Comprehensive Biomarkers of Soman (GD)-induced Chronic Toxicity: Proinflammatory Cytokines, Oxidative Stress, and Organ Function Parameters

doi:10.21203/rs.3.rs-5190446/v1

Download PDF

Research Article

Comprehensive Biomarkers of Soman (GD)-induced Chronic Toxicity: Proinflammatory Cytokines, Oxidative Stress, and Organ Function Parameters

https://doi.org/10.21203/rs.3.rs-5190446/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Organophosphate (OP) nerve agents, such as Soman (GD), pose a serious risk to neurological health due to their ability to inhibit acetylcholinesterase, which can result in seizures, epilepsy, and behavioral deficits. Despite acute treatments, the long-term consequences of exposure to OP agents, particularly neuroinflammation and systemic toxicity, remain inadequately understood.

Methods: This study used a Sprague dawley rat model to investigate the long-term effects of acute soman exposure (132 µg/kg, s.c) on neuroinflammation and systemic toxicity. Following exposure, animals were treated immediately with atropine sulfate (2 mg/kg, i.m) and oxime HI-6 (125 mg/kg, i.m) to control peripheral effects, and behavioral seizures were managed with midazolam (3 mg/kg, i.m) one hour later. The development of epilepsy was monitored through handling-induced seizures and EEG. At 18 weeks post-exposure, brain, serum, and cerebrospinal fluid (CSF) were collected under terminal anesthesia to assess neuroinflammatory markers and proinflammatory cytokines' gene expression in the brain, as well as cytokine protein levels in serum and CSF.

Results: All soman-exposed animals developed epilepsy, as confirmed by handling-induced seizures or EEG. Significant elevations of proinflammatory cytokines (TNF-α, IL-6, IL-1α, IL-18, IL-17A, and MCP1) were found in both serum and CSF, and corresponding gene expression increases were observed in the brain. Reactive nitrogen species (RNS) and reactive oxygen species (ROS) were significantly elevated in the serum of soman-exposed animals, though other blood biochemical parameters were similar to age-matched controls. No hematological changes were observed, indicating the inflammatory response originated in the brain. Elevated serum bilirubin and BUN levels indicated potential liver and kidney dysfunction, although no significant structural changes were detected in these organs.

Conclusions: This study identified key biomarkers of the chronic effects of soman exposure on the brain, blood, CSF, liver, and kidney. The findings suggest that monitoring liver and kidney function is crucial for survivors of nerve agent exposure or OP pesticide exposure suicides, and the identified biomarkers may assist in developing diagnostic and therapeutic strategies to mitigate long-term public health impacts.

Organophosphate Nerve agents

Soman

Oxidative stress

Proinflammatory cytokines

Chronic neurotoxicity

Peripheral biomarkers

Liver function

Kidney function.

Organophosphate nerve agents (OPNA) are a class of highly toxic chemical compounds that disrupt the nervous system's ability to transmit neurochemical signals. Due to the potent and volatile nature of the OPNAs, exposure can occur through inhalation, ingestion, or skin contact, with symptoms manifesting rapidly. Soman, also known as GD, is one such OPNA that was initially developed as an insecticide but now classified as a chemical warfare agent (Department of Health and Human Sciences 2003). It inhibits the acetylcholinesterase (AChE), an enzyme critical for nerve and muscle function, leading to the accumulation of acetylcholine (ACh) and overstimulation of neurons and muscles to initiate a range of neurological effects, including muscle twitching, seizures, and paralysis that can lead to respiratory failure and death (Gage et al. 2022; Vasanthi et al. 2023; National Research et al. 1999). The management of cholinergic symptoms and seizures resulting from acute exposure to OPNA is complex and requires atropine, an oxime, and higher doses of antiseizure agent such as, benzodiazepines (Jackson et al. 2019). Despite controlling the symptoms, long-term brain damage follows the OPNA exposure (Gage et al. 2022; Vasanthi et al. 2023) and may result in cognitive dysfunction (Hulse et al. 2019). Currently, there are no l biomarkers to monitor OPNA-induced toxicity and the disease progression.

Neuroinflammation, triggered by OPNA exposure, develops due to the activation of glial cells and the release of pro-inflammatory cytokines, which may exacerbate neuronal hyperexcitability and accelerate the development of epilepsy (Patel et al. 2019; Sharma et al. 2021). Reliable peripheral biomarkers from blood and cerebrospinal fluid (CSF) can be useful for early detection of neuroinflammation in nerve agent exposure (Vasanthi et al. 2023). Studies have identified increased levels of pro-inflammatory cytokines in patients with epilepsy, correlating with the frequency of epileptic seizures in humans and animal models (Vezzani et al. 2011). Additionally, reactive oxygen/nitrogen species generation have been linked to neuroinflammation following seizures (Meyer et al. 2023). These biomarkers aid in the diagnosis and may offer potential therapeutic targets to improve the management of nerve agent exposed survivors and provide insights into the pathophysiology of soman-induced epilepsy. Therefore, the identification of such markers is a step forward in the quest for precision medicine in the treatment of epilepsy and its associated complications in OPNA survivors.

OPNAs have been previously shown to be implicated in visceral organ toxicity and alter the complete blood count (CBC) (Greathouse et al. 2018). The liver can be affected due to its role in detoxifying chemicals and metabolizing drugs. The kidneys are also vulnerable as they filter blood and can accumulate toxic substances. Monitoring the liver and kidney function biomarkers can be a diagnostic tool and to prevent further injury to these vital organs. Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) are the liver enzymes that metabolize amino acids (Karami-Mohajeri et al. 2017). Elevated levels of ALT and AST in the blood may indicate liver dysfunction. Bilirubin, a byproduct of the breakdown of heme in the red blood cells, is an important biomarker of liver function. Creatinine, a waste product generated from muscle metabolism, is filtered out by the kidneys. Abnormal levels of creatinine in the blood suggest impaired kidney function. Blood urea nitrogen (BUN) is another indicator of kidney function. Elevated BUN levels can be a sign of kidney stress or damage. Together, these markers provide valuable insights into the health and functioning of the liver and kidneys (Gounden et al. 2018).

