Role of RGS12 in Placental Mitochondrial Dysfunction and Adverse Pregnancy Outcomes

doi:10.21203/rs.3.rs-5168064/v1

Download PDF

Research Article

Role of RGS12 in Placental Mitochondrial Dysfunction and Adverse Pregnancy Outcomes

https://doi.org/10.21203/rs.3.rs-5168064/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Mitochondrial function and its regulation within the placenta are critical for maintaining a healthy pregnancy. This study investigated the role of G-protein signaling 12 (RGS12) in placental mitochondrial function and pregnancy outcomes. RGS12 was found to be localized within the mitochondria of placental trophoblast cells. RGS12 knockdown in human placental cells resulted in decreased mitochondrial abundance, impaired oxidative phosphorylation, and reduced antioxidant capacity. Mechanistically, RGS12 enhanced the function of ATP5B, a key mitochondrial enzyme, by promoting its tyrosine phosphorylation. In a mouse model, placental RGS12 deficiency led to preterm birth (PTB), decreased fetal weight, and trophoblast cell death. These adverse effects were associated with diminished ATP synthase activity and activation of the p38MAPK signaling pathway, while restoring RGS12 expression improved the phenotype of mitochondrial dysfunction in placental trophoblast cells. Furthermore, reduced RGS12 expression and impaired mitochondrial function were observed in placentas from cases experiencing PTB. Collectively, these findings provide hitherto undocumented evidence of a specific molecular mechanism by which placental mitochondrial dysfunction contributes to adverse pregnancy outcomes. Our study suggests that RGS12 may represent a novel therapeutic target for improving pregnancy outcomes through its role in regulating placental mitochondrial function.

RGS12

Placenta

Mitochondrial Dysfunction

PTB

The placenta, a unique organ solely present during pregnancy, plays a critical role in supporting fetal development and maintaining a healthy pregnancy. Its functionality relies heavily on the proper function of trophoblastic cells within the placental tissue ^[1]. As a vital component of the maternal-fetal interface, the placenta primarily comprises three distinct trophoblast cell types: cytotrophoblasts, syncytiotrophoblasts, and extravillous trophoblasts. Each cell type fulfills specific functions, including proliferation and differentiation (cytotrophoblasts), substance exchange (syncytiotrophoblasts), hormone secretion (syncytiotrophoblasts), and remodeling of uterine spiral arteries (extravillous trophoblasts) ^{[2, 3]}. In addition, controlled apoptosis of trophoblasts is essential for normal placental development, differentiation, and function. Dysregulation of this process can contribute to various pregnancy complications, such as fetal growth restriction (FGR) and preeclampsia (PE) ^[4]. The proper execution of these aforementioned functions is intricately linked to the activity of mitochondria within these trophoblast cells.

The placenta is a highly metabolic tissue characterized by an abundance of mitochondria to fulfill the significant energy demands of both placental and fetal development. It is now understood that trophoblastic cells exhibit a high rate of aerobic glycolysis, resembling the metabolic profile of tumor cells ^[5]. During late pregnancy, the placenta consumes a substantial portion of the total uterine oxygen uptake, accounting for approximately 40%, despite constituting only 10–20% of the total uterine mass at that time ^[6]. Interestingly, studies have shown a gradual decrease in the expression of ATP5A, a key mitochondrial marker gene, within the mouse placenta during late pregnancy ^[7]. Furthermore, significant alterations in mitochondrial energy metabolism and regulatory factors have been observed in the placenta during pathological processes such as obesity, PE, preterm birth (PTB), and FGR ^[8–12]. Emerging evidence suggests a link between placental premature senescence or oxidative stress and pregnancy complications, including PE, FGR, and PTB ^{[13, 14]}. Both aging and oxidative stress, often induced by reactive oxygen species (ROS), are known to be closely associated with mitochondrial function ^{[15, 16]}. Paradoxically, mitochondria, while serving as the primary site of ROS production, are also susceptible to cellular apoptosis and oxidative damage themselves. Collectively, these findings highlight the crucial roles played by placental mitochondria in both physiological and pathological pregnancy processes. However, the precise molecular mechanisms governing placental mitochondrial homeostasis during normal pregnancy and pathological conditions remain to be elucidated.

Mitochondrial ATP synthesis is essential for maintaining cellular homeostasis, impacting metabolic pathways and cell fate ^[17]. Mitochondrial ATP synthase (Complex V) functions in concert with respiratory chain complexes (Complexes I-IV) to generate ATP by utilizing the electrochemical gradient across the inner mitochondrial membrane. Proper assembly of Complex V is critical for this process ^[18]. ATP synthase comprises two interconnected multi-subunit complexes: F1, the soluble catalytic core, and Fo, the transmembrane component housing the proton channel ^[19]. ATP5B, also known as ATP synthase F1 subunit beta, is a nuclear-encoded gene that produces a mitochondrial protein. This essential catalytic subunit plays a critical role in the formation of Complex V. Studies have demonstrated the involvement of ATP5B in various disease processes. In mouse models of osteoarthritis, ATP5B was found to protect against joint destruction by mitigating mitochondrial dysfunction in osteoclasts ^[20]. Similarly, in neurodegenerative diseases, the pathological protein FUS can trigger disease onset by disrupting mitochondrial function through its interaction with ATP5B. Restoring ATP5B expression has been shown to improve disease phenotypes in these models ^[21]. Furthermore, research suggests an association between ATP5B and poor prognosis in breast cancer ^[22]. Interestingly, ATP5B has also been implicated in trophoblast differentiation processes ^[23]. Collectively, this evidence suggests a potential role for ATP5B in the pathogenesis of various diseases, including placenta-related disorders.

The regulator of G protein signaling 12 (RGS12) is the largest member of the RGS protein family, known for its GTPase-activating function on the Gαi subunit ^[24]. RGS proteins are widely expressed, with specific members like RGS12 found in the placenta. They regulate G protein-coupled receptor (GPCR) signaling pathways, promoting G protein inactivation to inhibit GPCR signaling ^{[25, 26]}. During pregnancy, RGS proteins regulate receptors like oxytocin, prostaglandin, and progesterone, all GPCRs, which are involved in labor or PTB ^[27]. Interestingly, RGS proteins can exert functions beyond the RGS domain. For example, RGS2 regulates estrogen synthesis in placental trophoblasts by modulating aromatase expression through HAND1 ubiquitination ^[28]. RGS12 possesses various structural domains beyond the central RGS domain, including PDZ (PSD-95, disc-large, zo-1), PTB (phosphotyrosine binding), RBD (RAS-binding domain), and GoLoco (Gai/o-Loco) motifs, suggesting its potential for diverse protein interactions and functions ^[24]. Studies have shown that RGS12 acts as a tumor suppressor in prostate cancer by inhibiting AKT and MNX1 expression. Furthermore, it can mediate angiogenesis in inflammatory arthritis, activate the NF-κB signaling pathway, and regulate osteoblast differentiation through the Gαi-ERK pathway ^[29–32]. Intriguingly, Gα proteins, like Gαi, have been identified within placental mitochondria ^[33]. Considering the established relationship between RGS12 and Gαi, this raises the possibility that RGS12 may play a regulatory role in placental mitochondrial function.

