle of dKO mice requires further investigation.

Alternatively, high forces generated by the hypertrophic myofibres may cause high, local sarcomere strains along the sarcolemma, resulting in an increased susceptibility to contraction induced injury. Moreover, as part of the cytoskeleton, actin filaments are linked to the syntrophin complex by dystrophin. In acinar cells, knockout of Sntb1 has been shown to result in dispersed actin and defective actin assembly ⁶⁵. Here, reduced expression of Sntb1 in gastrocnemius muscles of dKO mice is suggested to destabilize the sarcomeres. Given that dystrophin-deficient mice are particularly susceptible to damage from eccentric contractions due to the disruption of DGC complex ⁶⁶, it is conceivable that in dKO gastrocnemius the reduced Sntb1 expression, as one of the DGC elements, may jeopardize cell membrane integrity and increase susceptibility to contraction-induced muscle damage ⁶⁷. As a result, the scar tissue and regenerating myofibres observed in regions of in low oxidative region of dKO gastrocnemius may lead to further muscle injury and force loss after eccentric contraction (Fig. 4. J). In addition, reduced Sntb1 expression levels have been shown to be associated with increased myotube diameter in vitro, suggesting the regulatory effect of SNTB1 on muscle size ⁶⁸.

This study shows that endomysium and perimysium thickness in muscles lacking both type I receptors were increased in proportion with the increase in myofibre CSA (Fig. 4. H, I). The increase endomysium and perimysium thickness could be an adaptation to the higher forces exerted by hypertrophic myofifbre ⁶⁹ and as such does not explain the enhanced eccentric contraction-induced reduction in force-generating capacity in dKO gastrocnemius muscle.

Lack of both Acvr1b and Tgfbr1 stimulates hypertrophy and oxidative metabolic capacity

Here we demonstrate that simultaneous myofibre-specific knockout of both TGF-β type I receptors allows for simultaneous increase myofibre size and oxidative capacity. Myofibres that lack both Tgfbr1 and Acvr1b show increased integrated SDH activity compared to myofibres of similar size of control mice and other species. In general, throughout a range of species myofibre size and oxidative metabolism are inversely related ^13,39, indicating that hypertrophy and an increase in oxidative metabolism are mutually exclusive. Generally, it is a challenge to simultaneously increase muscle size and oxidative capacity cf.¹³. In human, the increase in muscle mass induced by resistance training was blunted by concurrently performing endurance training which increased mitochondrial activity ^70,71. Our quantitative histochemical assessment of SDH activity provides calibrated histological estimates of myofibre VO_2max ⁷². Integrated SDH activity was increased in myofibres of dKO mice. In addition, cytochrome c oxidase activity per myofibre CSA was not changed in hypertrophic myofibres of dKO mice compared to control (Fig. 5. K). The increased integrated SDH and cytochrome c oxidase activities in myofibres of dKO mice indicate the increased mitochondrial respiratory chain activity. This unique finding demonstrates that the inverse relation between of myofibre size and oxidative metabolism capacity is violated by knocking out both TGF-β type I receptors.

Regarding the regulatory mechanisms underlying the increase in myofibre mitochondrial biosynthesis, the transcriptome analysis suggested that the increased oxidative metabolic capacity was due to the increased transcription of mitochondrial genes per myofibre. Since the amount of total mRNA per milligram muscle and the number of total nuclei per myofibre were not changed (Supplementary Fig. 1. J, Fig. 3H), the increased mRNA levels per myofibre was due to the increase in transcripts. This suggests that in dKO mice, transcriptional rate of mitochondrial genes per myonucleus was enhanced, which contributes to the increased number of proteins in the respiratory chain and mitochondrial content, leading to increased aerobic metabolic activity in myofibres. In addition, 20-fold increased Sln in gastrocnemius of dKO mice may contribute to the enhanced aerobic metabolism. High Sln expression level has been shown to increase oxidative metabolism in skeletal muscle ⁷³. Over expression of Sln triggered mitochondrial biogenesis by raising intracellular calcium concentration which activates CAMKII and PGC-1α ⁷⁴. By uncoupling SERCA, SLN increased energy demand, leading to enhanced mitochondrial biogenesis and ATP production ⁷⁵. These observations indicate that TGF-β type I receptor signalling is likely a key play in the regulation of mitochondrial biosynthesis.

Sufficient oxygen supply is pivotal to maintain mitochondrial ATP production ⁷⁶. We asked whether increased integrated SDH activity in dKO mice was accompanied by increased oxygen supply and uptake. Previous studies have shown that capillary supply to a myofibre is associated with the myofibre CSA ⁷⁷. Local capillary to myofibre ratio showed a positive correlation with myofibre size in human and rates muscles ⁷⁸. We assumed that intracellular oxygen transportation should be increased to meet the oxygen demand within myofibres lacking both Acvr1b and Tgfbr1. Here, we found an increase in capillary to myofibre ratio in the low oxidative region in gastrocnemius and soleus muscles in the absence of both type I receptors (Fig. 5. N). This indicates that myofibre-specific knockout of both TGF-β type I receptors stimulates capillarization. In addition to extracellular oxygen supply, intracellular oxygen transportation is also important to facilitate oxygen diffusion for oxidative energy production, which is mainly regulated by myoglobin ^79,80. Although gene expression levels of Mb in gastrocnemius of dKO mice were reduced (Fig. 5. L), myoglobin concentration within myofibres was unchanged in the low oxidative region of gastrocnemius and soleus (Fig. 5. M), which was likely caused by enhanced rate of translation. This suggests that increased myoglobin content may have contributed to enhanced intracellular oxygen transport within the superficial region of fast-type muscle and slow-type muscle to prevent hypoxia in the core of myofibre. In addition to oxygen storage and diffusion to the mitochondria within the myocyte, deoxymyoglobin has been shown to have strong nitrite reductase activity and able to generate nitric oxide (NO) ⁸¹. NO causes vasodilation and increases the blood flow to ensure sufficient oxygen delivery to the myofibre to match its metabolic requirements. Overall, the myofibre-specific lack of both Acvr1b and Tgfbr1 in skeletal muscle increases myofibre CSA, oxidative metabolism, vascularization and facilitates intracellular myofibre oxygen transport simultaneously, suggesting that inhibition of TGF-β type I receptors signalling potentially improves muscle endurance capacity.

