Jasmonate-ZIM domain (JAZ) genes are essential for the regulation of physiological processes in plants and help plants to protect from various stresses. Given the increasing global food security concerns related to growing populations, climate change, and scarce arable land, understanding stress-resilient crops such as cotton (Gossypiumspp.) is essential. Cotton is a crucial crop for economic and agricultural sustainability, especially in conditions of increasing salinity, drought, and heat, made worse by climate change. Here, genome-wide analyses of the JAZ gene family in cotton is performed, and their functional response to salt, drought, and heat stimuli is examined. In this study, 91 JAZ genes in five cotton species that are found to be unequally distributed on all chromosomes throughout genomes have been identified. This study focuses on these genes' evolutionary preservation with land plants and functional differentiation potential. Comparative genomics and phylogenetic studies have revealed the JAZ gene family's evolutionary dynamics and functional diversity, emphasizing its role in stress response pathways including salinity, drought and heat. Multiple stress-responsive cis-acting regulatory elements (CARE) including MYB/ARE have been found in JAZ gene promoters which indicates a sophisticated regulatory network that allows cotton to change its physiological and defensive responses to abiotic stimuli accurately. Understanding these networks improves our understanding and might improve cotton and other crops for sustainable agriculture. We identified the enhanced expression of JAZ01 and its related genes under abiotic stresses in transcriptomes. Functional validation of JAZ01 and other stress-related genes confirm their upregulation in abiotic stresses, particularly heat stress. These results show that the JAZ01 gene is essential to cotton's adaptive responses. This study explains how the JAZ gene family is implicated in cotton's stress tolerance, improves our understanding of cotton's stress tolerance genetic mechanisms, and provides a foundation for developing genetically modified climate smart crops that can thrive under ever-changing environmental conditions.
Research Article
Characterization of Jasmonate-ZIM domain family in response to abiotic stresses; functional insights for developing climate resilience cotton
https://doi.org/10.21203/rs.3.rs-5178808/v1
This work is licensed under a CC BY 4.0 License
Version 1
posted
You are reading this latest preprint version
JAZ
Genome-wide analysis
Transcriptomic analysis
Comparative genomics
Abiotic stress response
Climate resilience.
Cotton (Gossypium spp.) is an economically and commercially vital crop worldwide; however, its yield and production are often affected by several abiotic and biotic factors (Prakash et al. 2023). Climate change has a direct effect on enhancing the threat of both abiotic and biotic stressors as global temperature rise and changing conditions increase the impact of drought, salinity and heat stresses, all of which impacts the crop growth and yield. The carbon dioxide impact, or the amount of it in the atmosphere, is the main factor contributing to the global temperature rise (Majeed et al. 2021) making heat as one of the devastating stresses for cotton. The elevation in soil water evaporation, which induces drought and salt stress, is precipitated by an increase in the mean annual temperature (Kamburova et al. 2022) which affects cotton production (Pettigrew 2008, Xu et al. 2013). The quality and production of cotton fiber is also affected by salinity and drought that reduces yield by 20–40% (0.5 to 1.5 tons per hectare) and 40% (0.5 to 1.0 tons per hectare) respectively (Ashraf and Ahmad 2000, Zhang et al. 2014). Hence, it is essential to elucidate the underlying molecular mechanisms that enable cotton to withstand these abiotic stresses for improving crop resilience and secure it against climate change
The molecular mechanisms modulate a variety of signaling pathways and key genes for the sustainability of the plants. Plants stimulate their immune systems in response to all the stresses that they face from environment. Plant hormones play an important part in guarding plants from environmental stresses (Pieterse et al. 2012). The Jasmonic acid (JA) signaling pathway harboring JAZ genes is one of the essential mechanisms that regulate physiological processes and also protects plants against multiple stresses (Ruan et al. 2019). JAZ gene family plays an important role in the JA signaling pathway when herbivores attack plants. In cotton, through investigation of the roles and regulatory network of the JAZ gene, it is possible to develop methods that can increase the plant's capacity to resist diseases, pests, and the challenges offered by the environment, which results in better quality and enhanced crop production. The JA signaling pathway, which involves multiple genes and proteins, is a sophisticated and intricate cascade of signal transduction events that involve downstream gene response and the breakdown and production of molecules (Kazan 2015, Kazan and Manners 2012).
When the plants are exposed to stimuli from external stresses, they produce JA for their defense where JA is then turned into adenylate, converting the JAR1 enzyme into highly active JA-Ile. Only the JA receptor F-box protein COI1 (coronatine insensitve1) is bound by JA-Ile (Yan et al. 2009). The binding of MYC2 and COI1 involves the JAS domain. NINJA (new interactors of JAZ) (Thines et al. 2007) are bound by the ZIM domain that contains the TIFY motif. JAZ functions as a "repressor" in the JA pathway and is also thought to be a part of the JA co-receptor (Sheard et al. 2010). JAZ proteins connect with NINJA proteins (Pauwels et al. 2010) in the absence of JA-Ile to recruit the co-repressor TPL (TOPLESS), this interaction enables JAZ proteins to interact with downstream transcription factors, like MYC2, to prevent MYC2 from transcriptionally activating JA-responsive genes. When JA-Ile is present, the stress-accumulated JA-Ile binds to COI1 and facilitates direct binding of the COI1-JAZs complex. These complex forms and the JAZ proteins are ubiquitinated by the E3 ubiquitin ligase SCFCOI1 (Skp/Cullin/F-box) complex, which ultimately degrades the JAZ repressor by means of the 26S proteasome. ASK1/ASK2, Cullin1, Rbx1, and COI1 interact to each other to create the SCFCOI1 complex. These molecules play a crucial role in modulating the JA signaling response. MYC2 among them; not only helps to initiate JA signaling but also controls its termination. Furthermore, it can work in concert with MTB (MYC2-targeted bHLH) to modulate JA signaling (Katsir et al. 2008, Wang et al. 2015).
The interaction of the JAZ gene family with different transcription factors (MYC/JAM/ICF/MYB/TOE) controls the expression of downstream genes involved in regulating root elongation and growth (Fernández-Calvo et al. 2011), leaf senescence (Schweizer et al. 2013), plant flowering time (Zhai et al. 2015), insect resistance (Song et al. 2017), and freezing stress factors. JAZ genes also aid in the regulation of various biological processes (Chini et al. 2016) with the members of other hormone signal transduction pathways. Exemplified by the ethylene signaling pathway's core transcription factors. In Arabidopsis, ethylene insensitive3 (EIN3) and EIN3-LIKE1 (EIL1) can associate with JAZ proteins and slow down the ability to regulate the growth of the root. To control the ratio of defensive action against growth and development in plants, JAZ genes interact with the DELLA protein, an inhibitor of the gibberellin (GA) signal transduction (Chico et al. 2014), thus play a vital role in plant defense responses.
Insights into comparative genomics and evolution allow scientists to understand how plants adapt to certain unfavorable conditions (Abdullah-Zawawi et al. 2021). Now in the post genomic era of Next-Generation Sequencing (NGS) and bioinformatics, the genomes of various plant species have been assembled; that aid to perform genome-wide analysis, the identification and classification of genes based on their important domains and homology, which helps to reveal the regulatory mechanism and potential of functional diversity of genes families within and across the species (Sahu et al. 2020). Genome-wide analysis reveals the particular behaviors of gene families under different growth or stress conditions, such as their disease resistance, stress tolerance, and their relationship with the environment (Ehsan et al. 2023). The regulatory elements and expression patterns in the gene families are investigated through transcriptomics, and biological networks are uncovered by functional genomics (Feng et al. 2023).
