Claudin-1 as a potential marker of stress-induced premature senescence in vascular smooth muscle cells

doi:10.21203/rs.3.rs-5192437/v1

Download PDF

Research Article

Claudin-1 as a potential marker of stress-induced premature senescence in vascular smooth muscle cells

https://doi.org/10.21203/rs.3.rs-5192437/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Cellular senescence, a permanent state of cell cycle arrest, can result either from external stress and is then called stress-induced premature senescence (SIPS), or from the exhaustion of cell division potential giving rise to replicative senescence (RS). Despite numerous biomarkers distinguishing SIPS from RS remains challenging. We propose claudin-1 (CLDN1) as a potential cell-specific marker of SIPS in vascular smooth muscle cells (VSMCs). In our study, VSMCs subjected to RS or SIPS exhibited significantly higher levels of CLDN1 expression exclusively in SIPS. Moreover, nuclear accumulation of this protein was also characteristic only of prematurely senescent cells. ChIP-seq results suggest that higher CLDN1 expression in SIPS might be a result of a more open chromatin state, as evidenced by a broader H3K4me3 peak in the gene promoter region. However, the broad H3K4me3 peak and relatively high CLDN1 expression in RS did not translate into protein level, which implies a different regulatory mechanism in this type of senescence. Elevated CLDN1 levels were also observed in VSMCs isolated from atherosclerotic plaques, although this was highly donor dependent. These findings indicate that increased CLDN1 level in prematurely senescent cells may serve as a promising cell-specific marker of SIPS in VSMCs, both in vitro and ex vivo.

senescence

VSMC

CLDN1

ANLN

SIPS

atherosclerosis

Every year cardiovascular diseases remain the primary cause of death globally. The cardiovascular morbidities include hypertension, heart attack, and stroke. At the core of these conditions may lie the development of atherosclerosis – an inflammatory disease of the arteries that leads to the narrowing of the vessel lumen due to formation of atherosclerotic plaques. Multiple studies have shown that the plaque is composed of vascular smooth muscle cells that exhibit many features associated with cellular senescence [1]. Cellular senescence is defined as an irreversible cell cycle arrest and can arise due to either exhaustion of replication potential (replicative senescence - RS) or exposure to various external triggers (stress-induced premature senescence – SIPS). Both RS and SIPS display plenty of common characteristics which are best epitomized by an increased level of senescence-associated β-galactosidase (SA β-gal) activity, higher p53, p21, p16 or lower Ki67 and lamin B1 expression at the protein level [2]. Nevertheless, up to this day there is no clear marker that could be used to distinguish SIPS from RS.

Claudin-1 (CLDN1), along with other 23 claudins, occludins, junctional adhesion molecules (JAM) and zonula occludens-1 (ZO-1) proteins, forms tight junctions between cells, and its main function lies in controlling epithelial permeability [3]. By interacting both with proteins involved in forming the tight junctions and with actin in the cytoskeleton, CLDN1 can influence cell organization and its ability to migrate [4–6]. In addition, claudins play a crucial role in maintaining normal cell membrane polarity, in cell differentiation and organismal development [7]. Claudin-1 is commonly found in the endothelial cells of blood vessels (especially those forming the blood-brain barrier) [8], epidermis [9] or in cells of the epithelium lining the gastrointestinal tract [10]. However, little is known about the role of CLDN1 in vascular smooth muscle cells [4, 11–12], especially in the context of senescence, even though the alternative name of CLDN1 is senescence-associated epithelial membrane protein 1 (SEMP1), as the first paper described its mRNA upregulation in senescent cells [13, 14].

In this study, we present our results exploring the role of CLDN1 in senescent VSMCs. We applied our previously established experimental setup [15–17] to analyze differences in the transcriptomic profile of senescent VSMCs, and we selected CLDN1 for further analysis as it was significantly upregulated only in cells undergoing SIPS. We have characterized the gene and protein expression profile and analyzed CLDN1 localization in the cell. Moreover, we looked closely into the chromatin regulatory mechanisms and revealed an open chromatin state in the promoter region of the CLDN1 gene characterized by an enrichment in a broader H3K4me3 peak in senescent cells. An expanded experimental setup, which included an additional senescence-inducing agent, and both quiescent and confluent cells, confirmed CLDN1 upregulation in SIPS cells, thus prompting us to test CLDN1 as a promising SIPS marker in cells isolated from atherosclerotic plaques. Our data allow us to introduce CLDN1 as the first cell-specific marker that can help to distinguish SIPS from RS.

2.1. Cell culture

Human vascular smooth muscle cells (VSMCs), for in vitro culture, were purchased from ATCC (PCS-100-012) and Gibco (C0075C), and were from at least three different young male donors. VSMCs were cultured in vascular cell basal medium (ATCC) supplemented as defined by the manufacturer. Smooth muscle cells isolated from atherosclerotic plaques were obtained from patients who underwent carotid endarterectomies. Tissues were cleaned of blood and calcified parts and cut into 1–2 mm² fragments. The explants were placed in DMEM on selective dishes, that is gelatin-coated plates (Biocoat Gelatin Cellware, Corning), allowing smooth muscle cells to adhere. The explants remained in culture up to 30 days, until cells reached the confluency. Then cells were passaged once, seeded at a density of 4,000 cells/cm² in vascular cell basal medium for 24 hours and collected for subsequent analysis. Cells were cultured in a humidified atmosphere in the presence of 5% CO₂ at 37°C.

2.2. Cell treatment

To induce premature senescence (SIPS), VSMCs were seeded at the density of 4,000 cells/cm² and after 24 hours treated with 100 nM doxorubicin (Sigma-Aldrich, DOX), 7.5 µM curcumin (Cayman, CUR) or 150 µM H₂O₂ (Sigma-Aldrich). Treated cells were incubated for 7 days and analyzed. Quiescent cells were cultured in media without FBS for 7 days with regular medium change and analyzed. To obtain cells undergoing replicative senescence (RS), VSMCs were passaged every 3–4 days (when confluency reached 80–90%) until they lost proliferative potential. Young cells on early passages were used as a control (CTRL). Moreover, control and RS cells were analyzed in two additional variants: seeded at the regular density (4,000 cells/cm², designated as “CTRL” or “RS”, respectively) and at confluency over 90% (> 9,000 cells/cm², designated as “CTRL Conf.” or “RS Conf.”) and analyzed 24 hours after seeding. Cells in all experimental variants were tested for SA-β-galactosidase activity and bromodeoxyuridine incorporation to assess senescence.