The studies on the effects of acute soman exposure on biochemical and hematological parameters are limited. The research conducted in 1990 and 2001 reported the short term effects of low to moderate doses of soman (30 and 90 µg/kg) on blood parameters in mice and rabbits (LEE and CLEMENT 1990; Baille et al. 2001). Furthermore, assessments of liver and kidney functions were not reported to determine the potential toxicological impact of soman. To date, there has been no comprehensive data from chronic study on blood biochemistry, complete blood count, and histopathological changes following an acute exposure to a high dose of soman (132 µg/kg, single exposure) that results in status epilepticus for > 40 min. In this study, adult rats were exposed to either vehicle or soman and euthanized at 18 weeks post-exposure. Fresh brain tissue for qPCR (cytokines gene expression analysis), CSF and serum for cytokines and nitrooxidative markers, and the whole blood were collected for complete blood count and biochemical analysis. ALT, AST, bilirubin, creatinine, and BUN levels in serum were evaluated for liver and kidney function. Liver and kidney tissues fixed with 4% paraformaldehyde were evaluated for microscopic pathological changes.

Animal source, care, and ethics statement

The adult male and female Sprague–Dawley rats (7–8 weeks old; 250–300 g; Charles River, USA) were used in the study. Males and females were housed in the same room but in individual cages with a 12-h light: dark cycle in an enriched environment. The experiments were conducted after 2–3 days of acclimatization as per the approved protocol by the Institutional Animal Care and Use Committee (IACUC protocol: 20–090) and complied with the NIH ARRIVE Guidelines for the Care and Use of Laboratory Animals. Soman exposure was done at MRI Global, Kansas City, MO, and all other experiments were conducted in Laboratory Animal Resources facility at Iowa State University. All animals were euthanized at the end of the study (18 weeks) with pentobarbital sodium and phenytoin sodium (100 mg/kg, i.p.) as per the American Veterinary Medical Associations Guidelines for euthanasia.

Soman exposure and standard of care with medical countermeasures

Experimental Design is illustrated in Fig. 1.

For this study we used 20 rats (10/sex) chosen randomly from a large cohort of 50 rats that were used for behavioral experiments and brain MRI during the course of 18 weeks study. Ten rats (5/sex) were either treated with vehicle (0.5% hydroxypropyl methylcellose and 0.1% tween 80) or soman (GD, 132 µg/kg, s.c. 1.2 × LD₅₀) followed by HI-6 (125 mg/kg, i.m.) and atropine sulfate (2 mg/kg, i.m.) within 1 min of soman exposure to minimize peripheral cholinergic effects and mortality. The anticonvulsant midazolam (3 mg/kg, i.m.) was administered 1-h post-soman exposure to control behavioral SE and mortality due to the severity of SE.

Euthanasia, Blood, CSF, and tissue collection

The blood and CSF were collected aseptically under terminal anesthesia for downstream analysis. Aliquots of 300 µL blood were collected in tubes containing ethylenediamine tetra-acetic acid (EDTA‐K2) and mixed by inversion for a complete blood count (CBC). The blood from different aliquots was centrifuged at 1000–1500 × g for 10 min to separate serum. Both serum and CSF were aliquoted and stored at – 80°C until further analysis. The fresh brain tissue collected was snap frozen in liquid nitrogen (LN2) and stored at -80°C. Liver and kidney tissues from animals perfused with 4% paraformaldehyde (PFA) were also collected and processed for Hematoxylin and Eosin staining for histological evaluation.

Hematological Parameters

CBC was performed in an automated ProCyte Dx Hematology Analyzer to measure the following parameters: red blood cell (RBC) count, hematocrit (HCT), hemoglobin, mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), red cell distribution width (RDW), reticulocytes, total white blood cells (WBC), neutrophils, lymphocytes, monocytes, eosinophils and basophiles. The minimum volume of 300 µL blood was used for CBC analysis. Refer to Supplementary table 1 for mean ± SEM values for all treatment groups.

Blood Biochemical Analysis

The serum samples were analyzed for alanine transaminase (ALT), aspartate transaminase (AST), bilirubin, blood urea nitrogen (BUN), and creatinine using IDEXX Catalyst Chemistry Analyzers. 10µL of serum was used per analyte. The serum sample, slides, and pipette tips were loaded into the sample drawer and run on the IDEXX VetLab Station. Refer to Supplementary table 2 for mean ± SEM values for all treatment groups.

RNA Isolation and qPCR

The total RNA was extracted from the brain tissue (cortex) using TRIzol reagent (Invitrogen, catalog # 15596-026) according to the instructions by the company. The RNA's purity was assessed with a NanoDrop spectrophotometer, considering an A260/A280 ratio in the range of 1.8 to 2.1, a suitable quality for subsequent analysis. 1 µg of the RNA was reverse transcribed (RT) to cDNA using the Superscript IV VILO Kit (Thermo Fisher Scientific, catalog#11766050) as per the protocol. The qPCR mix comprised of 5 µL of PowerUp SYBR Green Master mix (Thermo Fisher Scientific, catalog # 25742), 0.5 µL of forward and reverse primers (10 µM concentration), 3 µL of nuclease-free water, and 1 µL of the synthesized cDNA (1 to 10 ng) was used. The primer sequences from Integrated DNA Technologies were used for the qPCR (Table 1). β-actin served as the reference gene for all gene products. The cycle threshold (CT) values for the target gene products were normalized against the CT values of the reference gene. Group comparisons were conducted using the ΔCT approach, where the ΔCT for each sample was the difference between the CT of the target gene and β-actin. The average ΔCT of the control group was established as the calibrator, which was then deducted from the ΔCT of each sample within the control and experimental groups to calculate the ΔΔCT. Fold changes in gene expression were determined using the formula 2^−ΔΔCt, and the mean fold change was computed for each experimental group and compared between control and soman exposed samples.