The current work used a comprehensive genomic analysis approach to investigate the JAZ gene family in cotton. Arabidopsis, brassica, wheat, turnip, and other plant species have all been the subject of prior research into the JAZ family (Gupta et al. 2021, Liu et al. 2017, Liu et al. 2019, Song et al. 2011). The JAZ family is characterized in cotton by previous research (Sun et al. 2017), however, further study is required to expand and examine its role in certain stress conditions in cotton along with diploid G. herbaceum. We performed a comprehensive study of domain, phylogenetic analysis, and comparative genomics for JAZ gene famil for the JAZ gene family in five cotton species- G. hirsutum, G. arboreum, G. raimondii, G. barbadense, and G. herbaceum. An extensive computational analysis of the promoters in the cotton of the JAZ genes has been carried out to investigate the regulatory areas linked with stress response. Transcriptomic expression profiling is carried out to check JAZ gene expression under various stresses. The expression study of cotton genes was also performed under different abiotic stresses such as, drought, salinity, and heat, to evaluate the expression of JAZ01 and its related genes in the cascade. This study provide valuable insights into the biological role of cotton JAZ gene family and can contribute in the development of climate-smart varieties that can thrive in changing environmental challenges. The potential role of phytohormones in regulating plant development and stress tolerance has also been assessed. These discoveries are important not just for boosting the yield of cotton but also for advancing worldwide initiatives aimed at enhancing food security through the development of resilient crops that can endure the effects of climate change.
Identification and sequence retrieval of JAZ genes in Gossypium and land plant species
The gene IDs of the Jasmonate ZIM-domain (JAZ) family in different cotton species including G. arboreum (BGI assembly), G. barbadense (HAU assembly), G. hirsutum (BGI assembly), G. herbaceum (HAU assembly), G. raimondii (JGI assembly) and Solanum lycopersicum (ITAG 4.0) were fetched from CottonGen (https://www.cottongen.org/) using recent version of their assemblies. JAZ genes in Oryza sativa (v7.0), Solanum tuberosum (v4.03), Sorghum bicolor (v3.1.1), and Brassica rapa (FPsc v1.3) were fetched from Phytozome (https://phytozome-next.jgi.doe.gov/). Meanwhile, JAZ genes in Arabidopsis thaliana were taken from TAIR (https://www.arabidopsis.org/) using its BLAST feature. To extract the gene and protein information of Gossypium JAZ genes, the information about the CDS and chromosome of each gene was extracted from the respective assemblies.
Chromosomal localization of JAZ genes
The chromosomal location of JAZ genes in species G. arboreum, G. barbadense, G. hirsutum, G. herbaceum, and G. raimondii was obtained by downloading the abovementioned assemblies. The whole JAZ genes of Gossypium species were mapped to G. hirsutum's chromosomesusing an online tool MG2C_v2.1 (http://mg2c.iask.in/mg2c_v2.1/).
Multiple sequence alignment and phylogenetic relationship
The protein sequences of G. arboreum, G. barbadense, G. hirsutum, G. herbaceum, G. raimondii, O. sativa, S. lycopersicum, S. tuberosum, A. thaliana, B. rapa, and S. bicolor were aligned using MUSCLE and clustering method UPGMA in MEGA 11. The phylogenetic tree was constructed using the Maximum likelihood method, and the thread number was set to 4 in MEGA11 at the bootstrap value of 1000.
Cis-acting regulatory element / Promoter analysis
To confirm the role of cis-acting regulatory elements in G. arboreum, G. barbadense, G. herbaceum, and G. raimondii, the 1 kb upstream region of all JAZ genes in all above species was extracted from the CottonGen. The cis-acting regulatory elements were then identified by submitting the protein sequences to the CARE database.
Gene structure and predicted protein motifs identification of JAZ genes
The CDS sequences were fetched from cottonGen, while the genomic sequences were fetched using NCBI's BLAST feature for every JAZ gene in Gossypium species. The CDS and genomic sequences of all genes of G. arboreum, G. barbadense, G. hirsutum, G. herbaceum, and G. raimondii were submitted to the GSDS 2.0 database to obtain the gene structure of all JAZ genes present. MEME suite was used to identify the motifs of protein sequences. The protein sequences of Gossypium species G. arboreum, G. barbadense, G. hirsutum, G. herbaceum, and G. raimondii were added to Multiple Em for Motif Elicitation (MEME v5.5.2) selecting the ten motifs per sequence.
JAZ chromosome and protein information
The gene and protein information of JAZ genes in G. herbaceum was obtained. The gene information, like chromosome number and location, CDS, and exon number, were extracted from the respective assemblies. The protein information, like PI, GRAVY, and molecular weight, were found by submitting the sequence to the ProtParam tool of Expasy.
Correlation of JAZ genes between Gossypium genomes
To identify the sequence similarity between different A and D genomes of cotton, they were visualized using the Circoletto 07.09.16. The protein sequences of G. arboreum and G. herbaceum were then uploaded to the Circoletto to identify the sequence similarity of the A genome. G. barbadense and G. hirsutum's protein sequences were uploaded to Circoletto to visualize the sequence similarity between the AD genome of cotton.
Transcriptome analysis of JAZ genes in different tissues and developmental stages
The transcriptome data for G. hirsutum were acquired from the CottonMD database. The expression profiles of JAZ genes in tissue/organs and developmental stages of G. hirsutum were analyzed. Furthermore, the in-silico expression analysis was conducted on tissues subjected to different environmental and abiotic stresses. The differential gene expression data was taken in FPKMs, which represent the fragments per kilobase of transcript per million mapped reads, were utilized to generate a heat map of JAZ gene family expression.
Plant material and abiotic stresses
The ginning of the cotton G. hirsutum variety MNH886 was followed by rinsing with H2SO4. The seeds were seeded in peat mixture in a plastic container and then placed at 30 °C Day/28 °C night with a 16-h day duration and moistened for four to five weeks. The plants were then given drought stress by spraying their roots with 10% polyethylene glycol (PEG-8000) solution. The increased solute concentration in the solution resulted in an osmotic imbalance, causing the plants to experience water stress. For heat stress, plants were given high-temperature conditions by placing them from optimal temperature (28℃-30℃) to direct sunlight (~50℃). The Salt treatment was given using NaCl solution (200mM). RNA samples were taken from the same plants as the control before stress, and then different abiotic stresses were applied, and two hours post-stress, test samples were obtained from the same plants.
RNA extraction for quantitative real-time PCR (qRT-PCR) analysis of JAZ genes
To analyze the expression patterns of JAZ genes under different abiotic stress environments, we extracted total RNA from both the control and treated samples. We next did DNaseI treatment (using Thermo Scientific) to eliminate any presence of genomic DNA contamination. A quantity of 1 microgram (1 μg) of RNA was employed to produce the complementary DNA (cDNA) using the assistance of a high-capacity cDNA reverse transcription kit (Applied Biosystems™) and an oligo (dT) primer. The polymerase chain reaction (PCR) was conducted in a 96-well plate with the PowerUp™ SYBR™ Green Master Mix from Applied Biosystems™, in conjunction with the Applied Biosystems® Real-Time PCR equipment. The qRT-PCR analysis primers used in this study have been listed in Table 1. The amplification reactions were performed under the following conditions: 95 °C for 5 min, followed by 40 cycles of 95 °C for 15 s, 55 °C for 20 s, and 72 °C for 30 s. Melting curve analysis, performed by increasing the temperature from 55 to 95 °C (0.5 °C per 10 s). The ΔΔ Ct method was utilized to determine the relative fold difference for each sample in every experiment. The UBQ7 gene was employed as an endogenous reference gene for the purpose of normalizing the obtained results. The data were subjected to analysis using the iQTM5.