2.3. Bromodeoxyuridine (BrdU) incorporation assay

The cell's capacity to replicate DNA was evaluated using the BrdU incorporation assay. BrdU (Sigma-Aldrich) was added to the culture medium at a concentration of 10 µM for 24 hours. Next, the cells were fixed in ice-cold 70% ethanol and stored at -20°C for at least 24 hours. Cells were then immunostained with a primary anti-BrdU antibody (1:100, Becton Dickinson) followed by a secondary Alexa Fluor 488-conjugated antibody (1:500, ThermoFisher Scientific). DNA was counterstained with DAPI (1 µg/ml). The percentage of dividing cells was determined by calculating the proportion of BrdU-positive cells among all DAPI-stained nuclei.

2.4. Senescence-Associated β-Galactosidase (SA β-Gal) assay

Cells were stained following the method described by Dimri et al. [18]. After fixation with a fixing solution (2% formaldehyde and 0.2% glutaraldehyde in PBS), the cells were washed and incubated in staining buffer (5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 150 mM NaCl, 2 mM MgCl2, 0.02 M phosphate buffer, and 1 mg/ml X-Gal, pH 6.0) overnight at 37°C in the dark and without carbon dioxide exposure. Nuclei were counterstained with DAPI (1 µg/ml). The cells were then analyzed using a Nikon Eclipse Ti fluorescent microscope. The results are presented as the percentage of cells with increased enzyme activity (blue color) relative to the total number of cells (based on DAPI-stained nuclei).

2.5. RNA isolation

Trypsinized VSMCs were stored in RNAlater solution (ThermoFisher Scientific) in -80°C and RNA was isolated with the MagNA Pure Total Isolation kit (Roche) compatible with automated MagNA Pure 24 System (Roche) according to the manufacturer’s instructions. The quality of the obtained RNA was electrophoretically tested using the 2100 Bioanalyzer and the RNA 6000 Nano Kit (Agilent), and the concentration was evaluated with NanoDrop 2000 (ThermoFisher Scientific).

2.6. DNA microarrays

Transcriptomic analysis was performed using the Affymetrix Gene Atlas System according to the manufacturer’s instructions. Briefly, 250 g of VSMCs RNA from 4 experimental variants (CTRL, CUR, DOX, RS) was used for target preparation using the GeneChip™ WT PLUS Reagent Kit (ThermoFisher Scientific). The prepared samples were then hybridized to Affymetrix™ HuGene 2.1 ST Array Strips (Affymetrix, Santa Clara, CA, USA). After washing and staining, the arrays were scanned in the GeneAtlas Imaging Station (Affymetrix), generating .CEL files as the data output. Data analysis was conducted using Transcriptome Analysis Console (TAC) software (ThermoFisher Scientific). Probes signal intensities were normalized with using the RMA (Robust Mulit-array Average) method and, after quality control, one-way ANOVA was applied to determine differentially expressed genes (DEGs) between treated cells and control. To minimize the variability originating from different sample preparation dates in a comparison analysis, batch effect in TAC was applied. The criteria for selecting DEGs were fold change ≤ − 1.3 and ≥ 1.3, and p value ≤ 0.05.

2.7. qPCR

RNA obtained as described in Chap. 4.4 was reverse transcribed with the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) according to the instructions under the following amplification conditions: 10 min at 25°C, 15 min at 50°C, 5 min at 85°C. The gene expression profile was evaluated with real-time PCR using the LightCycler 480 SYBR Green I Master (Roche) and LightCycler 480 Instrument (Roche). Reaction conditions consisted of 10 min at 95°C and 40 cycles of 10 sec at 95°C, 10 sec at 59°C and 30 sec at 72°C. Primers for

GAPDH (F: GAGTCAACGGATTTGGTCGT, R: TTGATTTTGGAGGGATCTCG),

EIF2B (F: CACTGCCCCTTCCTTAATCA, R: AGCTACTCACCCTGCCTCAA)

DAD1 (F: CAGTTCGGTTACTGTCTCCTCG, R: GGAGATGCCTTGGAAATCCGCT),

ANLN (F: TCAAGCTAGCCAGGCTCTTA, R: CTGAGGTCCTTCGTTCTTCA),

CLDN1 (F: GCGCGATATTTCTTCTTGCAGG, R: TTCGTACCTGGCATTGACTGG) were purchased from Real Time Primers, LLC. GAPDH, EIF2B and DAD1 were selected based on the microarray data and used as reference genes. Gene expression levels of ANLN and CLDN1 were analyzed by the Pfaffl method [19].

2.8. Protein fraction isolation

Cytoplasmic and nuclear fractions were isolated using the NE-PER Nuclear and Cytoplasmic Extraction Kit (ThermoFisher Scientific) according to the manufacturer’s instructions. The purity was controlled using GAPDH for the cytoplasmic fraction and HDAC1 for nuclear fraction. 5 µg of protein was loaded onto the gel.

2.9. Western blotting

Whole-cell protein lysates were prepared using Laemmli buffer. After electrophoretic separation proteins were transferred to nitrocellulose membrane and blocked in 5% non-fat milk in TBS containing 0.1% Tween-20 for 1 hour. Then, membranes were incubated at 4°C overnight with primary antibodies anti-ANLN (Abcam, ab211872, 1:1000), anti-CLDN1 (Abcam, ab15098, 1:50), anti-GAPDH (Millipore, MAB374, 1:150000), anti-LMNB1 (Santa Cruz, sc-365962, 1:500) anti-HDAC1 (Abcam, ab19845, 1:1000). Then, membranes were incubated with horseradish peroxidase-conjugated secondary antibody (Dako, 1:2000) in milk, washed and developed with ECL (ThermoFisher Scientific). Protein levels were normalized to GAPDH and shown as a relative fold change compared to the control.