Table 1

Primer sequences for qPCR
Sr no.	Primer name	Sequence	Sequence 5'-3'
1.	MCP1	Forward	TGTTCACAGTTGCTGCCTG
2.	MCP1	Reverse	GCCGACTCATTGGGATCATC
3.	TNFα	Forward	CAGACCCTCACACTCAGATCATCTTCT
4.	TNFα	Reverse	CCACTTGGTGGTTTGCTACGAC
5.	IL17A	Forward	AGTGAAGGCAGCGGTACT
6.	IL17A	Reverse	CTCAGAGTCCAGGGTGAAGTG
7.	IL-6	Forward	TAGTCCTTCCTACCCCAATTTCCAA
8.	IL-6	Reverse	TTGGTCCTTAGCCACTCCTTC
9.	IL18A	Forward	ACCACTTTGGCAGACTTCAC
10.	IL18A	Reverse	CTGGTCTGGGATTCGTTGG
11.	IL-1α	Forward	GGTAGTGAGACCGACCTCAT
12.	IL-1α	Reverse	GGTGCACCTGACTTTGTTCT
13.	β-actin	Forward	AAGTCCCTCACCCTCCCAAAAG
14.	β-actin	Reverse	AAGCAATGCTGTCACCTTCCC

Luminex assays for cytokine detection in serum and CSF

Customized MILLIPLEX® Rat Cytokine/Chemokine kit (Millipore Sigma, RECYTMAG-65K-08C) was used to assess the levels of TNF-α, IL-6, MCP-1, IL-1β, IL-1α, IL-18, IL-17A, and IL-10. 25 µL of the sample (serum or CSF) was added to 40 µL of primary antibody conjugated to magnetic microspheres, and incubated overnight at 4°C. After incubation, each well was triple-washed and incubated for 1 h with secondary antibodies. Lastly, after further washings, the streptavidin/phycoerythrin was added and incubated for 30 minutes. All samples were run in duplicates. A Bio-Plex plate reader (BIORAD) was used to read the 96-well plates following a proper gating to read cytokines of interest. A standard curve for all the cytokines was prepared using the standard cytokines, and the concentrations of cytokines detected in the samples were expressed as pg/mL.

Nitrite Assay

In the nitrite assay procedure, a 50 µL serum sample was dispensed into each well of a 96-well plate. This was followed by adding an equal volume of Griess reagent (Sigma-Aldrich) to each well. The mixture was then incubated for 10 at room temperature. Post incubation, the colorimetric changes were measured at an absorbance of 540 nm using the Synergy 2 multi-mode microplate reader (BioTek Instruments, USA). A calibration curve was determined using standard solutions, which was used to calculate the nitrite concentrations in the samples based on the optical density measured at 540 nm wavelength. Statistical analysis of the mean values across different groups was conducted using one-way ANOVA.

ROS Assay

The dichlorodihydro fluorescein (DCF) ROS/RNS Assay Kit, suitable for biofluids, culture supernatant, cell lysates (Abcam; Catalog#ab238535), was used to measure the levels of reactive oxygen species (ROS) in serum samples. The assay was conducted per the guidelines by the manufacturer. To quantify the ROS in the samples, their fluorescence values were compared against a pre-established H₂O₂ standard curve, with measurements taken at an excitation wavelength of 480 nm and an emission wavelength of 530 nm using the Synergy 2 multi-mode microplate reader (manufactured by BioTek Instruments, USA). The results were expressed as relative fluorescence units (RFUs).

Quantification of histopathological changes in the liver and kidney

Following perfusion, the liver and kidney tissue blocks were post-fixed in 4% paraformaldehyde for 24 hours, then submerged in 25% sucrose phosphate-buffered saline (PBS) for a minimum of three days at 4°C. Subsequently, the tissues were encased in a gelatin matrix (comprising 15% Type A Porcine gelatin, 7.5% sucrose, and 0.1% sodium azide in PBS, procured from Sigma, MO, USA) and maintained at 37°C for 3 hours before refrigerated overnight at 4°C. Post refrigeration, the gelatin-encased tissues were quickly frozen using liquid nitrogen-chilled 2-methyl butane. The solidified blocks were sectioned into 5 µm using a ThermoFisher cryostat, following the methodology outlined in our prior study (Puttachary et al. 2016). We collected five sections on each slide, which were pre-coated with chrome alum gelatin from Pfalz and Bauer, CT, USA, and stored at -20°C. Five sections from each organ per animal were processed for Hematoxylin and Eosin (H&E) staining. H&E stained sections were evaluated, and photomicrographs were taken using an Olympus BX43 trinocular microscope equipped with a DP27 camera and CellSens Standard Software (Olympus Corporation). Tissues were evaluated by a Board-certified veterinary anatomic pathologist (TA Harm) using a histopathologic scoring (HS) system with five independent scoring parameters. Few artifacts were identified (supplementary table 5) and excluded from the scoring. The parameters included were inflammation, tissue change (necrosis, proliferation), edema, and hemorrhage. Each parameter was scored on a scale ranging from 0 to 5, which indicated the percentage of tissue affected (Tables 2 and 3).

Table 2

Criteria for Histological evaluation
Score	Tissue affected
0	no tissue affected
1	1–15%
2	16–30%
3	31–45%
4	46–60%
5	> 60%

Table 3

Final interpretation based in total histopathological score
Final interpretation (total potential score = 29)
0 to 5	None to minimal change
6 to 10	Mild change
11 to 15	Moderate change
16 to 20	Moderate to severe change
21–29	Severe change

Rigor and Statistical Analysis

We had consulted a Biostatistician, Dr. Wang, College of Veterinary Medicine, Iowa State University, for the experimental design and statistical analyses for this study. The samples were randomized, and experimental groups were blinded until the data analysis was completed. We used GraphPad Prism 9.0 for statistical analysis. Where applicable, normality tests were performed using the Shapiro–Wilk test. Based on the normality of the data, t-test or Mann–Whitney test was applied to compare data between the two groups. The two-way ANOVA was used to detect significant interactions between sex and treatment effects with appropriate post hoc test for multiple comparisons across groups. Further statistical details are included in the figure legends.

Acute single exposure to soman, induced persistent long-term elevation of proinflammatory cytokines and chemokine gene expression in the rat brain.

The isolation of mRNA from the brain homogenates and qPCR analysis revealed a significant increase in proinflammatory cytokines TNF-α (Fig. 2A), IL-6 (Fig. 2B), IL-1α (Fig. 2C), IL-18 (Fig. 2D), IL-17A (Fig. 2E), and a chemokine MCP1 (Fig. 2F). This sustained increase in inflammation-related gene expression, triggered by a single exposure to soman, may lead to sustained elevation of their gene products in the CSF and serum.