Potential clinical implications of simultaneous knockout of Acvr1b and Tgfbr1

The present study shows three results with clinical relevance. First of all, myofibre-specific lack of both Acvr1b and Tgfbr1 increases myofibre size and oxidative capacity, indicating that potential pharmacological interference with these receptors may improve muscle strength and endurance capacity simultaneoulsy. Secondly, our results indicate that simultaneous receptor knockout positively affects force generation capacity particularly in slow, high oxidative myofibres, as a specific force in soleus muscles is preserved. Increased muscle mass with a less than proportional increase in force-generating capacity may not be beneficial. It is worth investigating whether endurance exercise combined with simultaneous pharmacological inhibition of Acvr1b and Tgfbr1 may enhance force-generating capacity, while preserving or improving specific muscle force. Note that human skeletal muscles do not express type IIB myosin, thus simultaneously blocking Acvr1b and Tgfbr1 in adult human skeletal muscle may resemble the results observed in mouse soleus muscle rather than those in gastrocnemius muscle. Last, lack of Acvr1b and Tgfbr1 in fast, glycolytic muscles reduced eccentric force-generating capacity, which is a potential indication for increased susceptibility to injurious eccentric loading. Therefore, it is noteworthy that in the development of a therapeutic intervention, substantial hypertrophy of glycolytic myofibres should be restrained to minimize the risk for injury.

In conclusion, our results indicate that myofibre-specific long-lasting simultaneous blocking of Acvr1b and Tgfbr1 in mice skeletal muscles results in muscle transcriptional changes, including genes involved in muscle growth, contraction, differentiation, filament organization, matrix remodelling, and metabolism. Knockout of both type I receptors differentially increases muscle mass and improves force-generating capacity in fast, glycolytic gastrocnemius and slow, high oxidative soleus muscles. Combined inhibition of both receptors in fast-type muscle induces a larger increase in muscle mass than that in force-generating capacity, while muscle mass in slow-type muscle is increased to a lower extent, but is in proportion with the increase in force-generating capacity. Substantial hypertrophy in fast-type muscles increases susceptibility to eccentric contraction induced injury. Moreover, combined myofibre specific knockout of both Tgfbr1 and Acvr1b increases SDH activity in proportion with the increased myofibre size. Although myofbre size and oxidative capacity are usually inversely related, simultaneous inhibition of TGF-β type I receptors seems to be a beneficial strategy to alleviate muscle pathology that may outperform other strategies, as interference with these receptors may improve muscle strength and aerobic metabolism capacity simultaneously.

Treatment of transgenic mice

The HSA-MCM mouse line originated from McCarthy lab ⁸² was obtained from Jackson Laboratory (Bar Harbor, ME, USA (stock number # 025750)). Mouse line Acvr1b^fl/fl83 was provided by Philippe Bertolino (Cancer Research Center of Lyon, French Institute of Health and Medical Research) and the Tgfbr1 KO mouse line ⁸⁴ was provided by Peter ten Dijke (Leiden University Medical Center). All animals were of a C57BL/6 background. Mouse lines were crossbred in-house to obtain HSA-MCM:Acvr1b^fl/fl, HSA-MCM:Tgfbr1^fl/fl and HSA-MCM: Acvr1b^fl/fl:Tgfbr1^fl/fl mouse lines (further be referred to Acvr1b KO, Tgfbr1 KO and dKO mice). Mouse lines were crossbred homozygously for the targeted loxP sites and heterozygously for inducible Cre recombinase enzyme. Food (Teklad, Envigo, Horst, The Netherlands) and water were available ad libitum. All experiments were performed according to the national guidelines approved by the Central Committee for Animal Experiments (CCD) (AVD112002017862) and the Institute of Animal Welfare (IvD) of the Vrije Universiteit Amsterdam. Genotyping for the HSA-MCM, Acvr1b^fl/fl and Tgfbr1^fl/fl genes was performed by using DNA isolated from ear notches. PCR was performed according to the corresponding genotyping protocol to validate the effect of gene knockout. The following primer sequences were used for genotyping: HSA-MCM gene: forward, 5′- GCATGGTGGAGATCTTTGA-3′ ⁸⁵, reverse, 5′-CGACCGGCAAACGGACAGAAGC-’3 ⁸², Acvr1b^fl/fl gene: In4, 5’-CAGTGGTTAAGAACACTGGC-3’, In5, 5’- GTAGTGTTATGTGTTATTGCC − 3’, In6, 5’GAGCAAGAGTTTCTCTATGTAG-3’ ⁸³and Tgfbr1^fl/fl gene: forward, 5’- CCTGCAGTAAACTTGGAATAAGAAG-’3, reverse, 5’- GACCATCAGCTGTCAGTACCC-3’ (Protocol 19216: Standard PCR Assay - Tgfbr1 < tm1.1Karl>, Jackson Laboratory, Bar Harbor, ME,USA) ⁸⁴. At an age of six weeks old, male mice were injected intraperitoneally with 100mg/kg/day TMX (10mg/ml, Sigma-Aldrich, T5648) for five consecutive days to activate Cre recombinase enzyme.