2.10. Chromatin immunoprecipitation coupled with sequencing (ChIP-seq)

Chromatin immunoprecipitation was performed using the iDeal kit for histones (Diagenode) following the manufacturer’s instructions. Here briefly: 3 million of VSMCs were trypsinized, suspended in PBS and fixed with 1% methanol-free formaldehyde for 1 minute (CTRL), 2 minutes (DOX and CUR) or 3 minutes (RS). Next, formaldehyde was quenched with 0.125 M glycine for 5 minutes at room temperature, the cells were washed with PBS and lysed at 4°C. Chromatin was sheared using the Bioruptor Plus (Diagenode) with a built-in cooling system set at 4°C. Cells were sonicated at high power mode for 40 cycles (30s ON, 30s OFF) (CTRL) or 30 cycles (DOX, CUR, and RS). Sonication efficiency was controlled using a 2100 Bioanalyzer and a High Sensitivity DNA kit (Agilent). Next, 7.5 × 10⁵ cells were immunoprecipitated overnight at 4°C in dedicated buffers, using Protein A-coated magnetic beads and antibodies recognizing H3K4me3 (1 µg, Diagenode, C15410003) and H3K9me3 (1,5 µg, Diagenode, C15410193). After subsequent washing, chromatin was eluted and decrosslinked overnight at 65°C with shaking. Finally, DNA was precipitated with magnetic beads and quantified using a Qubit dsDNA HS kit (Invitrogen). Immunoprecipitation was assessed by qPCR using LightCycler® 480 SYBR Green I Master (Roche) and the following amplification conditions: 10 min at 95°C and 40 cycles of 30 sec at 95°C, 30 sec at 60°C, 30 sec at 72°C.

The library was prepared from 3 ng of material using the KAPA HyperPrep Kit and compatible KAPA Unique Dual-Indexed Adapter Kit (KAPA Biosystems) according to the manufacturer's instructions. The library quality was assessed using a 2100 Bioanalyzer and a High Sensitivity DNA Analysis kit (Agilent), and the quantity was measured using qPCR using the KAPA Library Quantification kit (KAPA Biosciences).

Raw reads were trimmed using the Trimmomatic software [20]. Trimmed sequences were mapped to the human reference genome provided by ENSEMBL, (GRCh38) using Bowtie2 [21] with default parameters. Duplicate reads were identified and removed using MarkDuplicates tool from the GATK package (version 4.2.3.0) [22] with default parameters except OPTICAL_DUPLICATE_PIXEL_DISTANCE set to 12000. Peaks were detected with MACS2 [23]. To account for variability between replicates, reads overlapping each peak detected by MACS2 were counted, separately in each replicate, with summarizeOverlaps tool from GenomicAlignments library. Resulting counts were used by edgeR [24] to select locations with reproducible binding patterns across all replicates. Peaks were visualized using IGV software.

2.11. Immunofluorescence

Cells were seeded at 4000 cells/cm2 density and incubated according to the experimental variant. Next, cells were fixed with 4% paraformaldehyde for 15 minutes and stored in 70% ethanol at -20°C. After washing in PBS, cells were permeabilized for 10 minutes in PBS with 0.5% Triton, blocked for 10 minutes in PBS with 2% BSA, 1.5% Goat Serum and 0.5% Triton (blocking buffer), and incubated for 2 hours with primary antibody specific for ANLN (Sigma, HPA050556, 1:250) and CLDN1 (Abcam, ab15098, 1:100) dissolved in blocking buffer. Next, cells were washed and incubated with a secondary antibody conjugated with fluorescent AlexaFluor® dye (ThermoFisher Scientific, A-11008, 1:500) dissolved in PBS for 1 hour. Nuclei were stained for 15 minutes with DAPI. Finally, slides were mounted in a drop of Fluoromount G (Invitrogen) and scanned using an Eclipse Ti fluorescent microscope (Nikon) under 20× or 40× magnification. Detailed images of ANLN foci were captured using an SP8 confocal microscope (Leica) with 63× immersion objective.

2.12. Statistical analysis

All experiments were performed at least in three replicates for all experimental conditions. Results are presented as mean with standard deviation, unless stated otherwise. Normality was checked using Shapiro-Wilk test, and statistical analysis was performed using One-way ANOVA with Dunnett’s post hoc test in GraphPad Prism software, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. The following software were used to prepare the figures: ImageJ, GraphPad, Excel, clusterman in Python, Transcriptome Analysis Console (TAC) and Instant Clue.

3.1. Claudin-1 is highly expressed in SIPS but not in RS cells

To induce senescence in VSMCs we applied our established protocol, i.e. cells were treated with 100 nM doxorubicin (induction of DNA damage) and 7.5 µM curcumin (DNA-damage independent) for 7 days, while replicative senescence was achieved after several cell passages until cells ceased to divide and were harvested 24h after seeding. The senescence process was monitored using typical markers including BrdU incorporation, SA β-gal staining intensity and lamin B1 level. The results presented in Fig. 1 confirm an effective senescence induction (Fig. 1).