This study demonstrated that RGS12, a protein critical for mitochondrial function, is localized within the mitochondria of both mouse and human placentas. We further revealed that RGS12 is a key activator of phospho-ATP5B, a vital mitochondrial enzyme. Significantly, alterations in RGS12 expression led to mitochondrial dysfunction in placental and trophoblast cells, ultimately contributing to adverse pregnancy outcomes associated with placental insufficiency. Taken together, these findings highlight the RGS12-ATP5B axis as a novel mechanism underlying the crosstalk between the placenta and pregnancy complications, offering valuable new targets for therapeutic strategies to improve pregnancy outcomes.

RGS12 is expressed in placental cell mitochondria, cytoplasm, and nucleus

RGS12 has been implicated in various cellular processes, including proliferation, differentiation, oxidative phosphorylation, ROS production, and apoptosis, suggesting its potential role as a key regulator within mitochondria ^{[34, 35]}. To investigate its localization in placental cells, we performed immunostaining on the human placental trophoblast cell line HTR-8/SVneo. Nuclei were stained with DAPI (Fig. 1A), RGS12 was visualized with an anti-RGS12 antibody (Fig. 1B), and mitochondria were labeled with MitoTracker (Fig. 1C). Co-localization analysis revealed significant overlap between RGS12 and the mitochondrial marker, suggesting a primarily mitochondrial localization for RGS12 in these cells. Partial co-localization with the nuclear marker DAPI was also observed (Fig. 1D-F). To further characterize RGS12 localization and expression in placental tissues, we examined protein extracts from both mouse (18.5 days post-coitum, dpc) and human (term birth, TB) placentas. Mitochondrial and cytoplasmic fractions were isolated, and immunoblotting was performed to detect RGS12 alongside α-tubulin (cytoplasmic marker) and HSP60 (mitochondrial marker). RGS12 was detected in both mitochondrial and cytoplasmic fractions of both mouse and human placentas (Fig. 1G and H), with a significantly higher abundance in the mitochondrial fractions (approximately 5–10 fold), which may be attributed to some extent to other cell types within the placental tissue. To verify the mitochondrial enrichment of RGS12, specifically in trophoblast cells, we performed immunoblotting on mitochondrial and cytoplasmic extracts from human placental trophoblast cell lines HTR-8/SVneo and Swan71. Interestingly, RGS12 displayed comparable expression levels in both the mitochondrial and cytoplasmic fractions of these cell lines (Fig. 1I and J). Furthermore, its overall expression was correlated with the mitochondrial content of the cells. These findings suggest that while RGS12 is present in both cellular compartments, its expression may be linked to the abundance of mitochondria within placental trophoblast cells.

RGS12 regulates the tyrosine phosphorylation of mitochondrial ATP5B in placental trophoblast cells

Having identified RGS12 localization within placental trophoblast cells, we next explored its potential mechanisms of action. Immunoprecipitation (IP) experiments using RGS12 antibodies followed by mass spectrometry analysis revealed high-affinity binding between RGS12 and ATP5B, with minimal interactions detected between RGS12 and other mitochondrial proteins (Table S1). This finding suggests a specific role for RGS12 in mediating mitochondrial functions through ATP5B in these cells. To validate this interaction, we performed co-IP experiments using specific antibodies against ATP5B and RGS12 in placental trophoblast cell lines (HTR-8/SVneo and BeWo) and placental tissues (mouse 18.5 dpc and human TB). As expected, both proteins co-immunoprecipitated with their respective antibodies (Fig. 2A-G), supporting the hypothesis that ATP5B may be a regulatory target of RGS12 in placental trophoblast cells. Further confirmation of their colocalization was obtained through immunofluorescence (IF) staining of mouse and human placental tissues (Fig. 2H and I). Considering that RGS12 regulates various cellular processes through the phosphorylation of target proteins and that tyrosine phosphorylation of ATP synthase subunits is critical for its function ^[36–38], We investigated the potential role of RGS12 in phosphorylated tyrosine (p-Tyr) modification of ATP5B. Co-IP experiments using p-Tyr and ATP5B antibodies revealed phosphorylation of ATP5B in all tested samples (placental trophoblast cell lines, mouse, and human placentas) (Fig. 3A-G). These findings suggest a possible role for RGS12 in regulating ATP5B p-Tyr status. To functionally test this hypothesis, we manipulated RGS12 expression in HTR-8/SVneo cells. RGS12 knockdown (ShRGS12) and overexpression (RGS12^OE) were achieved (Fig. S1A-D). Interestingly, RGS12 knockdown specifically decreased mitochondrial p-Tyr levels without affecting overall cytoplasmic phosphorylation (Fig. 3H and I), indicating a specific role for RGS12 in regulating mitochondrial protein phosphorylation. Furthermore, RGS12 knockdown specifically reduced ATP5B mRNA and protein expression levels without affecting ATP5A (Fig. S1E-H). Collectively, these data suggest that RGS12 may regulate mitochondrial function in placental trophoblast cells by modulating the expression and tyrosine phosphorylation of ATP5B.

Knockdown of RGS12 in HTR-8/SVneo cells leads to mitochondrial dysfunction

To investigate the functional consequences of RGS12 knockdown on mitochondrial function in placental trophoblast cells, we established stable cell lines. HTR-8/SVneo cells were transfected with either scramble control shRNA (shCTL) or shRNA targeting RGS12 (shRGS12). Western blot analysis confirmed a significant reduction in RGS12 protein levels in both the cytoplasm and mitochondria of shRGS12 cells compared to the control group, with a more pronounced decrease observed in the mitochondrial fraction (Fig. 4A). Transmission electron microscopy (TEM) was employed to evaluate mitochondrial morphology. Compared to the control group, shRGS12 cells displayed significant alterations in mitochondrial morphology. These included swelling, rounding, a dissolved intramembranous matrix, reduced diameter and area, and a notable increase in damaged mitochondria (Fig. 4B-D). As anticipated, shRGS12 knockdown resulted in a significant decrease in both mitochondrial DNA (mtDNA) copy number and cellular ATP content in HTR-8/SVneo cells compared to the control group (Fig. 4E and F). To further assess mitochondrial function, we utilized MitoTracker for mitochondrial staining and Dihydroethidium staining to detect basal mitochondrial ROS production (Fig. 4G). These experiments revealed a reduction in mitochondrial abundance and a concomitant increase in ROS production in shRGS12 cells compared to the control group (Fig. 4G and H). Finally, we examined the impact of RGS12 knockdown on mitochondrial antioxidant function in HTR-8/SVneo cells by comparing the total antioxidant capacity (TAC) of shCTL and shRGS12 groups. Knockdown of RGS12 resulted in a significant decrease in TAC, indicating a decline in the cell's ability to counteract oxidative stress (Fig. 4I). To explore the effects of RGS12 knockdown on cellular function, we performed additional assays. Enzyme-linked immunosorbent assay (ELISA) revealed a significant decrease in SOD levels in the shRGS12 group compared to the control group, suggesting compromised antioxidant defense (Fig. S2A). Interestingly, GSH and NO levels remained unchanged, while MDA levels were even reduced in shRGS12 cells (Fig. S2B-D). These findings require further investigation to fully understand the interplay between RGS12 knockdown and oxidative stress markers. We next investigated the impact of RGS12 knockdown on the functional capabilities of placental trophoblast cells, including apoptosis, proliferation, hormone secretion, migration, and invasion. TdT-mediated dUTP Nick-End Labeling (TUNEL) staining revealed a significant increase in apoptosis in the shRGS12 group compared to the control (Fig. 5A and B). Similarly, CCK8 assays indicated a decrease in cell proliferation upon RGS12 knockdown (Fig. 5C). ELISA experiments showed a decrease in progesterone (P) secretion and an unchanged level of estrodiol (E2) in shRGS12 cells, leading to an increased E2-to-P ratio (Fig. 5D-F). To account for potential limitations of the HTR-8/SVneo cell line in hormone production, we verified these findings in BeWo cells, obtaining consistent results (Fig. S2E-H). Furthermore, Transwell assays and wound healing assays demonstrated a significant reduction in both migration and invasion abilities of shRGS12 cells compared to the control group (Fig. 5G-I and S2I, J). Interestingly, overexpression of RGS12 did not appear to affect proliferation, apoptosis, or mitochondrial morphology in HTR-8/SVneo cells (Fig. S3A-H).