RNA-seq and data analysis

RNA from both left gastrocnemius medialis (gastrocnemius) and soleus muscles of four animals was extracted for RNA-seq by using TRIzol (Thermo Fisher Scientific). Ribopure Link (Thermo Fisher Scientific) and DNAse I (Invitrogen) were used to isolate RNA. RNA purity was checked by 2200 TapeStation (Agilent Technologies), RIN values were all above 7.7. RNA concentration was measured by fluorometric quantification QbuitFluorometer (Life Technologies). RNA-seq library was prepared by enriching mRNA with KAPA mRNA Hyperprep (Roche Sequencing Solutions, Indianapolis, IN, USA). A total of 32 libraries were pooled and loaded on 4 lanes of Hiseq 4000 (Illumina, San Diego, CA, USA) that generated a single read of 50-base pairs per sample. On average, 43 million reads were produced per lane. Sequence quality was checked by FASTQC (version 0.11.9) that all sequences past Q value 30. Cutadapt was used for adapter trimming. Sequence reads were mapped to the mouse reference genome (GRCm38.p6, https://www.ncbi.nlm.nih.gov/assembly/GCF_000001635.26/) by HISAT2 (version 1.33). Mapped sequences were converted to normalized read counts using featureCounts (version 1.5.0-p3) ⁸⁶ and Ensembl GTF annotation. DESeq2 was used to analyse the DEGs on R2 platform (https://hgserver2.amc.nl/). Genes with relative expression of Benjamini-Hochberg-adjusted P \(\:<\) 0.05 and fold change ≥ 1.5 were considered differentially expressed. DEGs in gastrocnemius of dKO mice were used to construct heatmaps on R2 platform. GO analysis of biological process was performed on DAVID 6.8 ⁸⁷.

qPCR assay

Six biologically independent samples were used for qPCR using the Quant Studio 3 real time PCR (Applied Biosystems, Foster City, CA, USA) and SYBR Green master mix (Applied Biosystems, A25742, Foster City, CA, USA). Relative expression levels were normalized to expression levels of 18S mRNA. The primer sets are shown in Supplementary Table 5.

In situ contractile force measurement

Contractile force characteristics of both gastrocnemius and soleus muscles were measured three months after TMX injections. Mice were given analgesic, buprenorphine (Temgesic, 0.3 mg/ml, 0.1mg/kg), and anesthetised with 0.5-2% isoflurane (TEVA Pharmachemie BV, Haarlem) oxygen/air 0.2L/min. Right gastrocnemius medialis and soleus muscles were exposed that the proximal tendon was solely connected to the hind limb while the distal tendon was connected to a force transducer, leaving the innervation and blood supply intact. Muscles were kept humid during the whole assay. An electrical cuff was used to stimulate the gastrocnemius or soleus branch of the tibial nerve. After determining the amplitude of the electrical current for optimal muscle stimulation in mA (DS3 Isolated Current Stimulator, Digitimer), all experiments were performed at this amplitude. The length-force relation was determined by inducing tetanic isometric contractions (300ms, at 150Hz) at increasing muscle lengths, ranging from near active slack length until approximately 1 mm over optimal muscle length (l_o) (1 or 0.5-mm increments). Here, l_o is the muscle length at which the muscle attained the highest active force (P_o), i.e. the total force minus the passive force generated at that length. Each tetanic contraction was preceded and followed by two twitches with a 300ms interval between each twitch or tetanus. Between two subsequent tetanic contractions, muscles were kept at rest at slack length for 2 minutes to allow metabolical recovery. To determine passive and active muscle lengths during contractions, videos of contractions were analysed in Tracker software version 5.0.7 (obtained September 2019 via https://www.physlets.org/tracker/). Force-frequency relations were determined by inducing tetanic isometric contractions at approximately l_o at increasing stimulation frequencies. Subsequently, to test muscle susceptibility to damage, fifteen consecutive eccentric contractions were performed. Muscles were stimulated at 95% of their optimal length at 150Hz for 100ms and stretched to 116% of their optimal length (l_o) with a speed of 0.75l_o (ms^-1) during stimulation. Total stimulation duration was 500ms. After this, mice were euthanized with 0.1ml Euthasol injected into the heart and muscles were quickly dissected and weighed. Muscles were snap frozen in liquid nitrogen and stored at -80°C.

Immunofluorescence and histological analysis

Cryosections of 10 µm were cut from both gastrocnemius and soleus muscles (n = 6–8). Samples were subjected to immunofluorescence staining using antibodies against type I (BAD-5-s) (1 µg/mL), IIA (SC-71) (10 µg/mL), IIX (6H1) (1 µg/mL) and IIB (BF-F3) (1 µg/mL) (DSHB, Iowa City, IA, USA) myosin heavy chain were used as the primary antibodies. Goat anti-Mouse Alexa Fluor® 647 IgG2b (5 µg/mL), Goat anti-Mouse Alexa Fluor® 488 IgG1 (5 µg/mL), Goat anti-Mouse Alexa Fluor® 647 IgM (5 µg/mL), Goat anti-Mouse Alexa Fluor® 488 IgM (5 µg/mL) (Thermo Scientific, Waltham, MA, USA) were used as secondary antibodies. Sections were stained by wheat germ agglutinin (WGA) (1:50) (Fisher Scientific, USA) before being mounted with mounting medium containing 4‘,6-diamidino-2-phenylindole (DAPI) (Brunschwig, H1500, Amsterdam, The Netherlands). Images of all immunofluorescence assays were captured using a fluorescent microscope (Zeiss Axiovert 200M, Hyland Scientific, Stanwood, WA, USA) with a PCO SensiCam camera (PCO, Kelheim, Germany) using the program Slidebook 5.0 (Intelligent Imaging Innovations, Göttingen, Germany).