Next, the transcriptomic profiles of SIPS and RS cells were examined using DNA microarrays, with results compared to young cells and presented as log2 ratio. Our primary goal was to identify differences between these two types of senescence, and to find potential markers characteristic of SIPS, regardless of the inducing agent. Among the differentially expressed genes in SIPS cells, CLDN1 stood out the most, with over a tenfold higher expression in doxorubicin-treated cells and a fourfold increase in curcumin-treated cells, while no significant changes were observed in RS cells. Furthermore, microarray data indicated that CLDN1 was the only gene of the claudin family expressed at such a high level in senescent cells (Fig. 2A). To verify this observation, we analyzed CLDN1 expression using qPCR (Fig. 2B). While the trend observed in SIPS was confirmed, RS cells exhibited a two times higher mRNA level compared to control. However, this increase was not reflected at the protein level, where elevated CLDN1 expression was detected only in SIPS cells (Fig. 2C). To investigate the impact of chromatin state on the gene expression strength, which subsequently translates into protein expression, we analyzed the CLDN1 coding region using chromatin immunoprecipitation followed by sequencing (ChIP-seq) (Fig. 2D). Chromatin was immunoprecipitated with antibodies against H3K4me3 (trimethylated lysine 4 on histone H3), a marker of active chromatin, and H3K9me3 (trimethylated lysine 9 on histone H3), a marker of condensed and inactive chromatin. In young cells, a relatively narrow (1646 bp) H3K4me3 peak in the promoter region was detected, whereas in both SIPS (CUR and DOX) and RS cells, the peaks were broader compared to control (3078, 2295 and 2354 bp, respectively). This suggests more open chromatin, potentially influencing higher mRNA expression in SIPS and RS cells comparing to control. However, the low protein expression in RS indicates another type of regulation of claudin-1 gene expression, perhaps posttranscriptional, which is currently under investigation. Regarding the H3K9me3 mark, no significant enrichment changes in the proximity to or in the gene coding region were observed under any experimental conditions. Immunofluorescent staining analysis revealed an increased CLDN1 signal in the nuclei of SIPS cells, in contrast to young and RS cells. In young and RS cells the protein was predominantly localized in the cytoplasm (Fig. 2E), though the signal intensity in RS was significantly lower compared to the control. This trend was confirmed by Western blot analysis of nuclear and cytoplasmic protein fractions (Fig. 2F). It was observed that CLDN1 was also present in the cytoplasm of SIPS cells; however, the predominant nuclear localization of CLDN1 seems to be a distinctive feature only of SIPS. The GAPDH and HDAC1 proteins were used to control cytoplasmic and nuclear fraction quality, respectively.

3.2. Anillin as a marker of non-proliferating cells

The hallmark feature of cellular senescence is the permanent cell cycle arrest. Again, based on microarray data, we identified anillin (ANLN) as a marker of nonproliferating cells, evidenced by significantly reduced transcript levels measured by microarrays and qPCR in both types of senescence (Fig. 3A and B), a finding corroborated at the protein level (Fig. 3C). Anillin, a crucial protein in cytokinesis, plays a central role in the formation of the contractile ring and works in conjunction with actin to facilitate the separation of newly formed cells. Additionally, ANLN can be observed in the cell nucleus; however, since its discovery, its role has not been fully understood [25]. In our experiments, immunofluorescence staining confirmed the presence of ANLN in cell nuclei across all tested conditions, with senescent cells exhibiting significantly reduced signal intensity (Fig. 3D). Furthermore, in a subset of SIPS cells, characteristic ANLN foci were detected, which were absent in young cells. Similar foci, albeit less intense, were also occasionally observed in RS cells, though this phenomenon was rare (Fig. 3E).

3.3. An increase in CLDN1 expression is independent of cell confluence and reversible cell cycle arrest

To confirm that CLDN1 is highly expressed only in SIPS cells, we tested its protein level in additional experimental conditions. These included cells treated with another premature senescence-inducing agent, i.e. H₂O₂ (oxidative stress-induced senescence), in quiescent cells (temporary halt of divisions), and confluent young and RS cells (contact inhibition). The excess of reactive oxygen species (ROS) contributes to VSMC senescence in developing atherosclerotic plaques [26]. Increased ROS production results in damaged macromolecules and can cause DNA damage as well as telomere shortening and erosion [27]. To elevate ROS levels and induce oxidative stress in cells we applied hydrogen peroxide in a manner specified in our previously published studies [28, 29]. To rule out the influence of cell cycle arrest, we analyzed the protein levels in quiescent cells. Quiescence was achieved by culturing cells in a frequently changed medium without fetal bovine serum (FBS) for 7 days, causing a temporary halt in the G0 growth phase [30]. Such cells can resume division upon reintroduction of FBS into the medium. As it was mentioned, claudins are transmembrane proteins that form tight junctions that connect adjacent cells to create a selectively permeable barrier. During senescence, cell surface area increases significantly, and we observed that in some cases, SIPS cells clustered into multi-cell structures, a phenomenon less frequently seen in RS cells. To exclude the influence of increased contact between cells in SIPS on higher CLDN1 expression, we seeded young and RS cells at normal (4,000 cells/cm²) and higher density (> 9,000 cells/cm²) to achieve over 90% confluence and enforce contact between cells. Such cells were analyzed 24h after seeding. In this new experimental setup, for senescence validation at the protein level, we additionally used anillin as a marker of non-proliferating cells and lamin B1, whose reduced expression serves as a universal marker of senescence. High anillin expression was detected only in young control cells, with no signal observed in non-proliferating cells (SIPS, quiescent and RS). Lamin B1 exhibited high expression in young cells (both regular and confluent) and was also detectable in quiescent cells, confirming that these cells were not senescent. This experimental setup demonstrated that elevated claudin-1 expression was detected solely in prematurely senescent cells treated with curcumin, doxorubicin or hydrogen peroxide. Although no statistical significance was noted for the H₂O₂-treated cells, a high level of CLDN1 protein was observed in every experiment. In contrast, CLDN1 protein expression in young, quiescent, and replicatively senescent cells was either very low or undetectable (Fig. 4B).