Identification and sequence retrieval of JAZ genes in Gossypium and land plant species
By retrieving the database, we detected a total of 187 JAZ genes based on cotton genome data and Hidden Markov Model (HMM), their genomic, CDS and protein sequences were also obtained. 14 JAZ genes were identified in G. herbaceum, whereas different numbers of JAZ genes were identified in other species; A. thaliana (13), G. arboreum (14), G. barbadense (24), G. hirsutum (24), G. raimondii (15), O. sativa (15), S. tuberosum (13), S. bicolor (16), B. rapa (26), and S. lycopersicum (13) as depicted in Figure 1. Abundance of JAZ genes were found in G. barbadense and G. hirsutum due to their allotetraploid genomes, whereas all other species except B. rapa had comparable number of JAZ genes.
Chromosomal localization of JAZ genes
All Gossypium JAZ genes were mapped on G. hirsutism's chromosome; mapping all genes at one set of chromosomes gives an insight into the enrichment of each chromosome. G. arboreum (yellow colour)can be visualized on the A genome, G. raimondii (blue colour) on the D genome, and G. barbadense (red colour), G. hirsutum (green colour), and G. herbaceum (purple colour) on AD genomes (Figure 2). Chromosome numbers 5 and 9 of both genomes have a high number of JAZ genes. Chromosome numbers 2, 4, 11, and 13 of the A genome and Chromosome numbers 3, 4, 7, 12, and 13 of the D genome have little to no genes. Furthermore, detailed gene and protein information of all G. herbaceum JAZ are given in Table 2.
Multiple sequence alignment and phylogenetic relationship
Multiple sequence alignment of JAZ proteins in G. arboreum, G. barbadense, G. hirsutum, G. herbaceum, G. raimondii, S. lycopersicum, O. sativa, S. tuberosum, S. bicolor, B. rapa, and A. thaliana showed high conservation of JAZ proteins. The JAZ proteins were aligned to explore the evolutionary relationship between different Gossypium and land plant species, and the phylogenetic tree was constructed. The 192 gene IDs were classified into seven groups based on their phylogeny. The groups were named from A to G. Clade A and B were distant from every other clade in the tree. Clade C and D are closely related, while Clade F and G are more closely related than Clade E (Figure 3). Clades A, B, C, D, and F contained protein members from monocots and dicots. Clade E has only monocots S. bicolor and O. sativa, while Clade G has only dicots. The evolutionary study revealed that all JAZ groupings originated from a common ancestor.
Cis-acting regulatory element / Promoter analysis
Cis-acting regulatory elements were identified in the promoter regions of the Gossypium genes to explore the expression of JAZ genes. The putative promoter region sequence of each JAZ gene was analyzed to obtain information about the cis-acting regulatory elements of the Gossypium JAZ gene family. Many important regulatory elements were abundant in different species, such as MYB, which is present most abundantly in G. arboreum and G. barbadense (Figure 4A), Figure 4B). ARE site being most abundant in G. herbaceum and G. raimondii (Figure 4D), Figure 4C). The type and number of cis-acting regulatory elements in the promoter region of every Gossypium JAZ gene were different. For instance, the LTR element was only found in the promoter regions of GbarJAZ5, GbarJAZ10, GbarJAZ12, and GbarJAZ16 (Figure 4B). MBS was found in the promoter regions of GaJAZ01, GaJAZ03, GaJAZ06, GaJAZ07, and GaJAZ09 (Figure 4A). TGA elements were presented in the promoter regions of GrJAZ8 and GaJAZ10. AT-rich sequence, P-box, TCA-element, TCCC-motif are only present in the promoter region of G. herbaceum. box S and Gap-box are only present in the G. raimondii promoter region. AuxRE, CCGTCC motif/box, and chs-CMA2a/c were only present in the promoter region of G. barbadense (Figure 4B). These showed that the different members of the JAZ family in different Gossypium species might be involved in different abiotic stresses.
Gene structure and predicted protein motifs identification of JAZ genes
Visualization of gene structures of G. herbaceum JAZ genes was plotted with the GSDS 2.0 database.The gene size of G. herbaceum ranges from 700 bps to 2.5 Kbs. The number of exons varies from three to six for different JAZ genes (Figure 5). Motif analysis of G. herbaceum conducted through the MEME suite identified that the JAZ genes are enriched in conserved motifs, and different numbers of motifs are found in each gene, mostly four to five except GheJAZ07, which only shows one conserved motif (Figure 6). Of all the 10 conserved domains, only Motif 1 and Motif 2 are significant and found throughout JAZ genes. These logos can be seen in Table 3.
Correlation of JAZ genes between Gossypium genomes
Maps were drawn to explore further the origin and the evolutionary relationship between JAZ gene synteny between the A genome and AD genomes. Every gene ID of G. herbaceum and G. arboreum shared a syntenic relationship (Figure 7A). GheJAZ07 and GaJAZ07 are homologous and descendants from common ancestors, likewise GaJAZ03-GheJAZ03 and GaJAZ12-GheJAZ12. Similar results were obtained from the synteny map of AD genomes where JAZ genes of G. hirsutum and G. barbadense showed a solid syntenic relationship (Figure 7B). GbarJAZ4 shows a close relationship between GhJAZ3 and GhJAZ4. Similarly, GbarJAZ3 shows a close relationship with both GhJAZ3 and GhJAZ4. GhJAZ17 has a close relationship between GbarJAZ17 and GbarJAZ9.
Transcriptome analysis of JAZ genes in different tissues and developmental stages
The transcriptomic gene expression analysis showed the expression profile of JAZ genes in different G. hirsutum tissue/organs (Figure 8A), different DPA (Figure 8B), and tissues exposed to various conditions and abiotic stresses (Figure 8C, 8D, 8E, 8F, 8G). Certain JAZ genes are found to be constantly differentially expressed in all conditions like JAZ01 and JAZ12, whereas some JAZ genes remained unresponsive during most conditions like JAZ11, JAZ17, and JAZ19. JAZ01, a component of the jasmonate signaling pathway, is abundantly found during developmental stages when compared to the abundance of other JAZ genes (Figure 8A, 8B), but it is moderately upregulated in the case of temperature-sensitive conditions like cold (4℃) (Figure 8C) and heat stress (37℃) (Figure 8G), and highly upregulated in other abiotic stresses like in that of salinity (Figure 8D), drought (Figure 8E), and leaf control (Figure 8F).
Plant material and abiotic stresses
G. hirsutum MNH886 is a cotton cultivar that responded differently to several abiotic stressors, demonstrating the plant's resilience to environmental difficulties. When plants were exposed to drought stress, it was created by applying a 10% polyethylene glycol (PEG-8000) solution. They showed physiological changes that suggested they were under water stress. Changes in gene expression patterns were seen in this, indicating a biochemical reaction to an osmotic imbalance. Significant alterations in heat-responsive genes were found in heat-stressed plants, which were exposed to temperatures above and above their ideal range (28°C–30°C) and direct sunlight (~50°C). The physiological parameters changed as a result of the heat-induced stress, indicating that the plant was able to adjust its metabolic activities in reaction to the high temperatures. Moreover, the plants responded noticeably to a 200 mM concentration of sodium chloride (NaCl) treatment, demonstrating their susceptibility to salt stress. Stress-responsive genes were found using RNA samples taken from the same plants both before and after each stress condition. Early molecular reactions were captured during the two-hour post-stress sampling period, which added to our understanding of the dynamic changes in G. hirsutum MNH886 under various abiotic stresses.