Histochemistry staining

Succinate dehydrogenase activity was quantified according to the method reported by Van der Laarse, et al ⁸⁸. Images were captured by a Leica DMRB microscope (Wetzlar, Germany) with calibrated grey filters and a CCD camera (Sony XC77CE, Towada, Japan) connected to a LG-3 frame grabber (Scion, Frederick, MD, United States). The absorbances of the SDH-reaction product in the sections were determined at 660 nm using a calibrated microdensitometer and ImageJ ⁸⁹. SDH activity (∆A₆₆₀ ∙ µm^-1 ∙s^-1) was measured by the rate of absorbance per section thickness per second [∆A₆₆₀/(10 µm ∙ 600s)) at 10× magnification. The integrated SDH activity (∆A₆₆₀ ∙ µm ∙s^-1) was defined as SDH activity × myofibre cross-sectional area (FCSA). The curve of fitted SDH is calculated as an average value of constant SDH × CSA ¹⁷². The value of constant SDH was calculated as the average of integrated SDH activity of each myofibre. Connective tissue was stained by Sirius red staining. Sections were fixed in bouin and stained by 1% Sirius Red ^90,91. Capillaries were stained by biotinylated lectin (Griffonia simplicifolia) (Vector Laboratories) ³². Calibrated myoglobin staining were performed by the method reported by Van der Laarse, et al ⁹². Cytochrome c oxidase activity was assessed as previously described by Old, et al ⁹³.

RNAscope assay

RNA in situ hybridization (ISH) was performed by using RNAscope (ACDBio) assay, multiplex fluorescent reagent kit (Cat No. 3423280) and following the manufacture’s protocols. Fresh-frozen cross-sections of both gastrocnemius and soleus were used for staining. The probes were RNAscope™ Probe-Mm-Acvr1b (Cat No. 429271), RNAscope™ Probe-Mm-Tgfbr1 (Cat No. 406201), positive control probe (Cat No. 320881) and negative control probe (Cat No. 320871). Images were captured by using a fluorescent microscope (Zeiss Axiovert 200M, Hyland Scientific, Stanwood, WA, USA). Background fluorescent staining was removed by using a negative staining. Images were deconvoluted by Huygens Professional 23.04. Numbers of Acvr1b and Tgfbr1 transcripts within a myofibre were counted from 10 myofibres per muscle by using ImageJ 1.54 (intensity threshold for Tgfbr1: 86-65535, Acvr1b: 2-65535; size: 4-500 pixels).

Statistical analysis

Data obtained from physiological measurements were analysed in MATLAB 2018a (MathWorks, Natick, MA, USA). Graphs were made in Prism version 8 (GraphPad Software, San Diego, CA, USA). All data were presented as mean ± standard error of the mean (SEM). Statistical analysis was performed in SPSS version 26 (IBM, Amsterdam, The Netherlands). Statistical significance for multiple comparisons was determined by two-way analysis of variance (ANOVA) or three-way mixed model ANOVA with post-hoc Bonferroni corrections, and Tgfbr1 and Acvr1b were considered between-group independent factors. Significance was set at P < 0.05. Either frequency or contraction number were considered as within subject repeated factor. Assumptions for normality (Shapiro-Wilk, P = 0.05) and equality of variance (Levene’s test, P = 0.01) were tested. For a three-way repeated measures ANOVA, data sets that violated these assumptions were excluded for statistical analysis. For two-way ANOVA, if assumptions were violated even after transformation, a Kruskall-Wallis nonparametric test was performed. For force-frequency relation, significance was tested at 5, 80, 100 and 125 Hz. For the eccentric contractions, two-way ANOVA was performed for contraction numbers 1, 4, 7, 10 and 14 in gastrocnemius and numbers 1, 6, 7, and 13 in soleus. Other data points were analysed using Kruskall-Wallis analyses because of violation of normality or equal variance.

ACKNOWLEDGEMENTS

We gratefully acknowledge Philippe Bertolino (Cancer Research Center of Lyon, French Institute of Health and Medical Research) for providing mouse line Acvr1b^fl/fl and Peter ten Dijke (Leiden University Medical Center) for providing the Tgfbr1^fl/flmouse line. We thank animal caretakers of the Universitair Proefdier Centrum of the Vrije Universiteit Amsterdam, our colleague Wendy Noort, students Elke Schmitz and Bijee Visbeek for their contribution to data analysis. Funding: Prinses Beatrix Spierfonds, grant number W.OR14-17 from MMG Hillege, WMH Hoogaars, RT Jaspers; China Scholarship Council personal grant form A Shi (CSC grant number: 201808440351).