3.4. CLDN1 as a potential marker in ex vivo evaluation of cellular senescence type

Based on promising preliminary results obtained using VSMCs in vitro, we decided to use claudin-1 as a stress-induced premature senescence (SIPS) marker in ex vivo cells isolated from atherosclerotic plaques (AP). Additionally, to evaluate the proliferative capacity of these cells, we used anillin as a cell proliferation marker. AP cells were obtained from six different donors, seeded at a density of 4,000 cells/cm², and collected after a 24-hour incubation. Claudin-1 and anillin levels in AP cells were compared to those in young, prematurely and replicatively senescent VSMCs in vitro (the setup described in 2.1.). The results indicated that cells obtained from all donors consisted mostly of non-proliferating cells, as evidenced by the absence of ANLN bands in Western blotting analyses. Regarding CLDN1 expression, however, each sample required individual analysis. The most significant increase in CLDN1 expression was observed in cells from donor 3 and 4, closely resembling VSMCs treated with doxorubicin and curcumin. Given the concurrent decrease in anillin expression, it is likely that these cells predominantly underwent premature senescence. A slight increase in protein expression in cells from donors 1 and 2 suggests the presence of cells undergoing premature senescence, although their proportion within the whole cell population may be relatively small. A larger proportion of these cells may be replicatively senescent. In contrast, cells from donors 5 and 6 did not exhibit detectable levels of either CLDN1 or ANLN. This protein expression pattern is consistent with that observed in VSMCs undergoing replicative senescence, and it can be argued that cells from donors 5 and 6 primarily underwent replicative senescence.

Increased cellular senescence is inevitable in aging organisms and is often ascribed to telomere erosion that prompts replicative senescence. However, senescence can also be induced by various external stimuli, leading to stress-induced premature senescence, a phenomenon observable both in young and aged organisms. The process can be traced by analyzing the level or activity of established senescence markers, although none of them is specific for a given type of senescence. Thus, in this study we propose CLDN1 as a cell-specific marker of stress-induced premature senescence in VSMC.

The basis for the presented research on CLDN1 in senescence has been provided by transcriptomic analysis of prematurely (doxorubicin- and curcumin-induced) and replicatively senescent VSMCs. The microarray analysis indicated that the mRNA level was significantly upregulated in prematurely senescent cells while no changes were observed in replicative senescence when compared to young cells. However, when the mRNA level was analyzed with qPCR, upregulated expression was observed in both types of senescence. A similar observation was described in the original paper discussing SEMP1, where mRNA expression was elevated in replicatively senescent human mammary epithelial cells (HMECs) [14]. Unfortunately, no information regarding premature senescence has been provided. In our experiment, despite the observed higher transcript level in both SIPS and RS VSMCs, increased protein expression was noted solely in DOX and CUR-treated cells, suggesting additional post-transcriptional regulation of the mRNA level, for example, by miRNA [12]. Studies analyzing skin grafts from photoprotected (buttocks), and unprotected (forearm) tissue areas collected from young and elderly donors, provided interesting observations, aligning with our findings to some extent [13]. In those studies, the term “intrinsically senescent cells” can be interpreted as replicatively senescent cells and photoaged skin cells as prematurely senescent cells, as this tissue has been exposed to UV-radiation, which is a commonly known inducer of senescence. In intrinsically senescent cells (RS) claudin-1 expression was significantly downregulated with no changes in mRNA level compared to cells from young donor. This is similar to the phenomenon observed in our experiment. However, when photoaged (SIPS) and photoprotected skin from elderly patients were compared, the decrease in protein and mRNA level were even more pronounced in the sun exposed tissue. Interestingly, no differences were noted between forearm skin and the photoprotected skin from young individuals. It should be noted that these are different types of cells than those used in our experiments. Such conflicting results may be cell type-dependent, as it has been proven that the expression level of claudin-1 in normal or aging cells can be tissue-specific [31]. Our results suggest that in VSMCs, increased claudin-1 expression is a characteristic feature of SIPS.

Our research also aimed to elucidate the reasons behind the differences in CLDN1 expression between SIPS and RS and to understand the underlying epigenetic regulatory mechanisms. Results of the ChIP-seq analysis suggest that expression of the CLDN1 gene may be regulated by the enrichment in H3K4me3 at the transcription start site (TSS). It has been demonstrated that the overall levels of H3K4me3 decrease in senescent cells (unpublished data, manuscript in preparation) while on the other hand, a broad H3K4me3 peak at the TSS of CLDN1 is detected in both types of senescence. This may facilitate transcription, potentially by allowing more efficient binding of transcription factors to the TSS.

As cells senesce, their surface area increases, which may influence the formation of contact points between cells and the potential development of tight junctions (where claudin-1 is located). We observed that in SIPS, cells may form small clusters, and wondered whether the enhanced contact might be the reason for higher protein expression. Similar although less frequent observations were made for RS cells, but this depended on the donor. This led to the expansion of the experimental setup, in which we analyzed both young and RS cells in their nearly 100% confluence state. Additionally, we have investigated whether the higher protein level is associated solely with irreversible cell cycle arrest. To test this, cells were cultured in a serum-free medium for 7 days, resulting in their reaching a quiescent state. Such cells are temporarily arrested in the cell cycle and resume division upon reintroduction of serum into the medium. The Western blotting analysis showed no increase in CLDN1 in either case. The result suggests that the elevated CLDN1 level is not associated with increased intercellular contact or cell cycle exit.

We tested if the increased CLDN1 expression in SIPS cells might result from the prolonged culture, as these cells were incubated for 7 days without passage. Recent studies performed on human corneal epithelial cells (HCECs) showed that prolonged 14-day cultivation led to a significant increase in claudin-1 expression, which was noted from the 6th day of incubation [32]. The 14-day culture was supposed, based solely on cell division halting (cell count), to mimic cellular senescence. However, it is plausible that these cells reached 100% confluence, which potentially led to contact inhibition, and this could not be assigned to cellular senescence per se. Furthermore, the conditions of prolonged and confluent cell culture might have induced cellular stress, contributing to altered protein expression. As mentioned above, our confluent cells did not exhibit an increase in CLDN1 expression. To further investigate the effects of prolonged cell culture, we conducted claudin-1 expression kinetics in VSMCs over four consecutive days. The results, however, were inconclusive and remain under investigation.