RGS12 knockout (KO) and placenta-specific RGS12 KO mice exhibit decreased birth weight of fetuses, reduced placental efficiency, preterm birth, and placental mitochondrial dysfunction

To elucidate the in vivo role of RGS12 in pregnancy and placental function, we generated knockout mice using CRISPR-Cas9 technology. This approach targeted all exons of the RGS12 gene, resulting in global RGS12 knockout (RGS12^−/−). We additionally generated a placenta-specific RGS12 knockout model by mating RGS12 floxed mice with Elf5-Cre transgenic mice. Elf5-Cre expresses Cre recombinase under the control of the Elf5 promoter, primarily active in placental trophoblast cells ^[39]. In this breeding scheme, Cre recombinase mediated the deletion of exons 5 and 6 of the floxed RGS12 gene, specifically within Elf5-positive cells. Immunohistochemical analysis of placentas from RGS12-edited mice at 18.5 dpc confirmed the efficiency of RGS12 knockout in both models (Fig. 6A and E). Both global and placenta-specific RGS12 knockout mice were viable and fertile. However, they exhibited reduced offspring birth weight and placental efficiency, as evidenced by a smaller pup weight to placental weight ratio, without any significant change in overall placental weight (Fig. 6B-D and F-H). These findings suggest that RGS12 deficiency may compromise placental function, impairing fetal development. Morphological examination of the gestational sac, placenta, and fetuses from placenta-specific RGS12 knockout mice at 18.5 dpc revealed earlier delivery (between 18 and 18.5 dpc) compared to controls (RGS12^flox/flox). Fetuses from the RGS12^flox/flox; Elf5-Cre genotype were also smaller than controls. Genotype identification was confirmed by agarose gel electrophoresis (Fig. S4A-E). Interestingly, global RGS12 knockout mice did not exhibit premature delivery, although their tolerance to low-dose LPS-induced labor was reduced, leading to earlier delivery and a significantly higher rate of preterm birth (Fig. S4G-I). This phenotypic discrepancy between the global and placenta-specific knockout models suggests a potential role for RGS12 in other tissues or the existence of compensatory mechanisms within the body. Further analysis of placentas from global RGS12 knockout mice at 18.5 dpc using hematoxylin and eosin (H&E) staining revealed a significant reduction in the labyrinth zone, while the junctional zone remained unaffected (Fig. S5A-C). Ultrasound analysis of RGS12 knockout (RGS12^−/−) and wild-type (WT) mice at 18.5 dpc revealed no significant difference in fetal heart rate. However, placental umbilical blood flow velocity exhibited a dose-dependent decrease, suggesting that RGS12 deficiency may compromise placental blood flow capacity (Fig. S5D-G). This finding aligns with the observed phenotype of reduced fetal weight, potentially due to impaired nutrient and oxygen delivery to the developing fetus. Analysis of steroidogenic hormone levels in RGS12 knockout mice revealed no significant change in P levels, a significant increase in E₂ levels, and no significant change in the E2/P ratio. Furthermore, the expression of key steroidogenic enzymes (CYP11A1, HSD3B1, and STS) was downregulated in these mice (Fig. S6A-F). These findings suggest that RGS12 may play a role in regulating placental steroidogenesis. In light of the in vitro data demonstrating RGS12 interaction with ATP5B and its potential role in mitochondrial function, we further investigated mitochondrial status in placentas from 18.5 dpc placenta-specific RGS12 knockout mice. As expected, p-Tyr levels were decreased in these placentas compared to controls. TEM revealed an increased number of damaged mitochondria, while the mtDNA copy number was significantly elevated. Conversely, both ATP content and total antioxidant capacity were significantly reduced (Fig. 6I-M). Collectively, these findings suggest that RGS12 deficiency disrupts placental mitochondrial function, ultimately contributing to fetal growth restriction and a potential predisposition to preterm birth in the gene-edited mice.

Restoring RGS12 expression reverses the abnormal mitochondrial-related phenotypes

To determine whether RGS12 restoration could reverse the observed mitochondrial dysfunction, we employed a series of assays in HTR-8/SVneo cells. Control cells (shCTL-CTL^OE) were compared to cells with RGS12 knockdown and subsequent RGS12 overexpression (shRGS12-RGS12^OE). Western blot analysis confirmed successful RGS12 restoration in the shRGS12-RGS12^OE group, as evidenced by significantly increased RGS12 protein levels compared to the control group (Fig. 7A). Next, we evaluated the impact of RGS12 restoration on hormone production and oxidative stress markers. E2, P, and the E2/P ratio were measured, revealing no significant differences between the shRGS12-RGS12^OE and control groups (Fig. 7A, B, and D). This suggests that RGS12 restoration does not disrupt hormonal balance. Furthermore, analysis of oxidative stress markers indicated normalized SOD activity and GSH levels in shRGS12-RGS12^OE cells compared to the control group, with no significant changes in MDA or NO levels (Fig. 7E-H). These findings suggest that RGS12 restoration helps mitigate oxidative stress. To assess the effect of RGS12 restoration on mitochondrial function, we measured relative mtDNA copy number, ATP concentration, and total antioxidant capacity. The shRGS12-RGS12^OE group exhibited a significant increase in all three parameters compared to the control group (Fig. 7I-K). These results highlight the crucial role of RGS12 in promoting optimal mitochondrial function. Notably, the abnormal phenotypes observed in RGS12 knockout mice also demonstrated a dose-dependent effect, indirectly supporting that restoring RGS12 expression can alleviate these abnormalities (Fig. S5D-G). Taken together, our findings substantiated that restoring RGS12 expression in HTR-8/SVneo placental trophoblast cells effectively reversed the observed mitochondrial dysfunction. This finding underscores the critical role of RGS12 in maintaining both mitochondrial function and cellular homeostasis within these cells.