RNA extraction for quantitative real-time PCR (qRT-PCR) analysis of JAZ genes
For the transcript profiling of JAZ genes under various abiotic stress conditions, total RNA was extracted from the control and stressed plants. JAZ gene transcript profile in three abiotic stress environments (heat, salinity, and drought). As a control group, seedlings received no treatment at all. The X-axis displays the names of the stressors, while the Y-axis displays the relative expression level (fold change in comparison to the control). Relative fold change expression was calculated using the ΔΔCt method, with reference to UBQ7, an endogenous control. Each bar represents the average of three biological replicates (Figure 9). As results demonstrated, JAZ1, ACO, MPK3, and WRKY40 were upregulated in the case of all of the abiotic stresses. MPK6, ERF1, and HSP40were found to be downregulated in drought and salinity-stressed plants, while their expression was elevated in case of heat stress.
Jasmonate-ZIM domain or JAZ genes control jasmonic acid signaling, which in turn controls a range of stress reactions and developmental activities in plants (Delgado et al. 2021). In this study, we have executed a genome-wide analysis of the JAZ gene family in cotton, and our classification corroborates with previous studies. With the advent of NGS technologies, the first genome to be sequenced belonged to A. thaliana, a plant of the Brassicaceae family (Initiative 2000). Other plant species, including G. arboreum, G. barbadense, G. hirsutum, G. herbaceum, G. raimondii, O. sativa, S. tuberosum, S. bicolor, B. rapa, and S. lycopersicum, then had their whole genome sequences completed (Murat et al. 2016). The availability of these genomes enhanced our comprehension of the evolutionary links among the various plant species. It provided a strong basis for the discovery of genome-wide genes and functional studies of JAZ genes (Koenig and Weigel 2015, Warwick et al. 2010). The JAZ subfamily has been the subject of earlier research that has concentrated on gene identification and expression response to different hormones or stress treatments in a variety of model plants, including Arabidopsis, and crops, including rice, maize, wheat, and soybean (Ebel et al. 2018, Huang et al. 2017, Ye et al. 2009, Zhang et al. 2015, Zhu et al. 2013). The investigations on the TIFY family have been described in B. rapa, B. oleracea, and B. napus exclusive to plants. In the oldest terrestrial plant moss, two TIFY genes have been found, whereas the TIFY gene family has been seen in all terrestrial plants (Saha et al. 2016, Swanson et al. 2004). Hence, it is postulated that the emergence of the TIFY gene family occurred during the evolutionary transition of plants from aqueous to land habitats. However, comprehensive characterization and comparative evolutionary information between all cotton species including G. herbaceum with a focus on the JAZ subfamily is still limited.
The JAZ gene family is known for its significant involvement in regulating several physiological processes related to plant growth and stress responses. These functions are mediated via the signaling pathways of jasmonic acid (JA), including seed germination, flower development, and the plant's reaction to environmental factors such as salt, drought, high temperature, wounds, and diseases (He et al. 2018, Ju et al. 2019, Liu, Zhang, Li and Xia 2019, Yu et al. 2018, Zhao et al. 2020). These proteins are actively involved in the cellular response to stress and serve as key mediators in the signaling pathways of phytohormones, facilitating the activation of genes responsible for defensive mechanisms. In addition to this, JAZ proteins play a crucial role in maintaining a delicate equilibrium between growth and defense mechanisms, hence preventing the adverse consequences associated with excessive immune responses triggered by the jasmonic acid (JA) defense pathway (Guo et al. 2018).
Even among closely related species, there were significant changes in genome size, shape, and copy number (Zhang et al. 2018). These variations were confined to repetitive sequences and impacted certain gene families engaged in various physiological processes in plants (Lysak et al. 2009). In this study, 13 JAZ genes identified A. thaliana, 14 in G. arboreum, 24 in G. barbadense, 24 in G. hirsutum, 14 in G. herbaceum, 15 in G. raimondii, 15 in O. sativa, 13 in S. tuberosum, 16 in S. bicolor, 26 in B. rapa, and 13 in S. lycopersicum. All JAZ genes were divided into 7 groups from A to G. Based on their cotyledons, all JAZ genes arranged themselves into each group. Clades A, B, C, D, and F contained protein members (Delgado, Mora-Poblete, Ahmar, Chen and Figueroa 2021) from monocots and dicots. Clade E has only monocots S. bicolor and O. sativa, while Clade G has only dicots. Genes in the same clade might suggest their similar or complementary physiological functions in plants.
The precise interaction between cis-acting elements (CARE) and transcription factors (TFs) inside the promoter region plays a crucial role in the regulation of gene expression. This mechanism serves as a fundamental process for biological signal transmission and facilitates gene cooperation with other genes. In Gossypium JAZ genes, a comprehensive analysis revealed the presence of 67 probable cis-acting regulatory elements. These elements are associated with 17 or more distinct activities. The regulatory elements identified in this study include the TC-rich repeat element, which is associated with defense and stress responsiveness (Lv et al. 2023), Additionally, the LTR element is involved in low-temperature responsiveness (Du et al. 2022), MYB-binding sites (MBS) are implicated in drought-inducibility (Heidari et al. 2021), while the MYB binding site (MRE) and ACE are involved in light responsiveness (Hartmann et al. 2005), the ABRE associated with ABA signaling pathway (Nakashima and Yamaguchi-Shinozaki 2013), AuxRR-core and TGA elements related to Auxin-responsiveness (Chen and Liu 2019), TCA-elements involved in salicylic acid-responsive elements (Chen et al. 2005), CGTCA and TGACG motifs involved in MeJA responsiveness (Wang et al. 2011), P-box, TATC-box, and GARE-motif involved in gibberellin-responsive. In addition, several cis-acting elements are linked to hormones, such as ABREs, P-boxes, TCA elements, and TGA elements. The presence of these cis-acting areas might possibly have a substantial impact on the involvement of JAZ genes in the disease resistance pathway regulated by jasmonic acid (JA).
In order to get a deeper understanding of the structural organization of JAZ genes in G. herbaceum, their conserved motifs were found. Two conserved motifs, namely JAZ and TIFY, were found in G. herbaceum. The first motif, identified by its Interpro ID as PF09425, is recognized as a Jas motif. This motif can engage in a binding interaction with jasmonate, adopting a partly unwound helical conformation. Furthermore, it can engage in interactions with Myc proteins, which serve as important mediators of jasmonate signaling in plants (Zhang et al. 2015). The second motif, identified as Interpro ID: IPR010399, corresponds to a Tify domain of a sequence of 36 amino acids. This domain is found solely in Embryophyta, a taxonomic group that encompasses terrestrial plants. The naming of this particular domain is attributed to its presence of the amino acid pattern (TIF[F/Y]XG), which is known for its remarkable conservation. However, it was previously denoted as the Zim domain (NISHII et al. 2000, Shikata et al. 2004, Vanholme et al. 2007, White 2006).
The examination of synteny among JAZ genes in the four cotton species revealed a robust collinearity pattern despite the presence of chromosomal rearrangements or gene duplication events. Gene duplication events are a significant mechanism by which plants undergo evolutionary processes and facilitate the expansion of gene families (Magadum et al. 2013). Research findings indicate that a significant proportion of angiosperms, ranging from 70% to 80%, have undergone gene duplication or polyploidization events (Qiao et al. 2019). From a biological evolutionary standpoint, fragment replication, tandem duplication, and translocation are mechanisms that are very successful in producing novel genes and facilitating the development of resistance against external threats (Panchy et al. 2016).