Immunocytochemical staining demonstrated that in PS cells CLDN1 localizes predominantly within the cell nucleus, which was confirmed on the protein level by analyzing the cytoplasmic and nuclear cell fractions. This nuclear localization is uncommon, and the consequences of altered localization are not well understood. The existing data are contradictory and mostly focused on cancer cells. For example, studies have shown that in thyroid cancer cells, the translocation of CLDN1 to the nucleus and increased protein levels led to enhanced cell proliferation and migration [33]. In contrast, the increase in cytoplasmic fraction in melanoma cells drove metastasis and worsened survival outcomes, with nuclear localization having little effect on cell migration [34]. In colon cancer cells, however, increased levels of CLDN1 in both the cytoplasm and nucleus were associated with enhanced cell migration [35].

Following the preliminary characterization of CLDN1 expression in VSMCs, we employed it as a marker of SIPS in cells isolated from atherosclerotic plaques of six donors. To assess the proliferative state of these cells, we used ANLN. Our analysis revealed that all six samples predominantly consisted of non-dividing cells, as indicated by the absence of the ANLN band in Westen blotting.

Focusing on CLDN1 expression, only samples 3 and 4 displayed strong bands in Westen blot indicating high CLDN1 level, suggesting that these cells might have undergone premature senescence. In contrast, samples 1 and 2 exhibited SIPS and replicative senescence (RS) characteristics, though the proportion might be unbalanced given the faint CLDN1 bands observed. Samples 5 and 6, on the other hand, appeared to have a predominant population of RS cells. CLDN1 expression differences in isolated smooth muscle cells reflect the heterogeneity of atherosclerotic plaques, some of which are stable, some unstable and may cause vascular incidents. Better characterization of atherosclerotic plaques may allow for the selection of clinically significant changes, especially in coronary and cerebral arteries.

We also conducted parallel analyses on fibroblasts using the same experimental approach (results not shown). While the pattern of increased CLDN1 expression in SIPS fibroblasts mirrored that observed in VSMCs, the results related to RS were inconclusive. This area remains under investigation.

Claudin-1 is a widely studied protein; however, its role is mostly described in cancer cells and other malignancies or ailments (tissue fibrosis, stroke, wound healing etc.) [8, 36–38]. Its dysregulation can be used as a prognostic marker of breast cancer [39] or sleep apnea [40], and has recently been used as a therapeutic target of colon cancer [41], hepatocellular carcinoma [42] or tissue fibrosis [37]. So far, no research has been conducted on the role of CLDN1 in atherosclerosis and we propose that CLDN1 might serve as a stress-induced senescence marker in VSMCs and perhaps a future therapeutic target in this condition.

Ethics Committee

Studies with human samples were performed in line with the principles of the Declaration of Helsinki and were approved by the Ethical Committee of the Central Clinical Hospital Ministry of Internal Affairs (2017/114). Informed consent was obtained from all individual participants/patients included in the study.

Conflict of interest:

The authors declare no conflict of interest.

Funding:

The study was supported by the Polish National Science Center grant no. 2016/21/B/NZ3/00370 (Anna Bielak-Zmijewska).

Author contributions:

Agnieszka Gadecka - conceptualized research, performed experiments, analyzed and visualized data, prepared figures, wrote and reviewed the manuscript; Tomasz Buko and Dorota Janiszewska performed experiments; Marta Koblowska participated in research planning and supervision, analyzed data; Roksana Iwanicka-Nowicka and Helena Kossowska performed experiments and analyzed microarray data; Krzysztof Bojakowski performed surgeries; Grażyna Mosieniak established the procedure of VSMC isolation from atherosclerotic plaques; Anna Bielak-Zmijewska acquired funding, conceptualized and supervised the research, analyzed data, wrote and reviewed the manuscript. All authors contributed to the writing, read and accepted the final manuscript.

Acknowledgements:

NGS was performed thanks to Genomics Core Facility CeNT UW, using NovaSeq 6000 platform financed by the Polish Ministry of Science and Higher Education (decision no. 6817/IA/SP/2018 of 2018-04-10).

Data availability:

The datasets generated and/or analysed during the current study are available from the corresponding author upon reasonable request.