Leger, B., Derave, W., De Bock, K., Hespel, P. & Russell, A. P. Human sarcopenia reveals an increase in SOCS-3 and myostatin and a reduced efficiency of Akt phosphorylation. Rejuvenation Res 11, 163-175B (2008). https://doi.org/10.1089/rej.2007.0588
Carlson, M. E., Hsu, M. & Conboy, I. M. Imbalance between pSmad3 and Notch induces CDK inhibitors in old muscle stem cells. Nature 454, 528-532 (2008). https://doi.org/10.1038/nature07034
Ballak, S. B., Degens, H., Buse-Pot, T., de Haan, A. & Jaspers, R. T. Plantaris muscle weakness in old mice: relative contributions of changes in specific force, muscle mass, myofiber cross-sectional area, and number. Age (Dordr) 36, 9726 (2014). https://doi.org/10.1007/s11357-014-9726-0
Bernasconi, P. et al. Expression of transforming growth factor-beta 1 in dystrophic patient muscles correlates with fibrosis. Pathogenetic role of a fibrogenic cytokine. J Clin Invest 96, 1137-1144 (1995). https://doi.org/10.1172/JCI118101
Tanaka, M., Miyazaki, H., Takeda, Y. & Takeo, S. Detection of serum cytokine levels in experimental cancer cachexia of colon 26 adenocarcinoma-bearing mice. Cancer Lett 72, 65-70 (1993). https://doi.org/10.1016/0304-3835(93)90012-x
Costelli, P. et al. Muscle myostatin signalling is enhanced in experimental cancer cachexia. Eur J Clin Invest 38, 531-538 (2008). https://doi.org/10.1111/j.1365-2362.2008.01970.x
Andreetta, F. et al. Immunomodulation of TGF-beta 1 in mdx mouse inhibits connective tissue proliferation in diaphragm but increases inflammatory response: implications for antifibrotic therapy. J Neuroimmunol 175, 77-86 (2006). https://doi.org/10.1016/j.jneuroim.2006.03.005
Wilkinson, D. J., Piasecki, M. & Atherton, P. J. The age-related loss of skeletal muscle mass and function: Measurement and physiology of muscle fibre atrophy and muscle fibre loss in humans. Ageing Res Rev 47, 123-132 (2018). https://doi.org/10.1016/j.arr.2018.07.005
Cohen, S., Nathan, J. A. & Goldberg, A. L. Muscle wasting in disease: molecular mechanisms and promising therapies. Nat Rev Drug Discov 14, 58-74 (2015). https://doi.org/10.1038/nrd4467
van der Zwaard, S. et al. Critical determinants of combined sprint and endurance performance: an integrative analysis from muscle fiber to the human body. FASEB J 32, 2110-2123 (2018). https://doi.org/10.1096/fj.201700827R
Rosa-Caldwell, M. E. et al. Mitochondrial aberrations during the progression of disuse atrophy differentially affect male and female mice. J Cachexia Sarcopenia Muscle 12, 2056-2068 (2021). https://doi.org/10.1002/jcsm.12809
van den Borst, B. et al. Loss of quadriceps muscle oxidative phenotype and decreased endurance in patients with mild-to-moderate COPD. J Appl Physiol (1985) 114, 1319-1328 (2013). https://doi.org/10.1152/japplphysiol.00508.2012
van Wessel, T., de Haan, A., van der Laarse, W. J. & Jaspers, R. T. The muscle fiber type-fiber size paradox: hypertrophy or oxidative metabolism? Eur J Appl Physiol 110, 665-694 (2010). https://doi.org/10.1007/s00421-010-1545-0
Latres, E. et al. Activin A more prominently regulates muscle mass in primates than does GDF8. Nat Commun 8, 15153 (2017). https://doi.org/10.1038/ncomms15153
Mendias, C. L. et al. Transforming growth factor-beta induces skeletal muscle atrophy and fibrosis through the induction of atrogin-1 and scleraxis. Muscle Nerve 45, 55-59 (2012). https://doi.org/10.1002/mus.22232
Langley, B. et al. Myostatin inhibits myoblast differentiation by down-regulating MyoD expression. J Biol Chem 277, 49831-49840 (2002). https://doi.org/10.1074/jbc.M204291200
Hillege, M. M. G. et al. TGF-beta Regulates Collagen Type I Expression in Myoblasts and Myotubes via Transient Ctgf and Fgf-2 Expression. Cells 9 (2020). https://doi.org/10.3390/cells9020375
Hoffmann, C. et al. The effect of differentiation and TGFbeta on mitochondrial respiration and mitochondrial enzyme abundance in cultured primary human skeletal muscle cells. Sci Rep 8, 737 (2018). https://doi.org/10.1038/s41598-017-18658-3
Rebbapragada, A., Benchabane, H., Wrana, J. L., Celeste, A. J. & Attisano, L. Myostatin signals through a transforming growth factor beta-like signaling pathway to block adipogenesis. Mol Cell Biol 23, 7230-7242 (2003). https://doi.org/10.1128/MCB.23.20.7230-7242.2003
Kemaladewi, D. U. et al. Cell-type specific regulation of myostatin signaling. FASEB J 26, 1462-1472 (2012). https://doi.org/10.1096/fj.11-191189
Allen, D. L. & Unterman, T. G. Regulation of myostatin expression and myoblast differentiation by FoxO and SMAD transcription factors. Am J Physiol Cell Physiol 292, C188-199 (2007). https://doi.org/10.1152/ajpcell.00542.2005
Matsakas, A. et al. Molecular, cellular and physiological investigation of myostatin propeptide-mediated muscle growth in adult mice. Neuromuscul Disord 19, 489-499 (2009). https://doi.org/10.1016/j.nmd.2009.06.367
Lach-Trifilieff, E. et al. An antibody blocking activin type II receptors induces strong skeletal muscle hypertrophy and protects from atrophy. Mol Cell Biol 34, 606-618 (2014). https://doi.org/10.1128/MCB.01307-13
Lee, S. J. et al. Functional redundancy of type I and type II receptors in the regulation of skeletal muscle growth by myostatin and activin A. Proc Natl Acad Sci U S A 117, 30907-30917 (2020). https://doi.org/10.1073/pnas.2019263117