The present study highlights the ubiquitous significance of GhJAZ genes in stress physiology and highlights the crucial role these genes play in reacting to different environmental stressors. This pattern is duplicated in other plant species (Hu et al. 2013, Thines et al. 2007). JAZ01 exhibits observable differential regulation under salinity, heat, and drought. This is consistent with its function in ion balance under salinity stress (Qi et al. 2011), triggering heat shock responses to counteract thermal stress (Clarke et al. 2004) and jasmonate signaling pathways for drought stress management via ABA-dependent mechanisms (Seo et al. 2009). Because of its broad-spectrum stress reactivity, JAZ01 may be used as a target in crop breeding initiatives to increase stress tolerance.
Another important insight we obtained from this study was that there is a significant alternation of expression of other stress-related genes in treated plants. JAZ1, and associated genes including ACO, MPK3, WRKY40, MPK6, ERF1, and HSP40 cummulatively play a major role in plant stress tolerance [20], therefore, we accessed their response when it comes to reacting to different abiotic stresses. JAZ01, a component of the jasmonate signaling pathway, plays a vital role in regulating defensive responses in a number of different stress circumstances [20]. ACO, a crucial component in the production of ethylene, plays a pivotal role in regulating responses to drought and salt conditions by modulating ethylene levels. The members of the MAP kinase gene family having a role in signaling, MPK3 and MPK6, enhance the plant's resistance to environmental stress (Pitzschke and Hirt 2010, Sinha et al. 2011). WRKY40, a transcription factor, modulates the expression of genes that respond to abiotic signals by guiding the response to unfavorable conditions (Jiang and Deyholos 2009). ERF1 basically transmits the ethylene signals to plants, regulating the transcript level of stress-related genes (Müller and Munné-Bosch 2015). Additionally, HSP40, a unique heat shock protein, has a role in protecting plants from high temperatures by aiding the process of folding of proteins and their degradation (Sarkar et al. 2013).
The upregulation of JAZ01, ACO, MPK3, and WRKY40 genes and the specific regulation of MPK6, ERF1, and HSP40 genes in cotton plants under heat, salt, and drought conditions underlines their crucial function in the defense mechanisms against abiotic stress. The involvement of JAZ01 in the transmission of jasmonate signals and ACO in the generation of ethylene suggests a synchronized hormonal control that enhances the ability to withstand stress (Van de Poel et al. 2015, Wasternack and Hause 2013). The constant MPK3 enhanced expression across all stresses indicates its participation in widespread stress response. In contrast, MPK6 and ERF1 show stress-specific responses. Additionally, they interact with other stress-responsive pathways, such as abscisic acid (Müller and Munné-Bosch 2015, Rodriguez et al. 2010). The expression pattern of HSP40 suggests its role in enhancing protein stability under heat stress. Downregulation under exposure to salt and drought conditions suggests a change in chaperones to deal with (Wang et al. 2004). Increased expression of WRKY40 in all stress conditions gives it a wide-ranging regulatory role in defense pathways, such as osmotic balance, cellular safeguarding, and water conservation (Rushton et al. 2012). Collectively, JAZ01 and associated genes play important roles in a complex adaptative response, augmenting a plant's ability to endure unfavorable environmental conditions.
This study delves into the genomes of Gossypium, specifically conducting a genome-wide analysis to confirm the presence of the JAZ gene family in the G. herbaceum genome. This analysis provides valuable insights into the spread and conservation of the JAZ gene family in diploid cotton. Furthermore, we have elucidated the expression of JAZ genes in tetraploid cotton, validated JAZ01 and its pathway genes, and demonstrated the significance of these genes in salinity, drought, and heat stress in cotton. The results highlight the essential function of JAZ genes in boosting cotton's resistance to environmental stressors, a matter of growing significance during global climate change. The data revealed here broadens the knowledge about the JAZ gene family in cotton and paves the way for exploiting this important gene family to develop climate-smart future crops. Utilizing this knowledge, the creation of robust cotton cultivars may enhance global food security and sustainable agriculture, in accordance with the objectives of reducing the effects of climate change on crop yield.
Authors contribution
IA and RZN: conceptualization, review & editing, II and RZ: methodology, formal analysis, data curation, writing-original draft. AE, MAk and MAs: methodology, data curation. II, MJAA, RZ and RZN: data analysis, review, and editing. II, RZ and RZN: writing-review and In-silico analysis. All authors read and approved the final manuscript.
Acknowledgements
We are thankful to our colleagues at Agricultural Biotechnology Division, NIBGE, who provided their suggestions and support during this research.
Funding sources
This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.
Competing interest
The authors have no competing interest.
- Abdullah-Zawawi M-R, Ahmad-Nizammuddin N-F, Govender N, Harun S, Mohd-Assaad N, Mohamed-Hussein Z-A (2021) Comparative genome-wide analysis of WRKY, MADS-box and MYB transcription factor families in Arabidopsis and rice. Scientific reports 11:19678
- Ashraf M, Ahmad S (2000) Influence of sodium chloride on ion accumulation, yield components and fibre characteristics in salt-tolerant and salt-sensitive lines of cotton (Gossypium hirsutum L.). Field Crops Research 66:115-127
- Chen B-J, Wang Y, Hu Y-L, Wu Q, Lin Z-PJPS (2005) Cloning and characterization of a drought-inducible MYB gene from Boea crassifolia. 168:493-500
- Chen P, Liu Q-z (2019) Genome-wide characterization of the WRKY gene family in cultivated strawberry (Fragaria × ananassa Duch.) and the importance of several group III members in continuous cropping. Scientific Reports 9:8423. DOI 10.1038/s41598-019-44479-7
