Blocking mineralocorticoid signaling with esaxerenone reduces atherosclerosis in ApoE KO mice without affecting blood pressure and glycolipid metabolism

doi:10.21203/rs.3.rs-5196163/v1

Download PDF

Article

Blocking mineralocorticoid signaling with esaxerenone reduces atherosclerosis in ApoE KO mice without affecting blood pressure and glycolipid metabolism

https://doi.org/10.21203/rs.3.rs-5196163/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Aims: Endothelial damage mediated by mineralocorticoid receptor (MR) is an important factor in the development of atherosclerosis. Esaxerenone is a highly selective drug that can specifically block MR activity. The aim of this study is to examine whether specific blocking of mineralocorticoid signaling with esaxerenone exerts favorable effects on the progression of atherosclerosis.

Methods: ApoE KO mice were used as a model of atherosclerosis. In addition to a non-diabetic model, we created a diabetic model using streptozotocin. These were divided into a control group and an esaxerenone group. Esaxerenone-containing diet was provided for 8 weeks starting at 10 weeks of age. Various metabolic markers and abdominal aortic mRNA expression were evaluated, and histological examination of the aortic arch and thoracic aorta was performed.

Results: In diabetic mice, plaque area in the aortic arch was significantly smaller in esaxerenone group compared to control group, although there were no differences in blood pressure, serum lipid levels between the two group. Inflammation-related genes, macrophage marker, cell adhesion factors and oxidative stress marker were all significantly lower in esaxerenone group.

Conclusions: Specific blocking of mineralocorticoid signaling with esaxerenone exerts favorable effects on the progression of atherosclerosis without influencing blood pressure and glucolipid metabolism.

Health sciences/Cardiology

Health sciences/Endocrinology

esaxerenone

oxidative stress

atherosclerosis

Atherosclerotic cardiovascular disease is a chronic inflammatory disease of intima of the aorta and medium-sized arteries, and it accounts for one third of all deaths worldwide [1]. An important risk factor for atherosclerosis is the dysfunction of vascular endothelial cells due to chronic inflammation, which is often observed in subjects with metabolic syndrome or diabetes mellitus [2–9]. Chronic inflammation is mainly caused by the infiltration and accumulation of inflammatory cells such as macrophages and lymphocytes, and these cells release inflammatory cytokines [10–14]. On the other hand, it has been reported that the renin-angiotensin system (RAS) is activated in blood vessels with atherosclerosis, and mineralocorticoid receptor (MR)-mediated vascular endothelial dysfunction also contributes to the development of atherosclerosis [15]. In subjects with obesity, hyperglycemia and excessive salt intake, aldosterone activates MR signaling, which finally provokes oxidative stress through the activation of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. MR is also expressed in vascular endothelial cells, vascular smooth muscle cells and macrophages [16], and it has been thought that its activation leads to the progression of atherosclerosis independently of hypertension. It has been also reported that primary aldosteronism increases the incidence of cardiovascular disease independently of blood pressure compared to essential hypertension [17].

Therefore, we hypothesized that the progression of atherosclerosis could be inhibited by suppressing MR activity using an MR blocker. In this study, we blocked mineralocorticoid signaling with esaxerenone, an MR blocker that is widely used in clinical practice. There are several reports on basic research using esaxerenone. For example, it has been reported that esaxerenone shows renoprotective effect independently of blood pressure in type 2 diabetes model mice and cardioprotective effect using hypertension model rats [18, 19]. However, there has been no report at all showing the possible effects of MR blocking on the progression of atherosclerosis. The purpose of this study was to examine whether blocking of mineralocorticoid signaling with esaxerenone exerts anti-atherosclerotic effects and to elucidate the molecular mechanisms of the possible anti-atherosclerotic effects of blocking mineralocorticoid signaling under diabetic and non-diabetic conditions.

Animals and diets

ApoE knockout mice (C57BL/6J-ApoEtm1Unc) were purchased from Charles River Laboratories and reared under controlled environmental conditions on a 12-hour light/dark cycle (2 mice per cage in all experiments). Mice were fed water and standard diet (MF; Oriental Yeast Co.) were fed ad libitum until 8 weeks of age, and the room temperature was maintained at 25°C.