Wang, M., Yu, H., Kim, Y. S., Bidwell, C. A. & Kuang, S. Myostatin facilitates slow and inhibits fast myosin heavy chain expression during myogenic differentiation. Biochem Biophys Res Commun 426, 83-88 (2012). https://doi.org/10.1016/j.bbrc.2012.08.040
Mendias, C. L., Marcin, J. E., Calerdon, D. R. & Faulkner, J. A. Contractile properties of EDL and soleus muscles of myostatin-deficient mice. J Appl Physiol (1985) 101, 898-905 (2006). https://doi.org/10.1152/japplphysiol.00126.2006
Verbrugge, S. A. J. et al. PKM2 Determines Myofiber Hypertrophy In Vitro and Increases in Response to Resistance Exercise in Human Skeletal Muscle. Int J Mol Sci 21 (2020). https://doi.org/10.3390/ijms21197062
Amthor, H. et al. Lack of myostatin results in excessive muscle growth but impaired force generation. Proc Natl Acad Sci U S A 104, 1835-1840 (2007). https://doi.org/10.1073/pnas.0604893104
Personius, K. E. et al. Grip force, EDL contractile properties, and voluntary wheel running after postdevelopmental myostatin depletion in mice. J Appl Physiol (1985) 109, 886-894 (2010). https://doi.org/10.1152/japplphysiol.00300.2010
Qaisar, R. et al. Is functional hypertrophy and specific force coupled with the addition of myonuclei at the single muscle fiber level? FASEB J 26, 1077-1085 (2012). https://doi.org/10.1096/fj.11-192195
Welle, S., Cardillo, A., Zanche, M. & Tawil, R. Skeletal muscle gene expression after myostatin knockout in mature mice. Physiol Genomics 38, 342-350 (2009). https://doi.org/10.1152/physiolgenomics.00054.2009
Ballak, S. B. et al. Blunted angiogenesis and hypertrophy are associated with increased fatigue resistance and unchanged aerobic capacity in old overloaded mouse muscle. Age (Dordr) 38, 39 (2016). https://doi.org/10.1007/s11357-016-9894-1
Ploquin, C. et al. Lack of myostatin alters intermyofibrillar mitochondria activity, unbalances redox status, and impairs tolerance to chronic repetitive contractions in muscle. Am J Physiol Endocrinol Metab 302, E1000-1008 (2012). https://doi.org/10.1152/ajpendo.00652.2011
Omairi, S. et al. Enhanced exercise and regenerative capacity in a mouse model that violates size constraints of oxidative muscle fibres. Elife 5 (2016). https://doi.org/10.7554/eLife.16940
Gumerson, J. D. & Michele, D. E. The dystrophin-glycoprotein complex in the prevention of muscle damage. J Biomed Biotechnol 2011, 210797 (2011). https://doi.org/10.1155/2011/210797
Brooks, S. V. Rapid recovery following contraction-induced injury to in situ skeletal muscles in mdx mice. J Muscle Res Cell Motil 19, 179-187 (1998). https://doi.org/10.1023/a:1005364713451
Hyldahl, R. D. et al. Extracellular matrix remodeling and its contribution to protective adaptation following lengthening contractions in human muscle. FASEB J 29, 2894-2904 (2015). https://doi.org/10.1096/fj.14-266668
Mackey, A. L. & Kjaer, M. Connective tissue regeneration in skeletal muscle after eccentric contraction-induced injury. J Appl Physiol (1985) 122, 533-540 (2017). https://doi.org/10.1152/japplphysiol.00577.2016
van der laarse, W., Tombe, A. L., Groot, M. B. E. & Diegenbach, P. C. Size Principle of Striated Muscle Cells. Netherlands Journal of Zoology 48, 213-223 (1997). https://doi.org/10.1163/156854298X00075
Hillege, M. M. G. et al. Lack of Tgfbr1 and Acvr1b synergistically stimulates myofibre hypertrophy and accelerates muscle regeneration. Elife 11 (2022). https://doi.org/10.7554/eLife.77610
Andersen, J. L. & Aagaard, P. Myosin heavy chain IIX overshoot in human skeletal muscle. Muscle Nerve 23, 1095-1104 (2000). https://doi.org/10.1002/1097-4598(200007)23:7<1095::aid-mus13>3.0.co;2-o
Kim, P. L., Staron, R. S. & Phillips, S. M. Fasted-state skeletal muscle protein synthesis after resistance exercise is altered with training. J Physiol 568, 283-290 (2005). https://doi.org/10.1113/jphysiol.2005.093708
Chale-Rush, A., Morris, E. P., Kendall, T. L., Brooks, N. E. & Fielding, R. A. Effects of chronic overload on muscle hypertrophy and mTOR signaling in young adult and aged rats. J Gerontol A Biol Sci Med Sci 64, 1232-1239 (2009). https://doi.org/10.1093/gerona/glp146
Walker, N., Kahamba, T., Woudberg, N., Goetsch, K. & Niesler, C. Dose-dependent modulation of myogenesis by HGF: implications for c-Met expression and downstream signalling pathways. Growth Factors 33, 229-241 (2015). https://doi.org/10.3109/08977194.2015.1058260
Perdomo, G. et al. Hepatocyte growth factor is a novel stimulator of glucose uptake and metabolism in skeletal muscle cells. J Biol Chem 283, 13700-13706 (2008). https://doi.org/10.1074/jbc.M707551200
Fitts, R. H., McDonald, K. S. & Schluter, J. M. The determinants of skeletal muscle force and power: their adaptability with changes in activity pattern. J Biomech 24 Suppl 1, 111-122 (1991). https://doi.org/10.1016/0021-9290(91)90382-w
Stephenson, D. G. & Williams, D. A. Calcium-activated force responses in fast- and slow-twitch skinned muscle fibres of the rat at different temperatures. J Physiol 317, 281-302 (1981). https://doi.org/10.1113/jphysiol.1981.sp013825
Dutka, T. L. et al. ROS-mediated decline in maximum Ca2+-activated force in rat skeletal muscle fibers following in vitro and in vivo stimulation. PLoS One 7, e35226 (2012). https://doi.org/10.1371/journal.pone.0035226