- Chico J-M, Fernández-Barbero G, Chini A, Fernández-Calvo P, Díez-Díaz M, Solano R (2014) Repression of jasmonate-dependent defenses by shade involves differential regulation of protein stability of MYC transcription factors and their JAZ repressors in Arabidopsis. The Plant Cell 26:1967-1980
- Chini A, Gimenez-Ibanez S, Goossens A, Solano R (2016) Redundancy and specificity in jasmonate signalling. Current opinion in plant biology 33:147-156
- Clarke SM, Mur LA, Wood JE, Scott IM (2004) Salicylic acid dependent signaling promotes basal thermotolerance but is not essential for acquired thermotolerance in Arabidopsis thaliana. Plant J 38:432-447. DOI 10.1111/j.1365-313X.2004.02054.x
- Delgado C, Mora-Poblete F, Ahmar S, Chen JT, Figueroa CR (2021) Jasmonates and Plant Salt Stress: Molecular Players, Physiological Effects, and Improving Tolerance by Using Genome-Associated Tools. Int J Mol Sci 22. DOI 10.3390/ijms22063082
- Du Q-l, Fang Y-p, Jiang J-m, Chen M-q, Li X-y, Xie X (2022) Genome-wide identification and characterization of the JAZ gene family and its expression patterns under various abiotic stresses in Sorghum bicolor. Journal of Integrative Agriculture 21:3540-3555. DOI https://doi.org/10.1016/j.jia.2022.08.104
- Ebel C, BenFeki A, Hanin M, Solano R, Chini A (2018) Characterization of wheat (Triticum aestivum) TIFY family and role of Triticum Durum TdTIFY11a in salt stress tolerance. PloS one 13:e0200566. DOI 10.1371/journal.pone.0200566
- Ehsan A, Naqvi RZ, Azhar M, Awan MJA, Amin I, Mansoor S, Asif M (2023) Genome-Wide Analysis of WRKY Gene Family and Negative Regulation of GhWRKY25 and GhWRKY33 Reveal Their Role in Whitefly and Drought Stress Tolerance in Cotton. Genes 14:171
- Feng C-H, Niu M-X, Liu X, Bao Y, Liu S, Liu M, He F, Han S, Liu C, Wang H-L (2023) Genome-Wide Analysis of the FBA Subfamily of the Poplar F-Box Gene Family and Its Role under Drought Stress. International Journal of Molecular Sciences 24:4823
- Fernández-Calvo P, Chini A, Fernández-Barbero G, Chico J-M, Gimenez-Ibanez S, Geerinck J, Eeckhout D, Schweizer F, Godoy M, Franco-Zorrilla JM (2011) The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses. The Plant Cell 23:701-715
- Guo Q, Yoshida Y, Major IT, Wang K, Sugimoto K, Kapali G, Havko NE, Benning C, Howe GA (2018) JAZ repressors of metabolic defense promote growth and reproductive fitness in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America 115:E10768-e10777. DOI 10.1073/pnas.1811828115
- Gupta A, Bhardwaj M, Tran L-SP (2021) JASMONATE ZIM-DOMAIN family proteins: important nodes in jasmonic acid-abscisic acid crosstalk for regulating plant response to drought. Current Protein and Peptide Science 22:759-766
- Hartmann U, Sagasser M, Mehrtens F, Stracke R, Weisshaar BJPmb (2005) Differential combinatorial interactions of cis-acting elements recognized by R2R3-MYB, BZIP, and BHLH factors control light-responsive and tissue-specific activation of phenylpropanoid biosynthesis genes. 57:155-171
- He X, Zhu L, Wassan GM, Wang Y, Miao Y, Shaban M, Hu H, Sun H, Zhang X (2018) GhJAZ2 attenuates cotton resistance to biotic stresses via the inhibition of the transcriptional activity of GhbHLH171. Molecular plant pathology 19:896-908. DOI 10.1111/mpp.12575
- Heidari P, Faraji S, Ahmadizadeh M, Ahmar S, Mora-Poblete FJFiG (2021) New insights into structure and function of TIFY genes in Zea mays and Solanum lycopersicum: A genome-wide comprehensive analysis. 12:657970
- Hu Y, Jiang L, Wang F, Yu D (2013) Jasmonate regulates the inducer of cbf expression-C-repeat binding factor/DRE binding factor1 cascade and freezing tolerance in Arabidopsis. Plant Cell 25:2907-2924. DOI 10.1105/tpc.113.112631
- Huang H, Gao H, Liu B, Qi T, Tong J, Xiao L, Xie D, Song S (2017) Arabidopsis MYB24 Regulates Jasmonate-Mediated Stamen Development. Front Plant Sci 8:1525. DOI 10.3389/fpls.2017.01525
- Initiative A (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408:796-815. DOI 10.1038/35048692
- Jiang Y, Deyholos MK (2009) Functional characterization of Arabidopsis NaCl-inducible WRKY25 and WRKY33 transcription factors in abiotic stresses. Plant Mol Biol 69:91-105. DOI 10.1007/s11103-008-9408-3
- Ju L, Jing Y, Shi P, Liu J, Chen J, Yan J, Chu J, Chen KM, Sun J (2019) JAZ proteins modulate seed germination through interaction with ABI5 in bread wheat and Arabidopsis. The New phytologist 223:246-260. DOI 10.1111/nph.15757
- Kamburova V, Salakhutdinov I, Abdurakhmonov IY (2022) Cotton breeding in the view of abiotic and biotic stresses: challenges and perspectives. IntechOpen
- Katsir L, Chung HS, Koo AJ, Howe GA (2008) Jasmonate signaling: a conserved mechanism of hormone sensing. Current opinion in plant biology 11:428-435
- Kazan K (2015) Diverse roles of jasmonates and ethylene in abiotic stress tolerance. Trends in plant science 20:219-229
- Kazan K, Manners JM (2012) JAZ repressors and the orchestration of phytohormone crosstalk. Trends in plant science 17:22-31
- Koenig D, Weigel D (2015) Beyond the thale: comparative genomics and genetics of Arabidopsis relatives. Nature reviews Genetics 16:285-298. DOI 10.1038/nrg3883
- Liu F, Sun T, Wang L, Su W, Gao S, Su Y, Xu L, Que Y (2017) Plant jasmonate ZIM domain genes: shedding light on structure and expression patterns of JAZ gene family in sugarcane. Bmc Genomics 18:1-17
- Liu S, Zhang P, Li C, Xia G (2019) The moss jasmonate ZIM-domain protein PnJAZ1 confers salinity tolerance via crosstalk with the abscisic acid signalling pathway. Plant science : an international journal of experimental plant biology 280:1-11. DOI 10.1016/j.plantsci.2018.11.004
- Lv G, Han R, Shi J, Chen K, Liu G, Yu Q, Yang C, Jiang J (2023) Genome-wide identification of the TIFY family reveals JAZ subfamily function in response to hormone treatment in Betula platyphylla. BMC Plant Biology 23:143. DOI 10.1186/s12870-023-04138-6
- Lysak MA, Koch MA, Beaulieu JM, Meister A, Leitch IJ (2009) The dynamic ups and downs of genome size evolution in Brassicaceae. Molecular biology and evolution 26:85-98. DOI 10.1093/molbev/msn223
- Magadum S, Banerjee U, Murugan P, Gangapur D, Ravikesavan RJJog (2013) Gene duplication as a major force in evolution. 92:155-161