Acute single exposure to soman induced persistent long-term proinflammatory cytokine/chemokine elevation in the rat CSF and serum

Multiplex assays of the CSF (Fig. 3A) and serum (Fig. 3B) demonstrated a significant increase in the levels of TNF-α, IL-6, IL-1α, IL-18, IL-17A, and MCP-1 at the 18-week compared to controls. Notably, the levels of these proinflammatory cytokines were significantly higher in the cerebrospinal fluid (CSF) than in the serum.

Elevated levels of reactive oxygen/nitrogen species in the rat serum indicate persistent long-term nitrooxidative stress after exposure to soman.

Further examination of the serum revealed a significant increase in serum nitrite (RNS indicator) (Fig. 4A) Reactive oxygen species (ROS) (Fig. 4B) at 18 weeks after acute exposure to soman compared to the control group.

Acute exposure to soman did not change hematological parameters at 18 weeks.

A comprehensive hematological analysis indicated no significant differences in the red blood cell count, reticulocyte count, hematocrit levels, hemoglobin concentration, mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), red cell distribution width (RDW), and platelet cell count between the soman-exposed and the control groups (Fig. 5A). A similar trend was observed in white blood cells including neutrophils, lymphocytes, monocytes, eosinophils, and basophils. There were no significant differences between the group exposed to soman and the control group (Fig. 5B). These findings suggest that the inflammatory response to soman is likely orchestrated by the central nervous system rather than the peripheral or systemic immune response.

Bilirubin levels in the serum were elevated at 18 weeks post soman exposure

At 18 weeks following exposure to soman, a significant increase in serum bilirubin levels was observed (Fig. 6A). However, there were no changes in the serum Alanine Aminotransferase (ALT) (Fig. 6B) and Aspartate Aminotransferase (AST) levels (Fig. 6C). The bilirubin is cleared in the liver. The high levels of bilirubin despite normal AST and ALT levels may suggest compromised hepatic function in the soman exposed group.

Soman exposure marginally increased BUN, but not creatinine levels at 18 weeks post soman exposure

The elevated serum BUN levels in the soman exposed rats, in contrast to the control group, was observed (Fig. 7A). However, the serum creatinine levels did not change (Fig. 7B). The BUN to Creatinine ratio was significantly higher in the soman treated rats (Fig. 7C). Elevated BUN levels and BUN: creatinine ratio suggest an early stage of kidney and liver dysfunction, and compromised renal filtration, which in the long term can affect these organs significantly.

Histopathology reveals no significant liver or kidney damage from Soman exposure at 18 weeks

Liver and kidney sections were examined microscopically to screen for evidence of damage associated with soman exposure. No statistically significant differences were observed in the liver or kidney parameters between the soman-treated group and the control group (Fig. 8I-L) (Supplementary table 3 and 4). The sections from each group received scores for focal inflammation (e.g., score 1, mononuclear cells and few neutrophils) and extra-medullary hematopoiesis (e.g., score 1, bi- to tri-lineage development). Focal inflammation in the liver and kidney and extra-medullary hematopoiesis can be observed as background lesions/artifacts (Supplementary table 5). These changes were interpreted as background in this study, as there was no statistical difference between scores. Histopathologic examination did not identify changes consistent with toxicity, inflammation, or necrosis in response to soman exposure in the liver and kidney samples.

Acute exposure to OPNAs have been known to cause classical cholinergic symptoms such as salivation, lacrimation, urination, defecation (SLUD) and seizures that can be controlled with atropine, oxime, and anti-seizure medication, and these could prevent death if administered soon after the exposure (Eddleston et al. 2004; Eddleston et al. 2002; Reddy and Reddy 2015). However, delayed treatment could prolong seizures and cause brain injury in the long-term despite treating with symptomatic drugs (Hillman et al. 2013). Experimental models of OPNA have confirmed that the majority of the animals that had seizures for > 20 min develop spontaneous seizures (Vasanthi et al. 2023; Sharma et al. 2018; Rao et al. 2022).

Acute OPNA effects are symptomatic while the long-term effects of acute exposure develop delayed symptoms and there are no diagnostic tests currently available. The brain structural and functional MRI from the rats, at 10 weeks post exposure to soman, demonstrated that the changes in brain are subtle in specific regions and these changes significantly correlated with behavioral dysfunction (Putra et al. 2024). Also, the brain histological changes such as reactive gliosis and neurodegeneration at 18 weeks post soman confirmed the MRI changes observed at 10 weeks post-exposure (Vasanthi et al. 2023). The serum and CSF from the same animals that were used for brain MRI and histology revealed a significant increase in proinflammatory cytokines and chemokines and nitrooxidative stressors implying the brain inflammation (Vasanthi et al. 2023).

While these readouts are robust and reliable for OPNA-induced long term effects, brain MRI and behavioral testing for a large population post-exposure can be expensive and impractical. Moreover, unlike in the experimental model, brain histology is not possible. While serum cytokines and oxidative stress analysis can be routinely performed, it does not differentiate between central and peripheral toxicity. Therefore, a comprehensive hematological and biochemical analysis of the blood may provide more information to determine the extent of OPNA-induced toxicity. Also, organophosphate exposure has been shown to affect the function of certain visceral organs, and could add a valuable screening tool to the long term OPNA toxicity (Karami-Mohajeri et al. 2017; Greathouse et al. 2018). In summary, the long-term effects of acute OPNA exposure on internal organs such as the liver and kidneys, as well as the characterization and identification of the source of serological inflammatory biomarkers, are not well-documented and warrant further investigation.