Miller, M. S., Bedrin, N. G., Ades, P. A., Palmer, B. M. & Toth, M. J. Molecular determinants of force production in human skeletal muscle fibers: effects of myosin isoform expression and cross-sectional area. Am J Physiol Cell Physiol 308, C473-484 (2015). https://doi.org/10.1152/ajpcell.00158.2014
Jaspers, R. T. et al. Hypertrophy of mature Xenopus muscle fibres in culture induced by synergy of albumin and insulin. Pflugers Arch 457, 161-170 (2008).
Roberts, M. D., Haun, C. T., Vann, C. G., Osburn, S. C. & Young, K. C. Sarcoplasmic Hypertrophy in Skeletal Muscle: A Scientific "Unicorn" or Resistance Training Adaptation? Front Physiol 11, 816 (2020). https://doi.org/10.3389/fphys.2020.00816
Qaisar, R. et al. Oxidative stress-induced dysregulation of excitation-contraction coupling contributes to muscle weakness. J Cachexia Sarcopenia Muscle 9, 1003-1017 (2018). https://doi.org/10.1002/jcsm.12339
Tupling, A. R., Asahi, M. & MacLennan, D. H. Sarcolipin overexpression in rat slow twitch muscle inhibits sarcoplasmic reticulum Ca2+ uptake and impairs contractile function. J Biol Chem 277, 44740-44746 (2002). https://doi.org/10.1074/jbc.M206171200
Babu, G. J. et al. Overexpression of sarcolipin decreases myocyte contractility and calcium transient. Cardiovasc Res 65, 177-186 (2005). https://doi.org/10.1016/j.cardiores.2004.08.012
Tipton, K. D., Hamilton, D. L. & Gallagher, I. J. Assessing the Role of Muscle Protein Breakdown in Response to Nutrition and Exercise in Humans. Sports Med 48, 53-64 (2018). https://doi.org/10.1007/s40279-017-0845-5
Mendias, C. L., Kayupov, E., Bradley, J. R., Brooks, S. V. & Claflin, D. R. Decreased specific force and power production of muscle fibers from myostatin-deficient mice are associated with a suppression of protein degradation. J Appl Physiol (1985) 111, 185-191 (2011). https://doi.org/10.1152/japplphysiol.00126.2011
Milan, G. et al. Regulation of autophagy and the ubiquitin-proteasome system by the FoxO transcriptional network during muscle atrophy. Nat Commun 6, 6670 (2015). https://doi.org/10.1038/ncomms7670
Warren, G. L., Hayes, D. A., Lowe, D. A., Williams, J. H. & Armstrong, R. B. Eccentric contraction-induced injury in normal and hindlimb-suspended mouse soleus and EDL muscles. J Appl Physiol (1985) 77, 1421-1430 (1994). https://doi.org/10.1152/jappl.1994.77.3.1421
Hody, S., Croisier, J. L., Bury, T., Rogister, B. & Leprince, P. Eccentric Muscle Contractions: Risks and Benefits. Front Physiol 10, 536 (2019). https://doi.org/10.3389/fphys.2019.00536
Qaisar, R., Bhaskaran, S. & Van Remmen, H. Muscle fiber type diversification during exercise and regeneration. Free Radic Biol Med 98, 56-67 (2016). https://doi.org/10.1016/j.freeradbiomed.2016.03.025
Conti, A. et al. Increased expression of Myosin binding protein H in the skeletal muscle of amyotrophic lateral sclerosis patients. Biochim Biophys Acta 1842, 99-106 (2014). https://doi.org/10.1016/j.bbadis.2013.10.013
Norman, H. et al. Myofibrillar protein and gene expression in acute quadriplegic myopathy. J Neurol Sci 285, 28-38 (2009). https://doi.org/10.1016/j.jns.2009.04.041
Norman, H. et al. Impact of post-synaptic block of neuromuscular transmission, muscle unloading and mechanical ventilation on skeletal muscle protein and mRNA expression. Pflugers Arch 453, 53-66 (2006). https://doi.org/10.1007/s00424-006-0110-5
Kontrogianni-Konstantopoulos, A. et al. Obscurin modulates the assembly and organization of sarcomeres and the sarcoplasmic reticulum. FASEB J 20, 2102-2111 (2006). https://doi.org/10.1096/fj.06-5761com
Ye, R. et al. beta1 Syntrophin Supports Autophagy Initiation and Protects against Cerulein-Induced Acute Pancreatitis. Am J Pathol 189, 813-825 (2019). https://doi.org/10.1016/j.ajpath.2019.01.002
Proske, U. & Morgan, D. L. Muscle damage from eccentric exercise: mechanism, mechanical signs, adaptation and clinical applications. J Physiol 537, 333-345 (2001). https://doi.org/10.1111/j.1469-7793.2001.00333.x
Dowling, P. et al. The Dystrophin Node as Integrator of Cytoskeletal Organization, Lateral Force Transmission, Fiber Stability and Cellular Signaling in Skeletal Muscle. Proteomes 9 (2021). https://doi.org/10.3390/proteomes9010009
Shi, A. et al. Reduced myotube diameter induced by combined inhibition of transforming growth factor-β type I receptors Acvr1b and Tgfbr1 is associated with enhanced β1-syntrophin expression. Journal of Cellular Physiology n/a, e31418 https://doi.org/https://doi.org/10.1002/jcp.31418
An, J. Y. et al. Effect of myofiber characteristics and thickness of perimysium and endomysium on meat tenderness of chickens. Poult Sci 89, 1750-1754 (2010). https://doi.org/10.3382/ps.2009-00583
Hickson, R. C. Interference of strength development by simultaneously training for strength and endurance. Eur J Appl Physiol Occup Physiol 45, 255-263 (1980). https://doi.org/10.1007/BF00421333
Lundberg, T. R., Feuerbacher, J. F., Sunkeler, M. & Schumann, M. The Effects of Concurrent Aerobic and Strength Training on Muscle Fiber Hypertrophy: A Systematic Review and Meta-Analysis. Sports Med 52, 2391-2403 (2022). https://doi.org/10.1007/s40279-022-01688-x
van der Zwaard, S. et al. Maximal oxygen uptake is proportional to muscle fiber oxidative capacity, from chronic heart failure patients to professional cyclists. J Appl Physiol (1985) 121, 636-645 (2016). https://doi.org/10.1152/japplphysiol.00355.2016