PTB placentas are associated with decreased RGS12 expression and mitochondrial dysfunction

To investigate the potential link between RGS12 and PTB in humans, we collected placental tissues from patients with PTB and compared them to TB controls. Participant demographics and baseline clinical characteristics are shown in Table S2. Western blot and RT-PCR analysis revealed significantly reduced protein and mRNA levels of RGS12 in PTB placentas compared to the TB group (Fig. 8A-C). Consistent with our previous in vitro findings, PTB placentas displayed a significant decrease in mitochondrial tyrosine phosphorylation compared to controls, with no significant difference observed in cytoplasmic extracts (Fig. 8D). Furthermore, both ATP content and mtDNA copy number were significantly lower in PTB placentas (Fig. 8E and F). Analysis of steroidogenic hormone profiles in human placental tissues revealed a significant decrease in P levels in PTB compared to controls, with no significant difference in E₂ levels or E₂/P ratio. Interestingly, NO levels were significantly elevated in PTB placentas (Fig. 8G-J). Additionally, we observed a significant decrease in both protein and mRNA expression of ATP5B in PTB placentas, with a positive correlation between ATP5B and RGS12 expression levels (Fig. 8K-M). These findings suggest that RGS12 may regulate ATP5B expression in human placental tissues. Moreover, the downregulation of RGS12 was associated with mitochondrial dysfunction in PTB placentas, highlighting a potential correlation between these factors in human clinical samples.

Deficiency of placental RGS12 leads to increased apoptosis and activation of the p38MAPK signaling pathway

We next investigated apoptosis-related molecules in human PTB and TB placentas using Western blotting to gain further insights into the mechanisms by which RGS12 deficiency promotes trophoblast apoptosis and contributes to adverse pregnancy outcomes. We observed a significant increase in the expression of CASP9 and its activated form, cleaved-CASP9, in PTB placentas compared to controls (Fig. S7A-I). This finding was further corroborated in RGS12-knockdown HTR-8/SVneo cells (Fig. S8A-G). We next aimed to elucidate the mechanisms underlying RGS12 knockdown-induced placental dysfunction and adverse pregnancy outcomes. Transcriptomic analysis of RGS12-knockdown (shRGS12) HTR-8/SVneo trophoblast cells revealed significant changes in gene expression profiles compared to the control group (shCTL). KEGG pathway enrichment analysis identified significant enrichment of the p53 and MAPK signaling pathways (Fig. S9A-C). To validate these findings, we analyzed both clinical placental samples and shRGS12-transfected HTR-8/SVneo cells, and observed a significant enrichment of the p38MAPK signaling pathway in both groups (Fig. S10A-F). In conclusion, our findings suggest that placental RGS12 deficiency may contribute to placental dysfunction and adverse pregnancy outcomes through two potential mechanisms: 1) increased mitochondria-dependent apoptosis via the CASP9/CASP3 pathway and 2) activation of the p38MAPK signaling pathway.

This study unveils the critical role of RGS12 in placental function and its impact on pregnancy outcomes. We demonstrated that RGS12 localizes primarily to the mitochondria of placental trophoblast cells, where it plays an essential role in regulating mitochondrial function through the phosphorylation of ATP5B at tyrosine residues (p-Tyr). RGS12 deficiency emerged as a key factor in promoting trophoblast apoptosis, compromising mitochondrial function, and contributing to adverse pregnancy outcomes, including a trend towards birth and reduced fetal weight. Importantly, restoration of RGS12 expression reversed mitochondrial dysfunction in placental trophoblast cells. These findings were further validated in human PTB placental samples, providing strong clinical evidence for the association between RGS12 deficiency and placental mitochondrial dysfunction.

Our findings provide compelling evidence of a novel role for RGS12 in placental trophoblast cells, adding to the growing body of evidence highlighting its multifunctional nature in various cellular processes, including proliferation, differentiation, and apoptosis ^{[40, 41]}. While previous research has primarily focused on RGS12's involvement in cancer and neural development ^{[37, 38, 42]}, this study unveils its critical function in placental health. Furthermore, our work aligns with existing knowledge regarding RGS12's role in oxidative phosphorylation and ROS production ^[35]. We confirm the mitochondrial localization of RGS12 and demonstrate its essential contribution to maintaining mitochondrial function and integrity within the placenta.

Our study unveils a novel role for RGS12, a known regulator of diverse cellular processes, in regulating mitochondrial proteins through tyrosine phosphorylation. We demonstrated that RGS12 could directly interact with mitochondrial ATP5B, a critical subunit of the ATP synthase complex. Knockdown of RGS12 resulted in decreased tyrosine phosphorylation of ATP5B, suggesting that RGS12 modulates mitochondrial function via post-translational modifications. This finding complements previous research showing that RGS12 is essential for maintaining mitochondrial function during skeletal development by regulating OXPHOS activity through interaction with ATP5A ^[35]. It has been established that both ATP5A and ATP5B are subunits of the OXPHOS complex, located within the mitochondrial inner membrane and crucial for energy production, ROS generation, and programmed cell death regulation ^[43]. Our data confirm that RGS12 is involved in maintaining mitochondrial membrane potential, ATP production, and ROS balance, which are vital for trophoblast cell apoptosis and overall cellular health. Additionally, we demonstrate that RGS12 deficiency induces a specific form of mitochondrial-dependent apoptosis, as evidenced by the involvement of CASPASE-9 and CASPASE-3. This finding aligns with the established role of mitochondrial integrity in apoptosis regulation. Our study extends this knowledge by demonstrating that RGS12 loss contributes to a cascade of detrimental effects, including decreased mitochondrial number, increased dysfunction, and, ultimately, enhanced apoptosis.

RGS12 is a multifaceted protein that regulates various molecules and signaling pathways in diverse diseases ^{[32, 38, 44]}. In this study, we identify a novel function for RGS12: the regulation of placental mitochondrial proteins through tyrosine phosphorylation. Interestingly, previous research has demonstrated that RGS12 can interact with the nerve growth factor (NGF) receptor tyrosine kinase TrkA, as well as activated H-Ras, B-Raf, and MEK2, promoting coordinated signaling and prolonged ERK activation ^[41]. Furthermore, RGS12-mediated activation of the MEK1/2-ERK1/2 pathway has been implicated in pathological cardiac hypertrophy ^[45]. Our findings build upon this knowledge by revealing a novel regulatory mechanism for RGS12 in placental function. Specifically, our data suggest that the p38MAPK pathway is a critical downstream effector in the cascade initiated by RGS12 deficiency, leading to placental mitochondrial dysfunction and adverse pregnancy outcomes.

However, the limitations of this study should be acknowledged. The use of specific cell lines and animal models may not fully recapitulate the intricate nature of human placental biology. While validation experiments employing human placental samples help mitigate this concern, further studies are warranted to confirm these findings in broader and more diverse human populations. Additionally, the potential influence of other cell types within the placental tissue on our observations cannot be definitively ruled out. Future research directions include isolating and studying specific trophoblast subtypes to gain more precise insights into RGS12's function in the human placenta. Furthermore, validation of our findings in diverse populations and exploration of the therapeutic potential of RGS12 modulation in clinical settings are important next steps.