In this study, we demonstrate the brain as a potential source of the production of proinflammatory cytokines and nitrooxidative stressors that could be detected in the peripheral tissues such as CSF and serum. We also provide evidence for liver and kidney impairment as a long-term consequence to a single acute exposure to soman. Previously, there has been studies to identify potential biomarkers post OPNA exposure such as AChE/BChE concentrations in RBC, OPNA levels in the serum or plasma or its metabolites in urine (Mirbabaei et al. 2020; Jun et al. 2020). However, these tests are appropriate for a couple hours or days after the acute exposure to OPNA. Some studies suggest that biomonitoring of protein adducts using immune sensors may detect a low-level exposure within hours to a couple of days (Zhang et al. 2017a). In a recent study of VX exposure on rats, a serum albumin adduct, Cys³⁴(-DPAET)Pro, was detected in in-vivo specimens and showed a time dependent concentration increase after subcutaneous exposure in rats (Kranawetvogl et al. 2023). Since the average half-life of soman is about 9h (Moyer et al. 2014) and it gets cleared from the body within a couple of days in humans, there are no biomarkers to detect soman-induced effects beyond this point. Furthermore, considering the high basal metabolic rate in rats (Agoston 2017; McNab 1997), OPNAs clearance is even more faster.

As previously discussed, behavioral tests, brain MRI, EEG, and brain histology can be utilized to diagnose long-term central effects induced by OPNA in experimental models (Putra et al. 2024). However, there is no reliable peripheral biomarker that can be utilized for routine screening that can be identified in the serum or plasma, aside from cytokines and free radicals, following acute OPNA exposure. There is a significant gap in the information regarding the long-term comprehensive peripheral biomarkers for OPNA exposure. The previous studies have only investigated the early time points with subclinical doses of soman (Baille et al. 2001; LEE and CLEMENT 1990). A marked decrease in red blood cell counts and hematocrit levels was observed, suggesting increased hemolysis, in rabbits that were exposed to a low dose of soman (50µg/kg). The blood parameters were analyzed at 1, 2, 4, 24, and 48 hours post-exposure in this study (LEE and CLEMENT 1990). A substantial decline in cholinesterase levels, while an increase in creatinine phosphokinase activity was noticed at certain doses in the rabbit model. In the mouse model, low to moderate doses of soman (30–90 µg/kg) demonstrated reduced central cholinesterase activities which impacted motor function in a dose-dependent manner at 30 min, 24 h and 7 days after poisoning (Baille et al. 2001). Contrary to previous studies, we evaluated the prolonged effects of a substantial dose of soman (1.2XLD₅₀) on proinflammatory cytokines, nitrooxidative stress, and the liver and kidney functions. Furthermore, we also reported the long-term effects of soman on routine blood parameters. Such comprehensive evaluations can be useful to assess the efficacy of therapies.

We have previously demonstrated a significant increase in serum cytokines and nitrite levels at one week, two weeks, and six weeks post exposure in the rat DFP model, a surrogate for soman (Massey et al. 2023; Putra et al. 2020). In a soman rat model, we found a significant upregulation of cytokines and nitrite levels at 18 weeks post exposure (Vasanthi et al. 2023) validating the persistent cytokines and nitrite upregulation in OPNA models. However, in those studies, there was no evidence for the source of the cytokines and nitrooxidative stress markers. In this study, we demonstrate that their production is from brain, but not from the circulating leukocytes, as evident from concomitant increase in their gene expression (Fig. 2). Immunohistochemistry of brain sections for reactive glia markers (IBA1 + CD68 for reactive microgliosis and GFAP + C3 for reactive astrogliosis) and, inducible nitric oxide synthase (iNOS) suggested a significant increase of these markers in OPNA exposed animals at various time-points (Vasanthi et al. 2023; Massey et al. 2023; Putra et al. 2020)

Reactive glial cells are known to produce proinflammatory cytokines and chemokines (Vezzani et al. 2008; Zhang et al. 2017b; Stöberl et al. 2023) with a simultaneous increasing gene transcription (Trudler et al. 2021; Badanjak et al. 2021). Microglia, are the sensors of changes in the CNS microenvironment and are known to regulate the innate immune responses of astrocytes via microglia-astrocyte crosstalk (Tapia-Abellán et al. 2021). The astrocytes also form intimate connections with neurons and the blood vessels, thus they could detect neuronal damage and effectively regulate the inflammatory responses by modulating microglia (Minkiewicz et al. 2013; Tapia-Abellán et al. 2021). Reactive astrocytes are also known to produce MCP1 which acts on CCR2 receptors expressed by stressed neurons and reactive microglia. The elevated gene expression of proinflammatory cytokines in the brain and the increase in cytokine levels between in the CSF and serum imply that the source of inflammation is likely central rather than peripheral. The lack of significant changes in systemic hematological parameters in response to soman exposure further supports this finding. In a previous study, co-labeling of IBA1 with iNOS, and NeuN with 3NT in brain sections suggested reactive glia indeed upregulated iNOS, produced reactive nitrogen species, and nitrosylated proteins on their tyrosine residues (3NT) in neurons (Putra et al. 2020). Since the peripheral leukocyte counts or the ratio of various cell types did not change in soman-exposed animals compared to controls, it is likely that the nitro-oxidative stress markers also originated from the brain in soman exposed animals.

A comprehensive study based on data of the general population from the National Health and Nutrition Examination Survey (NHANES) found that exposure to OPNA is significantly associated with biomarkers of liver injury or liver function among the US adults (Li et al. 2022). Additionally, there is evidence suggesting that long-term exposure to organophosphate pesticides might lead to subclinical liver damage severe enough to affect liver function (Alvarez-Alvarez and Andrade 2023). Bilirubin, a byproduct of the breakdown of red blood cells, is an important marker of liver function. In this study, we found elevated serum bilirubin levels at 18-week post exposure which is a significant indicator of hepatic dysfunction and suggests potential hepatotoxic effects of soman. Thus, it is crucial to monitor serum bilirubin levels in individuals exposed to organophosphates. Elevated levels of ALT and AST in the blood indicate liver inflammation or altered liver function (Karami-Mohajeri et al. 2017). At the 18-week post-exposure to soman, animals showed stable serum ALT and AST levels, indicating that long-term liver function may not be severely affected by soman at the time point tested. The liver histology corroborated the serum biomarker findings, showing no significant pathological alterations in the soman-exposed group at 18 weeks. However, bilirubin levels in soman-exposed rats approached the higher end of the normal range and were markedly elevated compared to the control group (Fig. 6). This trend raises concerns and underscores the importance of monitoring, as bilirubin could potentially serve as an early indicator of soman toxicity. These findings suggest that histological changes typically precede functional impairments, given the significant rise in serum bilirubin levels among the soman-exposed subjects.