Costopoulos C, Liew TV, Bennett M (2008) Ageing and atherosclerosis: Mechanisms and therapeutic options. Biochem Pharmacol 75 (6):1251–1261. https://doi.org/10.1016/j.bcp.2007.10.006
González-Gualda E, Baker AG, Fruk L, Muñoz-Espín D (2021) A guide to assessing cellular senescence in vitro and in vivo. FEBS J 288(1):56–80. https://doi.org/10.1111/febs.15570
Günzel D, Yu ASL (2013) Claudins and the modulation of tight junction permeability. Physiol Rev 93(2):525-69. https://doi.org/10.1152/physrev.00019.2012
Li W, Liu L, Duanqing M, Xiong X, Gan D, Yang J, Wang M, Zhou M, Yan J (2023) CLDN1 silencing suppresses the proliferation and migration of airway smooth muscle cells by modulating MMP14. Autoimmunity 56(1):2281223. https://doi.org/10.1080/08916934.2023.2281223
Van Itallie CM, Tietgens AJ, Anderson JM (2017) Visualizing the dynamic coupling of claudin strands to the actin cytoskeleton through ZO-1. Mol Biol Cell 28(4):524–534. https://doi.org/10.1091/mbc.E16-10-0698
Zimmerli SC, Hauser C (2007) Langerhans cells and lymph node dendritic cells express the tight junction component claudin-1. J Invest Dermatol 127(10):2381–2390. https://doi.org/10.1038/sj.jid.5700882
Alshbool FZ, Mohan S (2014) Differential expression of claudin family members during osteoblast and osteoclast differentiation: Cldn-1 is a novel positive regulator of osteoblastogenesis. PLoS ONE 9(12). https://doi.org/10.1371/journal.pone.0114357
Sladojevic N, Stamatovic SM, Johnson AM, Choi J, Hu A, Dithmer S, Blasig IE, Keep RF, Andjelkovic AV (2019) Claudin-1-Dependent Destabilization of the Blood–Brain Barrier in Chronic Stroke. J Neurosci 39(4):743–757. https://doi.org/10.1523/JNEUROSCI.1432-18.2018
Furuse M, Hata M, Furuse K, Yoshida Y, Haratake A, Sugitani Y, Noda T, Kubo A, Tsukita S (2002) Claudin-based tight junctions are crucial for the mammalian epidermal barrier: A lesson from claudin-1-deficient mice. J Cell Biol 156(6):1099–1111. https://doi.org/10.1083/jcb.200110122
Oshima T, Miwa H (2016) Gastrointestinal mucosal barrier function and diseases. J Gastroenterol 51(8):768–778. https://doi.org/10.1007/s00535-016-1207-z
Fujita H, Chalubinski M, Rhyner C, Indermitte P, Meyer N, Ferstl R, Treis A, Gomez E, Akkaya A, O’Mahony L, Akdis M, Akdis CA (2011) Claudin-1 expression in airway smooth muscle exacerbates airway remodeling in asthmatic subjects. J Allergy Clin Immunol 127(6):1612-21. https://doi.org/10.1016/j.jaci.2011.03.039
Xie Y, Tan J, Qin Y, Cao Y, Wang Y, Li A, Wang Z, Qiao Z, Yan Z (2022) MiR-3571 modulates the proliferation and migration of vascular smooth muscle cells by targeting claudin 1. Int J Med Sci 19(3):511–524. https://doi.org/10.7150/ijms.64639
Jin SP, Han SB, Kim YK, Park EE, Doh EJ, Kim KH, Lee DH, Chung JH (2016) Changes in tight junction protein expression in intrinsic aging and photoaging in human skin in vivo. J Dermatol Sci 84(1):99–101. https://doi.org/10.1016/j.jdermsci.2016.07.002
Swisshelm K, Machl A, Planitzer S, Robertson R, Kubbies M, Hosier S (1999) SEMP1, a senescence-associated cDNA isolated from human mammary epithelial cells, is a member of an epithelial membrane protein superfamily. Gene 226(2):285-95. https://doi.org/10.1016/s0378-1119(98)00553-8
Bielak-Zmijewska A, Wnuk M, Przybylska D, Grabowska W, Lewinska A, Alster O, Korwek Z, Cmoch A, Myszka A, Pikula S, Mosieniak G, Sikora E (2014) A comparison of replicative senescence and doxorubicin-induced premature senescence of vascular smooth muscle cells isolated from human aorta. Biogerontology 15(1), 47–64. https://doi.org/10.1007/s10522-013-9477-9
Grabowska W, Kucharewicz K, Wnuk M, Lewinska A, Suszek M, Przybylska D, Mosieniak G, Sikora E, Bielak-Zmijewska A (2015) Curcumin induces senescence of primary human cells building the vasculature in a DNA damage and ATM-independent manner. AGE 37(1):7. https://doi.org/10.1007/s11357-014-9744-y
Grabowska W, Mosieniak G, Achtabowska N, Czochara R, Litwinienko G, Bojko A, Sikora E, Bielak-Zmijewska A (2019) Curcumin induces multiple signaling pathways leading to vascular smooth muscle cell senescence. Biogerontology 20(6):783–798. https://doi.org/10.1007/s10522-019-09825-2
Dimri GP, Lee X, Basile G, Acosta M, Scott G, Roskelley C, Medrano EE, Linskens M, Rubelj I, Pereira-Smith O (1995) A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A 92(20):9363–9367. https://doi.org/10.1073/pnas.92.20.9363
Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29(9):45e. https://doi.org/10.1093/nar/29.9.e45
Bolger AM, Lohse M, Usadel B (2014) Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30(15): 2114–2120. https://doi.org/10.1093/bioinformatics/btu170
Langmead B, Wilks C, Antonescu V, Charles R (2019) Scaling read aligners to hundreds of threads on general-purpose processors. Bioinformatics 35(3):421–432. https://doi.org/10.1093/bioinformatics/bty648
McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, Garimella K, Altshuler D, Gabriel S, Daly M, DePristo MA (2010) The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res 20(9):1297–1303. https://doi.org/10.1101/gr.107524.110
Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, Bernstein BE, Nusbaum C, Myers RM, Brown M, Li W, Liu XS (2008) Model-based Analysis of ChIP-Seq (MACS). Genome Biol 9(9), R137. https://doi.org/10.1186/gb-2008-9-9-r137
Robinson MD, McCarthy DJ, Smyth GK (2010) edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26(1):139–140. https://doi.org/10.1093/bioinformatics/btp616
Field CM, Alberts BM (1995) Anillin, a contractile ring protein that cycles from the nucleus to the cell cortex. J Cell Biol 131(1):165–178. https://doi.org/10.1083/jcb.131.1.165
Batty M, Bennett MR, Yu E (2022) The Role of Oxidative Stress in Atherosclerosis. Cells 11(23):3843. https://doi.org/10.3390/cells11233843