In summary, our study presents hitherto undocumented evidence of the critical role of RGS12 in maintaining placental health through its regulation of mitochondrial function in trophoblast cells (Fig. 9). Under normal physiological conditions, RGS12 promotes ATP5B activation via tyrosine phosphorylation, thereby optimizing mitochondrial function essential for placental well-being. Conversely, RGS12 deficiency disrupts mitochondrial homeostasis, leading to a decrease in both mitochondrial number and function. This dysfunction is further manifested by increased trophoblast apoptosis and adverse pregnancy outcomes, including preterm birth and reduced birth weight. Importantly, restoration of RGS12 expression reverses these detrimental effects, highlighting its potential as a therapeutic target. Our findings suggest that RGS12 may be a promising candidate for the prevention and treatment of pregnancy complications associated with placental mitochondrial dysfunction.

Clinical Perspectives

•Placental mitochondrial dysfunction is implicated in adverse pregnancy outcomes, such as PTB and FGR. This study was undertaken to explore the role of RGS12 in maintaining mitochondrial function in placental trophoblasts.

•The results demonstrated that RGS12 regulates mitochondrial ATP5B activity, and its deficiency leads to decreased mitochondrial function, increased trophoblast apoptosis, and poor pregnancy outcomes in both mouse models and human samples.

•These findings suggest that targeting the RGS12-ATP5B axis could be a potential therapeutic strategy for preventing or treating mitochondrial dysfunction-related pregnancy complications, potentially improving fetal growth and reducing PTB risk

RGS12-KO and placenta-specific RGS12- KO mice

The complete exon of the mouse RGS12 gene was knocked out using CRISPR-Cas9 technology, followed by heterozygous or subsequent homozygous mating to obtain RGS12-KO homozygous (RGS12^−/−) or heterozygous (RGS12^+/−) mice, with WT mice of the same strain used as the control group. To generate placenta-specific RGS12 knockout mice, we employed a breeding strategy. First, RGS12^flox/+ male mice (F0) were bred with WT females to generate F1 heterozygous (RGS12^flox/+) offspring. Subsequently, F1 heterozygous mice were intercrossed to obtain F2 offspring with the desired genotypes: RGS12^flox/flox (homozygous) and RGS12^flox/+ (heterozygous). Finally, F2 homozygous (RGS12^flox/flox) and heterozygous (RGS12^flox/+) mice were bred with Elf5-Cre transgenic mice to generate F3 offspring with placenta-specific RGS12 knockout (RGS12^flox/flox; Elf5-Cre) and a control group (RGS12^flox/+; Elf5-Cre). These F3 mice were used to establish a breeding colony for subsequent experiments. Growth curves were generated by measuring the weights of RGS12 knockout and control littermates at postnatal days 1, 7, 14, 21, 28, 35, 42, and 56.

All animal experiments were conducted following the principles of laboratory animals and the relevant regulations of the Department of Laboratory Animal Science, Fudan University. The experimental procedures were pre-registered and approved by the Animal Welfare and Ethics Committee of the Department of Laboratory Animal Science, Fudan University (Approval No.: 20211203S). The experimental animals were specific pathogen-free (SPF) female C57BL/6J mice at the breeding age (provided by Gempharmatech (JiangSu) and Cyagen Biosciences (Guangzhou)). Mice were housed in a company-maintained facility under standard laboratory conditions (22 ± 1°C, 12-hour light/dark cycle, light from 8:00 to 20:00) with ad libitum access to water and standard rodent chow. For breeding, females were mated with fertile males. Vaginal plug checks were performed daily between 8:00 and 9:00 a.m. The day a plug was observed was designated as 0.5 DPC, and females were then housed individually.

Cell culture and transfection

HTR-8/SVneo and Swan 71 cells were generously provided by Dr. Yè Mùjǐn and Dr. Xǔ Nǎixīn from Shanghai Jiao Tong University, while the BeWo cell line was purchased from Wuhan Puno Sai Life Science and Technology Co., Ltd. Primary trophoblast cells were extracted from 18.5 dpc mouse placental tissue digested with 0.2% collagenase I (Thermo Scientific, US) for 3 hours, and the above cells were all cultured in DMEM/F12 supplemented with 10% FBS and antibiotics, with passaging performed when the confluence reached approximately 80% according to the growth conditions. Placental trophoblast cells with RGS12 knockdown or overexpression were transfected transiently with the shRNA and plasmids using Lipofectamine 3000 (Invitrogen, USA). Stable transfection was performed by culturing cells in six-well plates with lentiviruses at an multiplicity of infection (MOI) of 40, selecting with puromycin, and maintaining with half-concentration puromycin to obtain stably transfected cells.

Mitochondrial isolation

Following the manufacturer's protocol, a mitochondrial isolation kit (Novus Biologicals, US) was used to isolate mitochondria from placental tissue or trophoblast cells. Briefly, 1g of blood-washed placental tissue and approximately 5 trophoblast cell plates at 80% confluence in 10cm dishes were homogenized and subjected to gradient centrifugation to extract mitochondria and mitochondrial proteins. Mitochondrial protein concentration was determined using a BCA kit (Biyuntian, China).

Plasmid and shRNA construction

The full length of the RGS12 cDNA fragment (NM_001394155.1) was cloned and inserted into the LV-EFS-MCS-WPRE-CMV-EGFP/T2A/Puro-SV40early-pA backbone. Negative control cells (CTL^OE) were transfected with the vector of LV-CMV-EGFP-T2A-Puro. Nontargeting RGS12 shRNAs were purchased from Saiye Biotechnology Co., Ltd (Guangzhou, China). Target sequences were as follows: LV-U6 > hRGS12[shRNA#1]-PGK > EGFP/T2A/Puro, shRNA#1: GCTGGATCTTGTTCCGATTAACTCGAGTTAATCGGAACAAGATCCAGC; LV-U6 > hRGS12[shRNA#2]-PGK > EGFP/T2A/Puro, shRNA#2: CGAAAGACTAAGGAAGATAAACTCGAGTTTATCTTCCTTAGTCTTTCG; LV-U6 > hRGS12[shRNA#3]-PGK > EGFP/T2A/Puro, shRNA#3: GAACACTAGGCAAGTCTAATTCTCGAGAATTAGACTTGCCTAGTGTTC. Control shRNA, shCTL: GCTTCGCGCCGTAGTCTTA. A control shRNA was constructed using a scrambled DNA sequence.

Lentivirus production was initiated by seeding 293T cells in DMEM medium supplemented with 10% serum. After 24 hours, when cell density reached over 80%, the cells were passaged using 0.25% trypsin. Two to four hours before transfection, the culture medium was replaced with a fresh, antibiotic-free, complete medium. Subsequently, the lentiviral plasmid of interest was introduced into the 293T cells to facilitate high-titer lentivirus production.