Bal, N. C. et al. Is Upregulation of Sarcolipin Beneficial or Detrimental to Muscle Function? Front Physiol 12, 633058 (2021). https://doi.org/10.3389/fphys.2021.633058
Maurya, S. K. et al. Sarcolipin Signaling Promotes Mitochondrial Biogenesis and Oxidative Metabolism in Skeletal Muscle. Cell Rep 24, 2919-2931 (2018). https://doi.org/10.1016/j.celrep.2018.08.036
Gamu, D., Juracic, E. S., Hall, K. J. & Tupling, A. R. The sarcoplasmic reticulum and SERCA: a nexus for muscular adaptive thermogenesis. Appl Physiol Nutr Metab 45, 1-10 (2020). https://doi.org/10.1139/apnm-2019-0067
Kueh, H. Y., Niethammer, P. & Mitchison, T. J. Maintenance of mitochondrial oxygen homeostasis by cosubstrate compensation. Biophys J 104, 1338-1348 (2013). https://doi.org/10.1016/j.bpj.2013.01.030
Ahmed, S. K., Egginton, S., Jakeman, P. M., Mannion, A. F. & Ross, H. F. Is human skeletal muscle capillary supply modelled according to fibre size or fibre type? Exp Physiol 82, 231-234 (1997). https://doi.org/10.1113/expphysiol.1997.sp004012
Wust, R. C., Gibbings, S. L. & Degens, H. Fiber capillary supply related to fiber size and oxidative capacity in human and rat skeletal muscle. Adv Exp Med Biol 645, 75-80 (2009). https://doi.org/10.1007/978-0-387-85998-9_12
Garry, D. J. et al. Postnatal development and plasticity of specialized muscle fiber characteristics in the hindlimb. Dev Genet 19, 146-156 (1996). https://doi.org/10.1002/(SICI)1520-6408(1996)19:2<146::AID-DVG6>3.0.CO;2-9
Takakura, H. et al. Endurance training facilitates myoglobin desaturation during muscle contraction in rat skeletal muscle. Sci Rep 5, 9403 (2015). https://doi.org/10.1038/srep09403
Quesnelle, K. et al. Myoglobin promotes nitrite-dependent mitochondrial S-nitrosation to mediate cytoprotection after hypoxia/reoxygenation. Nitric Oxide 104-105, 36-43 (2020). https://doi.org/10.1016/j.niox.2020.08.005
McCarthy, J. J., Srikuea, R., Kirby, T. J., Peterson, C. A. & Esser, K. A. Correction: Inducible Cre transgenic mouse strain for skeletal muscle-specific gene targeting. Skelet Muscle 2, 22 (2012). https://doi.org/10.1186/2044-5040-2-22
Ripoche, D. et al. Generation of a conditional mouse model to target Acvr1b disruption in adult tissues. Genesis 51, 120-127 (2013). https://doi.org/10.1002/dvg.22352
Larsson, J. et al. Abnormal angiogenesis but intact hematopoietic potential in TGF-beta type I receptor-deficient mice. EMBO J 20, 1663-1673 (2001). https://doi.org/10.1093/emboj/20.7.1663
McCarthy, J. J., Srikuea, R., Kirby, T. J., Peterson, C. A. & Esser, K. A. Inducible Cre transgenic mouse strain for skeletal muscle-specific gene targeting. Skelet Muscle 2, 8 (2012). https://doi.org/10.1186/2044-5040-2-8
Liao, Y., Smyth, G. K. & Shi, W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923-930 (2014). https://doi.org/10.1093/bioinformatics/btt656
Huang da, W., Sherman, B. T. & Lempicki, R. A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 4, 44-57 (2009). https://doi.org/10.1038/nprot.2008.211
van der Laarse, W. J., Diegenbach, P. C. & Elzinga, G. Maximum rate of oxygen consumption and quantitative histochemistry of succinate dehydrogenase in single muscle fibres of Xenopus laevis. J Muscle Res Cell Motil 10, 221-228 (1989). https://doi.org/10.1007/BF01739812
Schneider, C. A., Rasband, W. S. & Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9, 671-675 (2012). https://doi.org/10.1038/nmeth.2089
de Bruin, M., Smeulders, M. J., Kreulen, M., Huijing, P. A. & Jaspers, R. T. Intramuscular connective tissue differences in spastic and control muscle: a mechanical and histological study. PLoS One 9, e101038 (2014). https://doi.org/10.1371/journal.pone.0101038
Rivares, C. et al. Glycine receptor subunit-ss -deficiency in a mouse model of spasticity results in attenuated physical performance, growth and muscle strength. Am J Physiol Regul Integr Comp Physiol (2022). https://doi.org/10.1152/ajpregu.00242.2020
Van der Laarse, W. J., Maslam, S. & Diegenbach, P. C. Relationship between myoglobin and succinate dehydrogenase in mouse soleus and plantaris muscle fibres. Histochem J 17, 1-11 (1985). https://doi.org/10.1007/BF01003398
Old, S. L. & Johnson, M. A. Methods of microphotometric assay of succinate dehydrogenase and cytochrome c oxidase activities for use on human skeletal muscle. Histochem J 21, 545-555 (1989). https://doi.org/10.1007/BF01753355

There is NO Competing Interest.

SupplementaryMaterial.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Myofibre-specific knockout of TGF-β type I receptors triggers muscle hypertrophy and promotes contraction and oxidative metabolism

Status:

Version 1

Abstract

Figures

INTRODUCTION

RESULTS

Fast-and slow-type muscles lacking both TGF-β type I receptors show different transcriptional profiles

DISCUSSION

Lack of both Acvr1b and Tgfbr1 stimulates hypertrophy and oxidative metabolic capacity

Potential clinical implications of simultaneous knockout of Acvr1b and Tgfbr1

MARTERIALS AND METHODS

Treatment of transgenic mice

RNA-seq and data analysis

qPCR assay

In situ contractile force measurement

Immunofluorescence and histological analysis

Histochemistry staining

RNAscope assay

Statistical analysis

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1