Duan J, Duan J, Zhang Z, Tong T (2005). Irreversible cellular senescence induced by prolonged exposure to H 2O2 involves DNA-damage-and-repair genes and telomere shortening. Int J Biochem Cell Biol 37(7):1407–1420. https://doi.org/10.1016/j.biocel.2005.01.010
Głuchowska A. Cysewski D, Baj-Krzyworzeka M, Szatanek R, Węglarczyk K, Podszywałow-Bartnicka P, Sunderland P, Kozłowska E, Śliwińska MA, Dąbrowski M, Sikora E, Mosieniak G (2022) Unbiased proteomic analysis of extracellular vesicles secreted by senescent human vascular smooth muscle cells reveals their ability to modulate immune cell functions. GeroScience, 44(6):2863–2884. https://doi.org/10.1007/s11357-022-00625-0
Przybylska D, Janiszewska D, Goździk A, Bielak-Zmijewska A, Sunderland P, Sikora E, Mosieniak G (2016) NOX4 downregulation leads to senescence of human vascular smooth muscle cells. Oncotarget 7(41):66429–66443. https://doi.org/10.18632/oncotarget.12079
Marescal O, Cheeseman IM (2020) Cellular Mechanisms and Regulation of Quiescence. Dev Cell 55(3):259–271. https://doi.org/10.1016/j.devcel.2020.09.029
D’Souza T, Sherman-Baust CA, Poosala S, Mullin JM, Morin PJ (2009) Age-related changes of claudin expression in mouse liver, kidney, and pancreas. J Gerontol A Biol Sci Med Sci 64(11):1146–1153. https://doi.org/10.1093/gerona/glp118
Chen TC, Chang SW (2024) Non-lethal exposure to short-wavelength light-emitting diodes modulates tight-junction structure in human corneal epithelial cells via cAMP-dependent signaling. J Photochem Photobiol B 252:112869. https://doi.org/10.1016/j.jphotobiol.2024.112869
Zwanziger D, Badziong J, Ting S, Moeller LC, Schmid KW, Siebolts U, Wickenhauser C, Dralle H, Fuehrer, D (2015) The impact of CLAUDIN-1 on follicular thyroid carcinoma aggressiveness. Endocr Relat Cancer 22(5):819–830. https://doi.org/10.1530/ERC-14-0502
French AD, Fiori JL, Camilli TC, Leotlela PD, O’Connell MP, Frank BP, Subaran S, Indig FE, Taub DD, Weeraratna AT (2009) PKC and PKA Phosphorylation Affect the Subcellular Localization of Claudin-1 in Melanoma Cells. Int J Med Sci 6(2):93-101. https://doi.org/10.7150/ijms.6.93
Dhawan P (2005) Claudin-1 regulates cellular transformation and metastatic behavior in colon cancer. J Clin Invest 115(7):1765–1776. https://doi.org/10.1172/JCI24543
Bergmann S, von Buenau B, Vidal-y-Sy S, Haftek M, Wladykowski E, Houdek P, Lezius S, Duplan H, Bäsler K, Dähnhardt-Pfeiffer S, Gorzelanny C, Schneider SW, Rodriguez E, Stölzl D, Weidinger S, Brandner JM (2020) Claudin-1 decrease impacts epidermal barrier function in atopic dermatitis lesions dose-dependently. Sci Rep 10(1):2024. https://doi.org/10.1038/s41598-020-58718-9
Roehlen N, Saviano A, El Saghire H, Crouchet E, Nehme Z, Del Zompo F, Jühling F, Oudot MA, Durand SC, T Duong, F. H., Cherradi S, Gonzalez Motos V, Almeida N, Ponsolles C, Heydmann L, Ostyn T, Lallement A, Pessaux P, Felli E, Baumert TF (2022) A monoclonal antibody targeting nonjunctional claudin-1 inhibits fibrosis in patient-derived models by modulating cell plasticity. Sci Transl Med 14(676):eabj4221. https://doi.org/ 0.1126/scitranslmed.abj4221
Volksdorf T, Heilmann J, Eming SA, Schawjinski K, Zorn-Kruppa M, Ueck C, Vidal-y-Sy S, Windhorst S, Jücker M, Moll I, Brandner JM (2017) Tight Junction Proteins Claudin-1 and Occludin Are Important for Cutaneous Wound Healing. Am J Pathol 187(6):1301–1312. https://doi.org/10.1016/j.ajpath.2017.02.006
Heerma van Voss MR, van Diest PJ, Smolders YHCM, Bart J, van der Wall E, van der Groep P (2014) Distinct claudin expression characterizes BRCA1-related breast cancer. Histopathology 65(6):814–827. https://doi.org/10.1111/his.12490
Liu D, Meng H, Wan N, Feng J (2024) Association of CLDN molecules with sleep apnea hypopnea syndrome: new biomarker candidates. Front Neurol 15:1347137. https://doi.org/10.3389/fneur.2024.1347137
Cherradi S, Ayrolles-Torro A, Vezzo-Vié N, Gueguinou N, Denis V, Combes E, Boissière F, Busson M, Canterel-Thouennon L, Mollevi C, Pugnière M, Bibeau F, Ychou M, Martineau P, Gongora C, Del Rio M (2017) Antibody targeting of claudin-1 as a potential colorectal cancer therapy. J Exp Clin Cancer Res 36(1):89. https://doi.org/10.1186/s13046-017-0558-5
Roehlen N, Muller M, Nehme Z, Crouchet E, Jühling F, Del Zompo F, Cherradi S, Duong FHT, Almeida N, Saviano A, Fernández-Vaquero M, Riedl T, El Saghire H, Durand SC, Ponsolles C, Oudot MA, Martin R, Brignon N, Felli E, Baumert TF (2023) Treatment of HCC with claudin-1-specific antibodies suppresses carcinogenic signaling and reprograms the tumor microenvironment. J Hepatol 78(2):343–355. https://doi.org/10.1016/j.jhep.2022.10.011

Download PDF

Version 1

posted

You are reading this latest preprint version

Claudin-1 as a potential marker of stress-induced premature senescence in vascular smooth muscle cells

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials and methods

2.1. Cell culture

2.2. Cell treatment

2.3. Bromodeoxyuridine (BrdU) incorporation assay

2.4. Senescence-Associated β-Galactosidase (SA β-Gal) assay

2.5. RNA isolation

2.6. DNA microarrays

2.7. qPCR

2.8. Protein fraction isolation

2.9. Western blotting

2.10. Chromatin immunoprecipitation coupled with sequencing (ChIP-seq)

2.11. Immunofluorescence

2.12. Statistical analysis

3. Results

3.1. Claudin-1 is highly expressed in SIPS but not in RS cells

3.2. Anillin as a marker of non-proliferating cells

3.3. An increase in CLDN1 expression is independent of cell confluence and reversible cell cycle arrest

3.4. CLDN1 as a potential marker in ex vivo evaluation of cellular senescence type

4. Discussion

Declarations

Ethics Committee

Conflict of interest:

Funding:

Author contributions:

Acknowledgements:

Data availability:

References

Status:

Version 1