Western blot

Placental or trophoblast cells were homogenized in RIPA buffer containing a protease inhibitor cocktail (Cocktail I and PMSF) (MedChemExpress, HY-K0021) at 4°C, 60Hz for 5 minutes, then lysed on ice for 30 minutes. Protein concentration was measured using a BCA protein assay kit (Biyuntian, China). Equal amounts of protein (20–30 µg) were denatured in SDS and separated on a 10% SDS-PAGE gel. Proteins were transferred to a 0.45 µm PVDF membrane in a transfer buffer containing 20% methanol at 0.26A for 1 hour using wet transfer. The membrane was blocked with 5% skim milk at room temperature for 1 hour, incubated with primary antibodies overnight at 4°C, then incubated with HRP-conjugated secondary antibodies (1:4000, Affinity #S0001/2) at room temperature for 1 hour. HRP-conjugated anti-beta actin (1:4000, HuaAnBio, ET1702-67), alpha tubulin (1:4000, Affinity #AF4651), and HSP60 (1:4000, Affinity #AF5374) were used as internal controls. Primary antibodies used included: anti-RGS12 (1:1000, Affinity #DF4415), anti-ATP5B (1:1000, Affinity #DF12111), anti-p-Tyr (1:1000, Ab10321, Abcam), anti-ERK1/2 (1:1000, Affinity #AF0155), anti-phospho-ERK1/2 (Thr202/Tyr204) (1:1000, Affinity #AF1015), anti-JNK1/2/3 (1:1000, Affinity #AF6318), anti-phospho-JNK1/2/3 (Thr183 + Tyr185) (1:1000, Affinity #AF3318), anti-p38 (1:1000, GB114685-100, Servicebio), and anti-phospho-p38 (T180/Y182) (1:1000, GB113380-100, Servicebio).

Immunoprecipitation Mass Spectrometry and Coimmunoprecipitation

The Pierce TM Classic Magnetic Bead Immunoprecipitation Kit (Thermo Fisher, USA) was used for immunoprecipitation mass spectrometry (IP-MS) and Co-IP experiments. Briefly, approximately 1000 µg of protein extracted from placental or trophoblast cells were combined with 10 µg of RGS12 (RGS12 Antibody (G-4), Santa Cruz, sc-398545) antibody or the corresponding IgG control antibody, and incubated overnight at 4°C on a rotator. Approximately 25 µL (0.25 mg) of Pierce Protein A/G magnetic beads were used to collect the bound proteins. Then, 100 µL of 5× protein electrophoresis loading buffer (Biyuntian, China), diluted five times with double-distilled water to 1×, was added. The mixture was heated in a metal water bath to 100°C for 10 minutes. Subsequently, the beads were separated using a magnetic rack, and the remaining protein solution was collected.

The denatured and eluted protein solution from the IP was subjected to 10% SDS-PAGE and stained with Coomassie Brilliant Blue rapid staining solution (Biyuntian, China) for 30 minutes. The target bands, approximately 2 cm in length, were excised based on their positions. The bands were then washed and destained with approximately 100 mL of deionized water on a shaker before protein MS identification of interacting proteins.

Immunofluorescence

Placental tissues were fixed in 4% paraformaldehyde at room temperature overnight, followed by paraffin embedding and sectioning, or placental trophoblast cells were subjected to cell climbing assay. The sections or cells were incubated overnight at 4°C with primary antibodies against RGS12 (1:500, Affinity #DF4415), ATP5B (1:500, Affinity #DF12111), Cleaved-Caspase 3 (Asp175) (1:500, Affinity#AF7022), and MitoTracker (1:100, 8778S, Cell Signaling Technology). Subsequently, the sections or cells were incubated with corresponding secondary antibodies conjugated with fluorescent dyes (diluted 1:200 in 1% BSA) at room temperature for 1 hour. Relative fluorescence intensity was determined by comparing each intensity value to the average intensity of the cells using ImageJ software.

Reactive oxygen species

This experiment followed the protocol outlined in the Reactive Oxygen Species Assay Kit (Solarbio, China). Briefly, cells were seeded in a 6-well plate 24 hours prior to the assay. The ROS detection stock solution, Dihydroethidium, was diluted to 10 µM in a serum-free medium before use. Cells were then incubated with 1 ml of the staining solution per well for 30 minutes in a cell culture incubator protected from light. Following incubation, the staining solution was discarded, and the cells were washed twice with 1× PBS. Stained cells were observed under a confocal microscope, images were captured, and statistical analysis was performed using Image J software.

Mitochondrial membrane potential

A 6-well plate was prepared 24 hours in advance following the instructions of the Mitochondrial Membrane Potential Assay Kit with TMRE (Biyuntian, China). TMRE (1000x stock solution) was diluted by adding 1 µl of TMRE to 1 ml of detection buffer. Subsequently, 1 ml of the diluted TMRE staining working solution was added to each plate well. The plate was then incubated in a cell culture incubator for 30 minutes. Following incubation, the cells were washed twice with a pre-warmed cell culture medium and analyzed using a confocal microscope.

ATP

Intracellular ATP content was measured using an ATP Assay Kit (Biyuntian, China). Following the manufacturer's instructions, placental tissue or trophoblast cells were lysed with lysis buffer to release ATP. Homogenization was performed at 60 Hz for 3 minutes at 4°C using a homogenizer. The homogenate was centrifuged at 12,000 × g for 5 minutes at 4°C. A portion of the supernatant was used for protein concentration determination using the BCA method. The remaining supernatant was mixed and boiled at 100°C in a metal bath for 2 minutes to achieve complete ATP release. Luciferase activity was measured in a white opaque microplate using a multifunction microplate reader (SPARK, TECAN, CH) and compared to a standard curve.

Enzyme-Linked Immunosorbent Assay

Hormones (P and E2) and oxidative stress markers (GSH, SOD, MDA, and NO) were tested using corresponding ELISA kits (Youersheng or Nanjing Jiancheng, China). Briefly, peripheral blood from humans or mice was collected and allowed to stand at room temperature for 30 minutes. Alternatively, culture medium from placental trophoblast cells was collected after a 24-hour incubation period. Samples were centrifuged at 3000 rpm for 15 minutes at 4°C, and the supernatant was stored at -80°C for subsequent analysis. Detection of the relevant indicators was performed according to the manufacturer's instructions provided with the corresponding ELISA assay kits.

Quantitative real-time PCR analysis

RNA was extracted from placental or trophoblast cells using TRIzol reagent (TAKARA, Japan) in accordance with the manufacturer's instructions. Thereafter, 1 µg of RNA was reverse transcribed into cDNA using a reverse transcription kit (TAKARA, Japan) following the manufacturer's protocol. After the reverse transcription reaction, Real-Time PCR was conducted using SYBR Premix Ex Taq II (Tli RNaseH Plus) reagent (TAKARA, Japan), primers, and cDNA on the QuantStudio™ 5 Real-Time PCR system (Applied Biosystems™, Thermo Fisher). Amplification and melting curves were confirmed post-reaction, and quantitative analysis was performed using the 2^−ΔΔCt method. Primer sequences used are listed in Supplementary Table S3.

mtDNA copy number

The mtDNA copy number was assessed relative to nuclear DNA content using qPCR. Total DNA was extracted from placental or trophoblast cells using a commercially available DNA extraction kit (Haigene, China) according to the manufacturer's protocol. Human mitochondrial mtRNA-Leu (UUR) and mouse mitochondrial mtND1 and mtCOX genes were targeted for amplification to determine relative mtDNA copy number. Human nuclear B2M and mouse nuclear 16s genes served as normalization controls. The relative mtDNA copy number was calculated based on the threshold cycle (Ct) values obtained for nuclear and mitochondrial DNA using the following formula ^[46]: ΔCt = (Ct nuclear DNA - Ct mitochondrial DNA). Relative mtDNA copy number content was then determined as 2^ΔΔCt. Primer sequences are listed in Supplementary Table S3.