We set diabetes model and non-diabetes model. For making diabetes model, at 8 weeks of age, we used streptozotocin (STZ) to induce hyperglycemia based on our previous report [16]. Mice were injected intraperitoneally with STZ (50 mg/kg/day) (Fujifilm Wako Pure Chemicals) for 5 consecutive days. Mice that showed obvious hyperglycemia of 300 mg/dL or more under feeding conditions were designated as a diabetic model. At the age of 10 weeks, the diabetic and non-diabetic models were respectively divided into a standard diet group and an esaxerenone-containing diet group (Provided by Daiichi Sankyo Co., LTD.) (3 mg/kg/day) for intervention. Mice in the four groups were observed from 10 to 18 weeks of age, and body weight, blood glucose, and food intake were measured throughout the experimental period. The mice used in the study were subjected to dissection under isoflurane anesthesia and subsequently euthanized. This study was approved by the Animal Use Committee of Kawasaki Medical School (No. 23–037) and was conducted in accordance with the Kawasaki Medical School Animal Use Guidelines. In addition, this study was conducted in accordance with the Animal Research: Reporting of In Vivo Experiment (ARRIVE) guidelines.

Measurement of biochemical markers

Blood samples were collected from tail vein. Blood glucose levels were measured using a glucometer (Glutest Mint; Sanwa Kagaku Kenkyusho Co, Ltd, Japan). Plasma total cholesterol and triglyceride levels were measured enzymatically using the Wako LabAssay, L type Wako (Wako Pure Chemical Industries, Japan). Urine was collected using metabolic cage at 18 weeks of age, and urinary 8-OHdG levels were measured using ELISA kit (Japan Institute for the Control of Aging, NIKKEN SEIL Co, Ltd, Japan).

RNA isolation and real time PCR

Total RNA extraction was performed using a RNeasy lipid tissue mini kit (QIAGEN, Valencia, CA) according to the manufacturers’ instructions. cDNA was produced from mRNA using TaqMan reverse transcription reagents (Applied Biosystems, Foster City, CA). Quantitative RT-PCR was conducted using a Step One Plus Real-Time PCR system (Applied Biosystems). To quantify gene expression, the 2^−ΔCT was calculated using β-actin as an internal control. Primer sequences used for real time PCR are presented in Table 1.

Table 1

Primer sequences of forward and reverse primers for real-time PCR
Genes	Forward	Reverse
β-actin	CGTGAAAAGATGACCCAGATCA	CACAGCCTGGATGGCTACGTA
MCP-1	CTTCCTCCACCACCATGCA	CCAGCCGGCAACTGTGA
IL-1β	TGGTGTGTGACGTTCCCATTA	CGACAGCACGAGGCTTTTTT
IL-6	ACAACCACGGCCTTCCCTA	CATGTGTAATTAAGCCTCCGACTTG
TIMP-1	GCATGGACATTTATTCTCCACTGT	TCTCTAGGAGCCCCGATCTG
PAI-1	TGCATCGCCTGCCATTG	CTTGAGATAGGACAGTGCTTTTTCC
VCAM-1	GATCTCCCCTGAATACAAAACGAT	GCCCGTAGTGCTGCAAGTG
ICAM-1	TCGGAAGGGAGCCAAGTAACT	CGACGCCGCTCAGAAGAA
MMP-2	CCCTCAAGAAGATGCAGAAGTTC	TCTTGGCTTCCGCATGGT
F4/80	TGCATCTAGCAATGGACAGC	GCCTTCTGGATCCATTTGAA
CD68	TTTCTCCAGCTGTTCACCTTGA	CCCGAAGTGTCCCTTGTCA

Histological and immunohistological analyses

Under anesthesia, PBS was perfused from left ventricle and then mouses were killed and heart and aorta were dissected. Sudan IV (Wako: 192–04392) staining was conducted for aortic arch. Adventitial fat tissue was removed and aorta was dissected longitudinally. The image analysis software NIH Image (version 1.61; http://rsbweb.nih.gov/ij/) was used to calculate the ratio of the plaque lesion to the total aortic arch area.

Statistical analysis

All data were analyzed and expressed as the mean ± standard error of the mean. Differences between two groups were tested for statistical significance using Student’s t-test. p values less than 0.05 were considered to indicate a statistically significant difference.