The pathogenesis of renal injury due to OPNA intoxication remains largely unknown, but it is likely that the damage occurs at the renal tubules (Rubio et al. 2012). Experimental and clinical studies have also revealed that exposure to organophosphate flame retardants (OPFRs) is associated with renal tubular toxicity and renal impairment (Tsai et al. 2023). BUN and creatinine levels are vital parameters for assessing the health of the kidney (Ferguson and Waikar 2012; Gounden et al. 2018). In our soman study, we observed unaltered serum creatinine levels along with a consistent rise in serum BUN (p = 0.0567) and a significantly higher BUN: creatinine ratio at 18 weeks post-exposure. Likely, microscopic examination of the kidney sections did not reveal pathology. These findings suggest the kidneys were unaffected by the soman exposure at the time-point tested. Such variations in BUN levels may indicate potential kidney issues or diminished renal efficacy as urea is increased earlier in renal disease (Gounden et al. 2023). Although these serum levels remained within the normal range, the regularity of these elevated BUN levels in the soman-treated rats is notable. This indicates towards a possibility of utilizing this pattern as an additional indicator for kidney dysfunction screening in chronic soman exposure model. These indicators are vital for healthcare providers to assess renal health and detect any exposure to organophosphorus nerve agents (OPNAs). Also, the persistent high levels of BUN and BUN to creatinine ratio in the blood suggest a strong possibility of developing microscopic alterations over time.

The findings from this study underscore the necessity to monitor various parameters that may manifest over an extended period post-exposure. While the study indicates that soman exposure does not significantly alter certain blood hematological parameters in rats, the increased serum bilirubin and BUN to creatinine ratio are intriguing. These hepatic and renal alteration warrant further investigation into how soman exposure might affect organ functions over time. The absence of significant hematological changes suggests that they are not appropriate indicators of brain inflammation. The absence of a broad peripheral immune response in the study aligns with soman's known mechanism of action, which primarily affects the nervous system rather than the immune system (Gage et al. 2022). Given the severity of acute soman poisoning in humans, the findings from the experimental models highlight the translational potential of the study outcomes to fully understand the implications of exposure in the long term to develop effective diagnostic tests and medical countermeasures. While extrapolating the results from experimental model to humans, one should consider the physiological and biochemical differences between the species (Clewell Iii and Andersen 1987) .

This study indicates that neuroinflammatory responses persist for at least 18 weeks following a single acute soman (LD₅₀X1.2) exposure. These responses are likely central (in the brain) rather than peripheral. Elevated gene expression of proinflammatory cytokines in the brain suggests chronic inflammation and the disparity in cytokine levels between cerebrospinal fluid (CSF) and serum further supports central inflammation. Peripheral white blood cell counts remain unchanged, indicating that soman exposure does not elicit a broad peripheral immune response and hematological parameters are almost unreliable for diagnostic purposes at later time points. Elevated serum bilirubin and creatinine levels were suggestive of an imminent chronic impact on liver and kidney function respectively. Thus, it could be utilized as a routine diagnostic readout for acute single exposure or a low-level continued soman exposure. However, ALT and AST levels remain stable. A positive trend in BUN to creatinine ratio also suggested kidney function impairment. Continued research is warranted to understand soman’s toxicological effects fully. Targeted therapies for CNS inflammation are crucial and caution is required when extrapolating findings to humans due to physiological differences and acute toxicity of soman.

Ethics approval and consent to participate

The experiments were conducted as per the approved protocols by the Institutional Animal Care and Use Committees (IACUC protocol: 23-114) and complied with the NIH ARRIVE Guidelines for the Care and Use of Laboratory Animals.

Consent for publication

All authors agreed to publish.

Data availability

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request and can also be accessed as supplementary information files.

Conflict of interest

The authors declare that they have no conflict of interests.

Funding

This study is supported by the National Institute of Health/NINDS CounterACT Grant U01 NS117284-01.

Author’s contributions

NM and SSV conducted experiments and analyzed the data. NM and TT contributed significantly to manuscript writing. NM and SSV performed data analysis and cross verified by TT. LGGL provided equipment for multiplex analysis. TH analyzed Liver and Kidney tissue and performed Histopathological scoring evaluation. TT conceptualized the project, wrote the grant, supervised the work, acquired funding and managed the project.