Total antioxidant capacity

Approximately 1 million cells or 50 mg of tissue samples were harvested and placed in 200 µl of pre-chilled PBS. Homogenization was performed at 60 Hz for 3 minutes at 4°C, followed by centrifugation at 12000 g for 5 minutes at 4°C to collect the supernatant. A standard curve was then prepared according to the manufacturer's instructions. Sample absorbance was subsequently measured, and the total antioxidant capacity of the samples was calculated. Protein content was determined using the BCA method, with results expressed in mmol/mg or mmol/g.

Transmission electron microscopy

Fresh placental tissue samples were collected and promptly sectioned into blocks no larger than 1 mm³. For TEM analysis, cells were prepared for cell climbing slices 24 hours in advance. Subsequently, the tissue blocks were fixed in TEM fixative (Servicebio, China) at 4°C. Following fixation, the tissues were washed three times with 0.1 M phosphate buffer (PB, pH 7.4). Post-fixation was performed using 1% osmium tetroxide (OsO₄) for 2 hours at room temperature, followed by three additional rinses with 0.1 M PB. Dehydration was achieved through a graded ethanol and acetone series. The tissues were then embedded in resin overnight at 37°C. Polymerization of the resin was carried out in a 65°C oven for over 48 hours. Ultra-thin sections were cut from the embedded tissues and stained with uranyl acetate and lead citrate. After drying, the sections were loaded onto grids and observed under a transmission electron microscope (Hitachi, Japan) to acquire images.

Statistical analysis

Data were presented as mean ± SD (standard deviation) for clinical data and mean ± SEM (standard error of the mean) for experimental data. Count data were expressed as percentages. Western blot (WB), IHC, and IF results were analyzed using ImageJ software. All statistical analyses were performed using GraphPad Prism 9.0 (GraphPad Software, San Diego, CA). The normality of measurement data was assessed using the Shapiro-Wilk (S-W) test. For normally distributed data, comparisons between two groups or multiple groups were performed using an independent-sample t-test or one-way ANOVA, respectively. Non-parametric tests, such as the Mann-Whitney U test or the Kruskal-Wallis test, were used for comparisons between two or multiple groups with non-normal distributions. The chi-square test was employed to compare rates between the two groups. In all cases, a p-value less than 0.05 was considered statistically significant.

Conflict of Interest

The authors declare no conflict of interest.

Author Contributions

CXL. is responsible for data processing and literature writing, contributed to sample collection, sample process and sequencing library construction. ZXY. XNX. and SWH are responsible for auxiliary revision, HHF. SZG. CSC.and XCM. are responsible for reviewing the revised manuscript.

Funding

This work is supported by the National Natural Science Foundation of China (82171677 and 82088102), CAMS Innovation Fund for Medical Sciences (2019-I2M-5-064), Collaborative Innovation Program of Shanghai Municipal Health Commission (2020CXJQ01), Key Discipline Construction Project（2023-2025）of Three-Year Initiative Plan for Strengthening Public Health System Construction in Shanghai (GWVI-11.1-35), Shanghai Clinical Research Center for Gynecological Diseases (22MC1940200), Shanghai Urogenital System Diseases Research Center (2022ZZ01012) and Shanghai Frontiers Science Research Center of Reproduction and Development.

Acknowledgments

Thank “Home for Researchers (www.home-for-researchers.com)”.

Ethics approval and consent to participate

This study was approved by the University Research Ethics Committee. All participants signed an informed consent form prior to the study.

Consent for publication

Publication consent was obtained from all authors.

Availability of data and material

Data will be made available on request.