- Majeed S, Rana IA, Mubarik MS, Atif RM, Yang S-H, Chung G, Jia Y, Du X, Hinze L, Azhar MT (2021) Heat stress in cotton: a review on predicted and unpredicted growth-yield anomalies and mitigating breeding strategies. Agronomy 11:1825
- Müller M, Munné-Bosch S (2015) Ethylene Response Factors: A Key Regulatory Hub in Hormone and Stress Signaling. Plant Physiol 169:32-41. DOI 10.1104/pp.15.00677
- Murat F, Louis A, Maumus F, Armero A, Cook R, Quesneville H, Roest Crollius H, Salse J (2016) Erratum to: Understanding Brassicaceae evolution through ancestral genome reconstruction. Genome biology 17:64. DOI 10.1186/s13059-016-0887-2
- Nakashima K, Yamaguchi-Shinozaki KJPcr (2013) ABA signaling in stress-response and seed development. 32:959-970
- NISHII A, TAKEMURA M, FUJITA H, SHIKATA M, YOKOTA A, KOHCHI T (2000) Characterization of a Novel Gene Encoding a Putative Single Zinc-finger Protein, ZIM, Expressed during the Reproductive Phase in Arabidopsis thaliana. Bioscience, Biotechnology, and Biochemistry 64:1402-1409. DOI 10.1271/bbb.64.1402
- Panchy N, Lehti-Shiu M, Shiu S-HJPp (2016) Evolution of gene duplication in plants. 171:2294-2316
- Pauwels L, Barbero GF, Geerinck J, Tilleman S, Grunewald W, Pérez AC, Chico JM, Bossche RV, Sewell J, Gil E (2010) NINJA connects the co-repressor TOPLESS to jasmonate signalling. Nature 464:788-791
- Pettigrew W (2008) The effect of higher temperatures on cotton lint yield production and fiber quality. Crop science 48:278-285
- Pieterse CM, Van der Does D, Zamioudis C, Leon-Reyes A, Van Wees SC (2012) Hormonal modulation of plant immunity. Annual review of cell and developmental biology 28:489-521
- Pitzschke A, Hirt H (2010) New insights into an old story: Agrobacterium-induced tumour formation in plants by plant transformation. Embo j 29:1021-1032. DOI 10.1038/emboj.2010.8
- Prakash S, Kumar M, Radha, Kumar S, Jaconis S, Parameswari E, Sharma K, Dhumal S, Senapathy M, Deshmukh VP (2023) The resilient cotton plant: uncovering the effects of stresses on secondary metabolomics and its underlying molecular mechanisms. Functional & Integrative Genomics 23:183
- Qi T, Song S, Ren Q, Wu D, Huang H, Chen Y, Fan M, Peng W, Ren C, Xie D (2011) The Jasmonate-ZIM-domain proteins interact with the WD-Repeat/bHLH/MYB complexes to regulate Jasmonate-mediated anthocyanin accumulation and trichome initiation in Arabidopsis thaliana. Plant Cell 23:1795-1814. DOI 10.1105/tpc.111.083261
- Qiao X, Li Q, Yin H, Qi K, Li L, Wang R, Zhang S, Paterson AHJGb (2019) Gene duplication and evolution in recurring polyploidization–diploidization cycles in plants. 20:1-23
- Rodriguez MC, Petersen M, Mundy J (2010) Mitogen-activated protein kinase signaling in plants. Annu Rev Plant Biol 61:621-649. DOI 10.1146/annurev-arplant-042809-112252
- Ruan J, Zhou Y, Zhou M, Yan J, Khurshid M, Weng W, Cheng J, Zhang K (2019) Jasmonic acid signaling pathway in plants. International journal of molecular sciences 20:2479
- Rushton DL, Tripathi P, Rabara RC, Lin J, Ringler P, Boken AK, Langum TJ, Smidt L, Boomsma DD, Emme NJ, Chen X, Finer JJ, Shen QJ, Rushton PJ (2012) WRKY transcription factors: key components in abscisic acid signalling. Plant Biotechnology Journal 10:2-11. DOI https://doi.org/10.1111/j.1467-7652.2011.00634.x
- Saha G, Park JI, Kayum MA, Nou IS (2016) A Genome-Wide Analysis Reveals Stress and Hormone Responsive Patterns of TIFY Family Genes in Brassica rapa. Front Plant Sci 7:936. DOI 10.3389/fpls.2016.00936
- Sahu PK, Sao R, Mondal S, Vishwakarma G, Gupta SK, Kumar V, Singh S, Sharma D, Das BK (2020) Next generation sequencing based forward genetic approaches for identification and mapping of causal mutations in crop plants: A comprehensive review. Plants 9:1355
- Sarkar NK, Kundnani P, Grover A (2013) Functional analysis of Hsp70 superfamily proteins of rice (Oryza sativa). Cell Stress Chaperones 18:427-437. DOI 10.1007/s12192-012-0395-6
- Schweizer F, Bodenhausen N, Lassueur S, Masclaux FG, Reymond P (2013) Differential contribution of transcription factors to Arabidopsis thaliana defense against Spodoptera littoralis. Frontiers in Plant Science 4:13
- Seo PJ, Xiang F, Qiao M, Park JY, Lee YN, Kim SG, Lee YH, Park WJ, Park CM (2009) The MYB96 transcription factor mediates abscisic acid signaling during drought stress response in Arabidopsis. Plant Physiol 151:275-289. DOI 10.1104/pp.109.144220
- Sheard LB, Tan X, Mao H, Withers J, Ben-Nissan G, Hinds TR, Kobayashi Y, Hsu F-F, Sharon M, Browse J (2010) Jasmonate perception by inositol-phosphate-potentiated COI1–JAZ co-receptor. Nature 468:400-405
- Shikata M, Matsuda Y, Ando K, Nishii A, Takemura M, Yokota A, Kohchi T (2004) Characterization of Arabidopsis ZIM, a member of a novel plant-specific GATA factor gene family. J Exp Bot 55:631-639. DOI 10.1093/jxb/erh078
- Sinha AK, Jaggi M, Raghuram B, Tuteja N (2011) Mitogen-activated protein kinase signaling in plants under abiotic stress. Plant Signal Behav 6:196-203. DOI 10.4161/psb.6.2.14701
- Song S, Qi T, Huang H, Ren Q, Wu D, Chang C, Peng W, Liu Y, Peng J, Xie D (2011) The jasmonate-ZIM domain proteins interact with the R2R3-MYB transcription factors MYB21 and MYB24 to affect jasmonate-regulated stamen development in Arabidopsis. The Plant Cell 23:1000-1013
- Song Y, Zhao G, Zhang X, Li L, Xiong F, Zhuo F, Zhang C, Yang Z, Datla R, Ren M (2017) The crosstalk between Target of Rapamycin (TOR) and Jasmonic Acid (JA) signaling existing in Arabidopsis and cotton. Scientific Reports 7:45830
- Sun H, Chen L, Li J, Hu M, Ullah A, He X, Yang X, Zhang X (2017) The JASMONATE ZIM-domain gene family mediates JA signaling and stress response in cotton. Plant and Cell Physiology 58:2139-2154
- Swanson WJ, Wong A, Wolfner MF, Aquadro CF (2004) Evolutionary expressed sequence tag analysis of Drosophila female reproductive tracts identifies genes subjected to positive selection. Genetics 168:1457-1465. DOI 10.1534/genetics.104.030478
- Thines B, Katsir L, Melotto M, Niu Y, Mandaokar A, Liu G, Nomura K, He SY, Howe GA, Browse J (2007) JAZ repressor proteins are targets of the SCF(COI1) complex during jasmonate signalling. Nature 448:661-665. DOI 10.1038/nature05960
- Thines B, Katsir L, Melotto M, Niu Y, Mandaokar A, Liu G, Nomura K, He SY, Howe GA, Browse J (2007) JAZ repressor proteins are targets of the SCFCOI1 complex during jasmonate signalling. Nature 448:661-665