Agoston DV (2017) How to translate time? The temporal aspect of human and rodent biology. Frontiers in neurology 8:92
Alvarez‐Alvarez I, Andrade RJ (2023) Organophosphate pesticides: Another silent liver hazard? Liver International 43 (2)
Badanjak K, Mulica P, Smajic S, Delcambre S, Tranchevent L, Diederich N, Rauen T, Schwamborn J, Glaab E, Cowley S, Antony P, Pereira S, Venegas C, Gruenewald A (2021) iPSC-Derived Microglia as a Model to Study Inflammation in Idiopathic Parkinson's Disease. FRONTIERS IN CELL AND DEVELOPMENTAL BIOLOGY 9. doi:10.3389/fcell.2021.740758
Baille V, Dorandeu F, Carpentier P, Bizot J, Filliat P, Four E, Denis J, Lallement G (2001) Acute exposure to a low or mild dose of soman: Biochemical, behavioral and histopathological effects. PHARMACOLOGY BIOCHEMISTRY AND BEHAVIOR 69:561-569
Clewell Iii HJ, Andersen ME (1987) Dose, species, and route extrapolation using physiologically based pharmacokinetic models. Drinking Water and Health, Volume 8: Pharmacokinetics in Risk Assessment 8:159
Department of Health and Human Sciences C (2003) Facts About Soman.
Eddleston M, Buckley N, Checketts H, Senarathna L, Mohamed F, Sheriff M, Dawson A (2004) Speed of initial atropinisation in significant organophosphorus pesticide poisoning - A systematic comparison of recommended regimens. JOURNAL OF TOXICOLOGY-CLINICAL TOXICOLOGY 42:865-875. doi:10.1081/CLT-200035223
Eddleston M, Szinicz L, Eyer P, Buckley N (2002) Oximes in acute organophosphorus pesticide poisoning: a systematic review of clinical trials. Qjm 95 (5):275-283
Ferguson M, Waikar S (2012) Established and Emerging Markers of Kidney Function. CLINICAL CHEMISTRY 58:680-689. doi:10.1373/clinchem.2011.167494
Gage M, Rao NS, Samidurai M, Putra M, Vasanthi SS, Meyer C, Wang C, Thippeswamy T (2022) Soman (GD) Rat Model to Mimic Civilian Exposure to Nerve Agent: Mortality, Video-EEG Based <i>Status Epilepticus</i> Severity, Sex Differences, Spontaneously Recurring Seizures, and Brain Pathology. Frontiers in Cellular Neuroscience 15. doi:10.3389/fncel.2021.798247
Gounden V, Bhatt H, Jialal I (2018) Renal function tests.
Gounden V, Bhatt H, Jialal I (2023) Renal Function Tests.[Updated 2023 Jul 17]. StatPearls [Internet]; StatPearls Publishing: Treasure Island, FL, USA
Greathouse B, Zahra F, Brady MF (2018) Acetylcholinesterase inhibitors toxicity.
Hillman J, Lehtimäki K, Peltola J, Liimatainen S (2013) Clinical significance of treatment delay in status epilepticus. International journal of emergency medicine 6:1-7
Hulse E, Haslam J, Emmett S, Woolley T (2019) Organophosphorus nerve agent poisoning: managing the poisoned patient. BRITISH JOURNAL OF ANAESTHESIA 123:457-463. doi:10.1016/j.bja.2019.04.061
Jackson C, Ardinger C, Winter K, McDonough J, McCarren H (2019) Validating a model of benzodiazepine refractory nerve agent-induced status epilepticus by evaluating the anticonvulsant and neuroprotective effects of scopolamine, memantine, and phenobarbital. JOURNAL OF PHARMACOLOGICAL AND TOXICOLOGICAL METHODS 97:1-12. doi:10.1016/j.vascn.2019.02.006
Jun D, Bajgar J, Kuča K, Kassa J (2020) Monitoring of blood cholinesterase activity in workers exposed to nerve agents. In: Handbook of toxicology of chemical warfare agents. Elsevier, pp 1035-1045
Karami-Mohajeri S, Ahmadipour A, Rahimi H, Abdollahi M (2017) Adverse effects of organophosphorus pesticides on the liver: a brief summary of four decades of research. ARHIV ZA HIGIJENU RADA I TOKSIKOLOGIJU-ARCHIVES OF INDUSTRIAL HYGIENE AND TOXICOLOGY 68:261-275. doi:10.1515/aiht-2017-68-2989
Kranawetvogl T, Kranawetvogl A, Scheidegger L, Wille T, Steinritz D, Worek F, Thiermann H, John H (2023) Evidence of nerve agent VX exposure in rat plasma by detection of albumin-adducts in vitro and in vivo. ARCHIVES OF TOXICOLOGY 97:1873-1885. doi:10.1007/s00204-023-03521-4
LEE M, CLEMENT J (1990) EFFECTS OF SOMAN POISONING ON HEMATOLOGY AND COAGULATION PARAMETERS AND SERUM BIOCHEMISTRY IN RABBITS. MILITARY MEDICINE 155:244-249
Li W, Xiao H, Wu H, Xu X, Zhang Y (2022) Organophosphate pesticide exposure and biomarkers of liver injury/liver function. LIVER INTERNATIONAL 42:2713-2723. doi:10.1111/liv.15461
Massey N, Vasanthi SS, Samidurai M, Gage M, Rao NK, Meyer C, Thippeswamy T (2023) 1400 W, a selective inducible nitric oxide synthase inhibitor, mitigates early neuroinflammation and nitrooxidative stress in diisopropylfluorophosphate-induced short-term neurotoxicity rat model. Frontiers in Molecular Neuroscience 16. doi:10.3389/fnmol.2023.1125934
McNab BK (1997) On the utility of uniformity in the definition of basal rate of metabolism. Physiological Zoology 70 (6):718-720
Meyer C, Grego E, Vasanthi S, Rao N, Massey N, Holtkamp C, Huss J, Showman L, Narasimhan B, Thippeswamy T (2023) The NADPH Oxidase Inhibitor, Mitoapocynin, Mitigates DFP-Induced Reactive Astrogliosis in a Rat Model of Organophosphate Neurotoxicity. ANTIOXIDANTS 12. doi:10.3390/antiox12122061
Minkiewicz J, Vaccari J, Keane R (2013) Human astrocytes express a novel NLRP2 inflammasome. GLIA 61:1113-1121. doi:10.1002/glia.22499
Mirbabaei F, Mohammad-Khah A, Babri M, Naseri M (2020) Verification of exposure to sarin nerve agent through the chemical analysis of red blood cell samples. MICROCHEMICAL JOURNAL 158. doi:10.1016/j.microc.2020.105174
Moyer RA, Sidell FR, Salem H (2014) Soman.
National Research C, Division on E, Life S, Board on Environmental S, Subcommittee on Chronic Reference Doses for Selected Chemical Warfare A (1999) Review of the US Army's Health Risk Assessments for Oral Exposure to Six Chemical-Warfare Agents.
Patel D, Tewari B, Chaunsali L, Sontheimer H (2019) Neuron-glia interactions in the pathophysiology of epilepsy. NATURE REVIEWS NEUROSCIENCE 20:282-297. doi:10.1038/s41583-019-0126-4