Parolini O. Placenta: The tree of life. CRC Press, 2016
Maltepe E, Fisher SJ. Placenta: The forgotten organ. Annu Rev Cell Dev Biol, 2015, 31: 523-552
Soncin F, Natale D, Parast MM. Signaling pathways in mouse and human trophoblast differentiation: A comparative review. Cell Mol Life Sci, 2015, 72: 1291-1302
De Falco M, Penta R, Laforgia V, et al. Apoptosis and human placenta: Expression of proteins belonging to different apoptotic pathways during pregnancy. J Exp Clin Cancer Res, 2005, 24: 25-33
Bax BE, Bloxam DL. Energy metabolism and glycolysis in human placental trophoblast cells during differentiation. Biochim Biophys Acta, 1997, 1319: 283-292
Carter AM. Placental oxygen consumption. Part i: In vivo studies--a review. Placenta, 2000, 21 Suppl A: S31-37
Bartho LA, Fisher JJ, Walton SL, et al. The effect of gestational age on mitochondrial properties of the mouse placenta. Reprod Fertil, 2022, 3: 19-29
Mele J, Muralimanoharan S, Maloyan A, et al. Impaired mitochondrial function in human placenta with increased maternal adiposity. Am J Physiol Endocrinol Metab, 2014, 307: E419-425
Lien YC, Zhang Z, Cheng Y, et al. Human placental transcriptome reveals critical alterations in inflammation and energy metabolism with fetal sex differences in spontaneous preterm birth. Int J Mol Sci, 2021, 22:
Bartho LA, O'Callaghan JL, Fisher JJ, et al. Analysis of mitochondrial regulatory transcripts in publicly available datasets with validation in placentae from pre-term, post-term and fetal growth restriction pregnancies. Placenta, 2021, 112: 162-171
Xu Z, Jin X, Cai W, et al. Proteomics analysis reveals abnormal electron transport and excessive oxidative stress cause mitochondrial dysfunction in placental tissues of early-onset preeclampsia. Proteomics Clin Appl, 2018, 12: e1700165
Holland O, Dekker Nitert M, Gallo LA, et al. Review: Placental mitochondrial function and structure in gestational disorders. Placenta, 2017, 54: 2-9
Sultana Z, Maiti K, Dedman L, et al. Is there a role for placental senescence in the genesis of obstetric complications and fetal growth restriction? Am J Obstet Gynecol, 2018, 218: S762-s773
Joo EH, Kim YR, Kim N, et al. Effect of endogenic and exogenic oxidative stress triggers on adverse pregnancy outcomes: Preeclampsia, fetal growth restriction, gestational diabetes mellitus and preterm birth. Int J Mol Sci, 2021, 22:
Wang Y, Hekimi S. Mitochondrial dysfunction and longevity in animals: Untangling the knot. Science, 2015, 350: 1204-1207
Willems PH, Rossignol R, Dieteren CE, et al. Redox homeostasis and mitochondrial dynamics. Cell Metab, 2015, 22: 207-218
Akbari M, Kirkwood TBL, Bohr VA. Mitochondria in the signaling pathways that control longevity and health span. Ageing Res Rev, 2019, 54: 100940
Jonckheere AI, Smeitink JA, Rodenburg RJ. Mitochondrial atp synthase: Architecture, function and pathology. J Inherit Metab Dis, 2012, 35: 211-225
Kühlbrandt W. Structure and mechanisms of f-type atp synthases. Annu Rev Biochem, 2019, 88: 515-549
Xu Y, Tan H, Liu K, et al. Targeted inhibition of atp5b gene prevents bone erosion in collagen-induced arthritis by inhibiting osteoclastogenesis. Pharmacol Res, 2021, 165: 105458
Deng J, Wang P, Chen X, et al. Fus interacts with atp synthase beta subunit and induces mitochondrial unfolded protein response in cellular and animal models. Proc Natl Acad Sci U S A, 2018, 115: E9678-e9686
Gale M, Li Y, Cao J, et al. Acquired resistance to her2-targeted therapies creates vulnerability to atp synthase inhibition. Cancer Res, 2020, 80: 524-535
Fisher JJ, McKeating DR, Cuffe JS, et al. Proteomic analysis of placental mitochondria following trophoblast differentiation. Frontiers in physiology, 2019, 10: 489013
Snow BE, Hall RA, Krumins AM, et al. Gtpase activating specificity of rgs12 and binding specificity of an alternatively spliced pdz (psd-95/dlg/zo-1) domain. J Biol Chem, 1998, 273: 17749-17755
De Vries L, Zheng B, Fischer T, et al. The regulator of g protein signaling family. Annu Rev Pharmacol Toxicol, 2000, 40: 235-271
Sjögren B, Blazer LL, Neubig RR. Regulators of g protein signaling proteins as targets for drug discovery. Prog Mol Biol Transl Sci, 2010, 91: 81-119
Walker AR, Larsen CB, Kundu S, et al. Functional rewiring of g protein-coupled receptor signaling in human labor. Cell Rep, 2022, 40: 111318
Tang C, Jin M, Ma B, et al. Rgs2 promotes estradiol biosynthesis by trophoblasts during human pregnancy. Exp Mol Med, 2023, 55: 240-252
Wang Y, Wang J, Zhang L, et al. Rgs12 is a novel tumor-suppressor gene in african american prostate cancer that represses akt and mnx1 expression. Cancer Res, 2017, 77: 4247-4257
Li Z, Liu T, Gilmore A, et al. Regulator of g protein signaling protein 12 (rgs12) controls mouse osteoblast differentiation via calcium channel/oscillation and gαi-erk signaling. J Bone Miner Res, 2019, 34: 752-764
Yuan G, Yang ST, Yang S. Endothelial rgs12 governs angiogenesis in inflammatory arthritis by controlling cilia formation and elongation via mycbp2 signaling. Cell Insight, 2022, 1: 100055
Yuan G, Yang S, Ng A, et al. Rgs12 is a novel critical nf-κb activator in inflammatory arthritis. iScience, 2020, 23: 101172
Kuyznierewicz I, Thomson M. Gtp-binding proteins g(salpha), g(ialpha), and ran identified in mitochondria of human placenta. Cell Biol Int, 2002, 26: 99-108
Ng AYH, Li Z, Jones MM, et al. Regulator of g protein signaling 12 enhances osteoclastogenesis by suppressing nrf2-dependent antioxidant proteins to promote the generation of reactive oxygen species. Elife, 2019, 8:
Yuan G, Yang S, Liu M, et al. Rgs12 is required for the maintenance of mitochondrial function during skeletal development. Cell Discov, 2020, 6: 59
Zhang FX, Pan W, Hutchins JB. Phosphorylation of f1f0 atpase delta-subunit is regulated by platelet-derived growth factor in mouse cortical neurons in vitro. J Neurochem, 1995, 65: 2812-2815
Li Y, Liu M, Yang S, et al. Rgs12 is a novel tumor suppressor in osteosarcoma that inhibits yap-tead1-ezrin signaling. Oncogene, 2021, 40: 2553-2566
Yuan G, Yang S, Yang S. Rgs12 represses oral squamous cell carcinoma by driving m1 polarization of tumor-associated macrophages via controlling ciliary mycbp2/kif2a signaling. Int J Oral Sci, 2023, 15: 11
Kong S, Liang G, Tu Z, et al. Generation of elf5-cre knockin mouse strain for trophoblast-specific gene manipulation. Genesis, 2018, 56: e23101
Schroer AB, Mohamed JS, Willard MD, et al. A role for regulator of g protein signaling-12 (rgs12) in the balance between myoblast proliferation and differentiation. PLoS One, 2019, 14: e0216167
Willard MD, Willard FS, Li X, et al. Selective role for rgs12 as a ras/raf/mek scaffold in nerve growth factor-mediated differentiation. Embo j, 2007, 26: 2029-2040
Gross JD, Kaski SW, Schmidt KT, et al. Role of rgs12 in the differential regulation of kappa opioid receptor-dependent signaling and behavior. Neuropsychopharmacology, 2019, 44: 1728-1741
Xu Y, Xue D, Bankhead A, 3rd, et al. Why all the fuss about oxidative phosphorylation (oxphos)? J Med Chem, 2020, 63: 14276-14307
Fu C, Yuan G, Yang ST, et al. Rgs12 represses oral cancer via the phosphorylation and sumoylation of pten. J Dent Res, 2021, 100: 522-531
Huang J, Chen L, Yao Y, et al. Pivotal role of regulator of g-protein signaling 12 in pathological cardiac hypertrophy. Hypertension, 2016, 67: 1228-1236
Rooney JP, Ryde IT, Sanders LH, et al. Pcr based determination of mitochondrial DNA copy number in multiple species. Methods Mol Biol, 2015, 1241: 23-38

Download PDF

Reviewers agreed at journal
24 Oct, 2024
Reviewers invited by journal
23 Oct, 2024
Editor assigned by journal
07 Oct, 2024
First submitted to journal
06 Oct, 2024

You are reading this latest preprint version

Role of RGS12 in Placental Mitochondrial Dysfunction and Adverse Pregnancy Outcomes

Status:

Version 1

Abstract

Figures

Introduction

Results

RGS12 is expressed in placental cell mitochondria, cytoplasm, and nucleus

RGS12 regulates the tyrosine phosphorylation of mitochondrial ATP5B in placental trophoblast cells

Knockdown of RGS12 in HTR-8/SVneo cells leads to mitochondrial dysfunction

Restoring RGS12 expression reverses the abnormal mitochondrial-related phenotypes

PTB placentas are associated with decreased RGS12 expression and mitochondrial dysfunction

Deficiency of placental RGS12 leads to increased apoptosis and activation of the p38MAPK signaling pathway

Discussion

Materials and methods

RGS12-KO and placenta-specific RGS12- KO mice

Cell culture and transfection

Mitochondrial isolation

Plasmid and shRNA construction

Western blot

Immunoprecipitation Mass Spectrometry and Coimmunoprecipitation

Immunofluorescence

Reactive oxygen species

Mitochondrial membrane potential

ATP

Enzyme-Linked Immunosorbent Assay

Quantitative real-time PCR analysis

mtDNA copy number

Total antioxidant capacity

Transmission electron microscopy

Statistical analysis

Declarations

References

Supplementary Files

Status:

Version 1