- Van de Poel B, Smet D, Van Der Straeten D (2015) Ethylene and Hormonal Cross Talk in Vegetative Growth and Development. Plant Physiol 169:61-72. DOI 10.1104/pp.15.00724
- Vanholme B, Grunewald W, Bateman A, Kohchi T, Gheysen G (2007) The tify family previously known as ZIM. Trends in Plant Science 12:239-244. DOI https://doi.org/10.1016/j.tplants.2007.04.004
- Wang C, Liu Y, Li S-S, Han G-Z (2015) Insights into the origin and evolution of the plant hormone signaling machinery. Plant physiology 167:872-886
- Wang W, Vinocur B, Shoseyov O, Altman A (2004) Role of plant heat-shock proteins and molecular chaperones in the abiotic stress response. Trends Plant Sci 9:244-252. DOI 10.1016/j.tplants.2004.03.006
- Wang Y, Liu G-J, Yan X-F, Wei Z-G, Xu Z-RJJoPD, Protection (2011) MeJA-inducible expression of the heterologous JAZ2 promoter from Arabidopsis in Populus trichocarpa protoplasts. 118:69-74
- Warwick SI, Mummenhoff K, Sauder CA, Koch MA, Al-Shehbaz IA (2010) Closing the gaps: phylogenetic relationships in the Brassicaceae based on DNA sequence data of nuclear ribosomal ITS region. Plant Systematics and Evolution 285:209-232. DOI 10.1007/s00606-010-0271-8
- Wasternack C, Hause B (2013) Jasmonates: biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany. Annals of botany 111:1021-1058
- White DWR (2006) <i>PEAPOD</i> regulates lamina size and curvature in <i>Arabidopsis</i>. Proceedings of the National Academy of Sciences 103:13238-13243. DOI doi:10.1073/pnas.0604349103
- Xu Z, Shimizu H, Yagasaki Y, Ito S, Zheng Y, Zhou G (2013) Interactive effects of elevated CO 2, drought, and warming on plants. Journal of Plant Growth Regulation 32:692-707
- Yan J, Zhang C, Gu M, Bai Z, Zhang W, Qi T, Cheng Z, Peng W, Luo H, Nan F (2009) The Arabidopsis CORONATINE INSENSITIVE1 protein is a jasmonate receptor. The Plant Cell 21:2220-2236
- Ye H, Du H, Tang N, Li X, Xiong L (2009) Identification and expression profiling analysis of TIFY family genes involved in stress and phytohormone responses in rice. Plant molecular biology 71:291-305. DOI 10.1007/s11103-009-9524-8
- Yu X, Chen G, Tang B, Zhang J, Zhou S, Hu Z (2018) The Jasmonate ZIM-domain protein gene SlJAZ2 regulates plant morphology and accelerates flower initiation in Solanum lycopersicum plants. Plant science : an international journal of experimental plant biology 267:65-73. DOI 10.1016/j.plantsci.2017.11.008
- Zhai Q, Zhang X, Wu F, Feng H, Deng L, Xu L, Zhang M, Wang Q, Li C (2015) Transcriptional mechanism of jasmonate receptor COI1-mediated delay of flowering time in Arabidopsis. The Plant Cell 27:2814-2828
- Zhang F, Yao J, Ke J, Zhang L, Lam VQ, Xin X-F, Zhou XE, Chen J, Brunzelle J, Griffin PR, Zhou M, Xu HE, Melcher K, He SY (2015) Structural basis of JAZ repression of MYC transcription factors in jasmonate signalling. Nature 525:269-273. DOI 10.1038/nature14661
- Zhang L, Cai X, Wu J, Liu M, Grob S, Cheng F, Liang J, Cai C, Liu Z, Liu B, Wang F, Li S, Liu F, Li X, Cheng L, Yang W, Li MH, Grossniklaus U, Zheng H, Wang X (2018) Improved Brassica rapa reference genome by single-molecule sequencing and chromosome conformation capture technologies. Horticulture research 5:50. DOI 10.1038/s41438-018-0071-9
- Zhang L, Peng J, Chen T, Zhao X, Zhang S, Liu S, Dong H, Feng L, Yu S (2014) Effect of drought stress on lipid peroxidation and proline content in cotton roots. JAPS: Journal of Animal & Plant Sciences 24
- Zhang Z, Li X, Yu R, Han M, Wu Z (2015) Isolation, structural analysis, and expression characteristics of the maize TIFY gene family. Molecular genetics and genomics : MGG 290:1849-1858. DOI 10.1007/s00438-015-1042-6
- Zhao C, Pan X, Yu Y, Zhu Y, Kong F, Sun X, Wang F (2020) Overexpression of a TIFY family gene, GsJAZ2, exhibits enhanced tolerance to alkaline stress in soybean. Molecular Breeding 40:33. DOI 10.1007/s11032-020-01113-z
- Zhu D, Bai X, Luo X, Chen Q, Cai H, Ji W, Zhu Y (2013) Identification of wild soybean (Glycine soja) TIFY family genes and their expression profiling analysis under bicarbonate stress. Plant cell reports 32:263-272. DOI 10.1007/s00299-012-1360-7
Table 1 Primers used in qRT-PCR of cotton under salinity, drought and heat stress
|
Primer Pair No. |
Primers Name |
Primer Sequence |
|
1 |
JAZ1-Gh-F |
TTATGGTGGACGAGTGATTGTGTT |
|
JAZ1-Gh-R |
TTGATTGGACTTCTGGCTATGCT |
|
|
2 |
ACO1-Gh-F |
TACAAGAGCGTGGAGCACAG |
|
ACO1-Gh-R |
TTGGCCTGGAATTTAAGCAC |
|
|
3 |
ERF1-Gh-F |
GCTCAAAAGCTAATAATGAAGGGG |
|
ERF1-Gh-R |
AGTATCAAAGGTTCCAAGCCAAA |
|
|
4 |
MPK3-Gh-F |
GCGGCTGAATTCATTAACTGAGCTGCTCGG |
|
MPK3-Gh-R |
TTAAGGGGTACCCCCAATGGTTGCTGC |
|
|
5 |
MPK6-Gh-F |
GCTGAGTTGGGGTTTTTGAATG |
|
MPK6-Gh-R |
GATGATAGGTAAGGATGAGCTAGTGC |
|
|
6 |
HSP20-Gh-F |
TCACATCGTTTCCTTCACTTTCC |
|
HSP20-Gh-R |
TCACATCGTTTCCTTCACTTTCC |
|
|
7 |
WRKY40-Gh-F |
ACCATGCACGCCCTTCTCC |
|
WRKY40-Gh-R |
CCGTCCCCATACCCCTCTG |
|
|
8 |
UBQ7-Gh-F |
GAAGGCATTCCACCTGACCAAC |
|
UBQ7-Gh-R |
CTTGACCTTCTTCTTCTTGTGCTTG |
Table 2 Protein information of G. herbaceum JAZ gene
|
IDs |
Chromosome no. |
Amino acid length |
CDS (bps) |
Molecular weight (kDs) |
Theoretical pI |
GRAVY |
Chr. start location |
Chr. Stop location |
|
GheJAZ01 |
7 |
228 |
687 |
24519.71 |
5.69 |
-0.308 |
2047826 |
2049823 |
|
GheJAZ02 |
1 |
243 |
732 |
27131.76 |
9.51 |
-0.501 |
1734876 |
1736111 |
|
GheJAZ03 |
1 |
370 |
1113 |
39765.04 |
7.09 |
-0.23 |
85238576 |
85241064 |
|
GheJAZ05 |
3 |
127 |
594 |
21777.84 |
9.23 |
-0.484 |
9328352 |
9330057 |
|
GheJAZ08 |
5 |
240 |
723 |
25621.97 |
9.06 |
-0.452 |
3634525 |
3636194 |
|
GheJAZ09 |
5 |
229 |
690 |
24395.5 |
8.25 |
-0.353 |
3917289 |
3919746 |
|
GheJAZ10 |
5 |
257 |
774 |
28380.72 |
9.37 |
-0.812 |
13905856 |
13907429 |
|
GheJAZ11 |
5 |
119 |
360 |
13882.95 |
9.55 |
-0.821 |
14775872 |
14776782 |
|
GheJAZ13 |
6 |
263 |
792 |
28558.26 |
7.59 |
-0.536 |
21173486 |
21175193 |
|
GheJAZ04 |
8 |
252 |
759 |
27243.97 |
9.04 |
-0.465 |
131361658 |
131363064 |
|
GheJAZ14 |
10 |
120 |
363 |
13769.4 |
9.56 |
-0.994 |
3857610 |
3858361 |
|
GheJAZ07 |
12 |
825 |
2478 |
92420.43 |
9.29 |
-0.131 |
109749658 |
109755306 |
|
GheJAZ12 |
scaffold |
364 |
1095 |
39552.9 |
9.47 |
-0.374 |
68429 |
70524 |
|
GheJAZ06 |
scaffold |
270 |
818 |
29782.29 |
8.33 |
-0.703 |
68424 |
6982 |
Table 3 Logos of the two significant motifs
No competing interests reported.