There was no significant difference in factors related to atherosclerosis between control and esaxerenone group

It is well known that blood glucose, lipid and blood pressure control greatly affect the progression of atherosclerosis. Therefore, we measured blood glucose levels, lipid levels, body weights and blood pressure. In non-diabetic mice, there was no significant difference in non-fasting blood glucose levels between control and esaxerenone group (Fig. 1A). Body weights and food intake were also not different between control and esaxerenone group (Fig. 1C, E). In diabetic mice, there was also no significant difference in non-fasting blood glucose levels, body weights and food intake between the two groups (Fig. 1B, D, F). In fasting conditions, there was also no difference in blood glucose levels, body weights, and lipid levels such as triglyceride and total cholesterol between control and esaxerenone group in non-diabetic and diabetic mice (Table 2, 3). Esaxerenone is used as an anti-hypertensive drug in clinical practice. However, esaxerenone did not lower blood pressure and heart rate in both non-diabetic and diabetic mice in this strain (Table 2, 3). Furthermore, esaxerenone did not affect body composition such as organ weights in both non-diabetic and diabetic models (Supplementary Table 1, 2). Therefore, in this study, treatment with esaxerenone did not change any factors that can influence the progression of atherosclerosis.

Table 2

Biochemical data, body weights, and blood pressure in non-diabetic mice
	Before treatment (10 weeks)		After treatment (18 weeks)
	control	Esaxerenone	control	Esaxerenone	p value
Fasting blood glucose (mg/dl)	62.7 ± 2.7	65.2 ± 3.0	103.5 ± 13.1	87.3 ± 6.8	n.s.
Total cholesterol (mg/dl)	N/A	N/A	142.2 ± 12.5	152.0 ± 14.4	n.s.
Triglyceride (mg/dl)	N/A	N/A	94.2 ± 9.6	93.1 ± 12.7	n.s.
Fasting body weights (g)	22.9 ± 0.7	22.8 ± 1.1	26.3 ± 0.6	26.5 ± 1.3	n.s.
Systolic BP (mmHg)	103.8 ± 2.6	98.1 ± 3.8	96.1 ± 2.5	98.8 ± 4.5	n.s.
Diastolic BP (mmHg)	55.5 ± 2.6	51.1 ± 2.5	50.0 ± 4.3	41.1 ± 5.3	n.s.
Heart rate (beats/min)	703.8 ± 10.3	662.9 ± 18.3	711.1 ± 12.7	694.0 ± 13.7	n.s.
p value between with and without esaxerenone treatment at 18 weeks. n.s.: not significant;
N/A, not applicable.

Table 3

Biochemical data, body weights, and blood pressure in diabetic mice
	Before treatment (10 weeks)		After treatment (18 weeks)
	control	Esaxerenone	control	Esaxerenone	p value
Fasting blood glucose (mg/dl)	120.6 ± 13.5	160.3 ± 12.7	154.1 ± 20.5	138.1 ± 14.8	n.s.
Total cholesterol (mg/dl)	N/A	N/A	176.8 ± 19.0	174.3 ± 41.0	n.s.
Triglyceride (mg/dl)	N/A	N/A	123.5 ± 12.7	153.6 ± 11.4	n.s.
Fasting body weights (g)	21.1 ± 0.55	19.6 ± 1.38	23.6 ± 0.82	26.1 ± 0.72	n.s.
Systolic BP (mmHg)	97.1 ± 2.5	104.0 ± 3.0	105.4 ± 3.2	104.1 ± 8.3	n.s.
Diastolic BP (mmHg)	47.6 ± 4.2	50.6 ± 3.5	49.5 ± 5.8	50.4 ± 4.8	n.s.
Heart rate (beats/min)	660.9 ± 17.2	648.2 ± 14.5	711.1 ± 12.7	694 ± 13.7	n.s.
p value between with and without esaxerenone treatment at 18 weeks. n.s.: not significant;
N/A, not applicable.

Plaque formation in the aortic arch was significantly reduced in esaxerenone group compared to control group in diabetic mice.

Next, to investigate the effect of esaxerenone on the progression of atherosclerosis, plaque formation in the aortic arch was evaluated. The area of plaque stained with Sudan IV was measured and compared between with and without esaxerenone treatment. In the non-diabetic mice, there was no significant difference between control and esaxerenone group (Fig. 2A, B, E). However, esaxerenone treatment significantly reduced plaque area compared to control group in diabetic mice (Fig. 2C, D, E).