Putra M, Sharma S, Gage M, Gasser G, Hinojo-Perez A, Olson A, Gregory-Flores A, Puttachary S, Wang C, Anantharam V, Thippeswamy T (2020) Inducible nitric oxide synthase inhibitor, 1400W, mitigates DFP-induced long-term neurotoxicity in the rat model. Neurobiology of Disease 133. doi:10.1016/j.nbd.2019.03.031
Putra M, Vasanthi SS, Rao NS, Meyer C, Van Otterloo M, Thangi L, Thedens DR, Kannurpatti SS, Thippeswamy T (2024) Inhibiting Inducible Nitric Oxide Synthase with 1400W Reduces Soman (GD)-Induced Ferroptosis in Long-Term Epilepsy-Associated Neuropathology: Structural and Functional Magnetic Resonance Imaging Correlations with Neurobehavior and Brain Pathology. Journal of Pharmacology and Experimental Therapeutics 388 (2):724-738
Puttachary S, Sharma S, Verma S, Yang Y, Putra M, Thippeswamy A, Luo DO, Thippeswamy T (2016) 1400W, a highly selective inducible nitric oxide synthase inhibitor is a potential disease modifier in the rat kainate model of temporal lobe epilepsy. Neurobiology of Disease 93:184-200. doi:10.1016/j.nbd.2016.05.013
Rao NS, Meyer C, Vasanthi SS, Massey N, Samidurai M, Gage M, Putra M, Almanza AN, Wachter L, Thippeswamy T (2022) DFP-Induced Status Epilepticus Severity in Mixed-Sex Cohorts of Adult Rats Housed in the Same Room: Behavioral and EEG Comparisons. Frontiers in Cell and Developmental Biology 10. doi:10.3389/fcell.2022.895092
Reddy SD, Reddy DS (2015) Midazolam as an anticonvulsant antidote for organophosphate intoxication—a pharmacotherapeutic appraisal. Epilepsia 56 (6):813-821
Rubio CR, Felipe Fernández C, Manzanedo Bueno R, Del Pozo BA, García JM (2012) Acute renal failure due to the inhalation of organophosphates: successful treatment with haemodialysis. Nephrology Dialysis Transplantation Plus 5 (6):582-583
Sharma S, Carlson S, Gregory-Flores A, Hinojo-Perez A, Olson A, Thippeswamy T (2021) Mechanisms of disease-modifying effect of saracatinib (AZD0530), a Src/Fyn tyrosine kinase inhibitor, in the rat kainate model of temporal lobe epilepsy. Neurobiology of Disease 156. doi:10.1016/j.nbd.2021.105410
Sharma S, Carlson S, Puttachary S, Sarkar S, Showman L, Putra M, Kanthasamy AG, Thippeswamy T (2018) Role of the Fyn-PKCδ signaling in SE-induced neuroinflammation and epileptogenesis in experimental models of temporal lobe epilepsy. Neurobiology of disease 110:102-121
Stöberl N, Maguire E, Salis E, Shaw B, Hall-Roberts H (2023) Human iPSC-derived glia models for the study of neuroinflammation. JOURNAL OF NEUROINFLAMMATION 20. doi:10.1186/s12974-023-02919-2
Tapia-Abellán A, Angosto-Bazarra D, Alarcón-Vila C, Baños M, Hafner-Bratkovic I, Oliva B, Pelegrín P (2021) Sensing low intracellular potassium by NLRP3 results in a stable open structure that promotes inflammasome activation. SCIENCE ADVANCES 7. doi:10.1126/sciadv.abf4468
Trudler D, Nazor K, Eisele Y, Grabauskas T, Dolatabadi N, Parker J, Sultan A, Zhong Z, Goodwin M, Levites Y, Golde T, Kelly J, Sierks M, Schork N, Karin M, Ambasudhan R, Lipton S (2021) Soluble α-synuclein-antibody complexes activate the NLRP3 inflammasome in hiPSC-derived microglia. PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA 118. doi:10.1073/pnas.2025847118
Tsai K-F, Lee W-C, Lee C-T, Kung C-T (2023) # 6546 renal tubular toxicity of organophosphate flame retardants in patients with chronic kidney disease. Nephrology Dialysis Transplantation 38 (Supplement_1):gfad063d_6546
Vasanthi SS, Rao NS, Samidurai M, Massey N, Meyer C, Gage M, Kharate M, Almanza A, Wachter L, Mafuta C, Trevino L, Carlo AM, Bryant E, Corson BE, Wohlgemuth M, Ostrander M, Showman L, Wang C, Thippeswamy T (2023) Disease-modifying effects of a glial-targeted inducible nitric oxide synthase inhibitor (1400W) in mixed-sex cohorts of a rat soman (GD) model of epilepsy. Journal of Neuroinflammation 20 (1). doi:10.1186/s12974-023-02847-1
Vezzani A, Maroso M, Balosso S, Sanchez MA, Bartfai T (2011) IL-1 receptor/Toll-like receptor signaling in infection, inflammation, stress and neurodegeneration couples hyperexcitability and seizures. Brain Behav Immun 25 (7):1281-1289. doi:10.1016/j.bbi.2011.03.018
Vezzani A, Ravizza T, Balosso S, Aronica E (2008) Glia as a source of cytokines: Implications for neuronal excitability and survival. EPILEPSIA 49:24-32. doi:10.1111/j.1528-1167.2008.01490.x
Zhang W, Guo Z, Chen Y, Cao Y (2017a) Nanomaterial based biosensors for detection of biomarkers of exposure to op pesticides and nerve agents: A review. Electroanalysis 29 (5):1206-1213
Zhang Z, Jiang B, Gao Y (2017b) Chemokines in neuron-glial cell interaction and pathogenesis of neuropathic pain. CELLULAR AND MOLECULAR LIFE SCIENCES 74:3275-3291. doi:10.1007/s00018-017-2513-1

No competing interests reported.

Additionalfle1.pdf

Download PDF

Version 1

posted

You are reading this latest preprint version

Comprehensive Biomarkers of Soman (GD)-induced Chronic Toxicity: Proinflammatory Cytokines, Oxidative Stress, and Organ Function Parameters

Status:

Version 1

Abstract

Figures

Introduction

Methods

Animal source, care, and ethics statement

Soman exposure and standard of care with medical countermeasures

Euthanasia, Blood, CSF, and tissue collection

Hematological Parameters

Blood Biochemical Analysis

RNA Isolation and qPCR

Luminex assays for cytokine detection in serum and CSF

Nitrite Assay

ROS Assay

Quantification of histopathological changes in the liver and kidney

Rigor and Statistical Analysis

Results

Bilirubin levels in the serum were elevated at 18 weeks post soman exposure

Soman exposure marginally increased BUN, but not creatinine levels at 18 weeks post soman exposure

Histopathology reveals no significant liver or kidney damage from Soman exposure at 18 weeks

Discussion

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1