Esaxerenone treatment reduced oxidative stress and inflammatory cytokines in diabetic mice

Next, we examined the possible effects of esaxerenone on the progression of atherosclerosis. It is known that activation of the RAS stimulates NADPH oxidase and increase reactive oxygen species (ROS) [17]. Therefore, we evaluated urinary 8-OHdG levels as oxidative stress marker. Urinary 8-OHdG levels were significantly lower in esaxerenone group compared to control group in diabetic mice (Fig. 3A). Expression levels of inflammatory cytokines such as Il-6, Il-1β and Mcp-1 were higher in diabetic mice compared to non-diabetic mice. In non-diabetic mice, expression levels of Il-6, Il-1β and Mcp-1 tended to be lower in esaxerenone group, although it did not reach a statistical significance. In diabetic mice, however, expression levels of Il-1β and Mcp-1 were significantly lower in esaxerenone group compared to control (Fig. 3B, C, D). Taken together, specific locking of mineralocorticoid signaling with esaxerenone reduced ROS production and decreased expression levels of inflammatory cytokines in abdominal aorta under diabetic conditions.

Esaxerenone reduced expression levels of factors associated with cell adhesion, macrophage infiltration, and plaque stability in the aorta of diabetic mice.

Finally, to examine other factors associated with atherosclerosis, we evaluated expression levels of cell adhesion, macrophage and plaque stability markers in the abdominal aorta. In non-diabetic mice, there were no differences in expression levels of cell adhesion, macrophage and plaque stability markers. Expression levels related with thrombus formation or cell adhesion such as Pai-1, Vcam-1, Icam-1 were significantly lower in esaxerenone group in diabetic mice (Fig. 4A, B, C). There was no difference in macrophage marker such as F4/80, but expression levels of Cd68 were significantly lower in esaxerenone group compared to control in diabetic mice (Fig. 4D, E). Regarding plaque stability, there was no difference in expression levels of Timp-1 (Fig. 4F). Mmp-2 expression level was significantly lower in esaxerenone group in diabetic mice (Fig. 4G).

In this study, we demonstrated that specific blocking of mineralocorticoid signaling with esaxerenone exerted favorable anti-atherosclerotic effects in the aorta of STZ-induced hyperglycemic ApoE KO mice. Furthermore, interestingly, such anti-atherosclerotic effects were obtained without influencing blood pressure and glucolipid metabolism. Other MR blockers, such as spironolactone [18] and eplerenone [19, 20] showed anti-atherosclerotic effects, but both drugs decreased blood pressure and improved lipid profile both of which are well known to reduce the progression of atherosclerosis. Therefore, while mineralocorticoid signaling has been drawing much attention recently, this is the first report which clearly demonstrates that blocking of mineralocorticoid signaling exerts favorable anti-atherosclerotic effects, independently of blood pressure and glucolipid metabolism.

In clinical studies, finerenone has been shown to reduce cardiovascular events in patients with chronic kidney disease and type 2 diabetes mellitus [21], but basic studies have only examined cardioprotection and renoprotection [18, 19]. There is no report examining its possible effects on atherosclerosis. It is thought that esaxerenone suppresses the progression of atherosclerosis by suppressing mineralocorticoid signaling and reducing oxidative stress and inflammation. In this study, urinary 8-OHdG, an oxidative stress marker, was lower in esaxerenone group compared to control group. Expression levels of inflammatory markers such as Il-1β and Mcp-1 were significantly lower in esaxerenone group in diabetic mice. Furthermore, expression levels of Pai-1, Cd68, Vcam-1 and Icam-1 may have decreased due to the improvement of inflammation. It has been reported that MR-mediated NADPH oxidase and Rac1 activation induces the production of ROS and are involved in vascular injury [24, 25]. We think that esaxerenone blocked MR and decreased ROS production. It is also known that MR activation promotes leukocyte adhesion through increased Icam-1 expression [26] and production of inflammatory cytokines and chemokines such as Il-1β, Mcp-1, and Pai-1 [27]. In this study, inflammatory cytokines and cell adhesion factors were increased under diabetic conditions, and these were significantly improved by esaxerenone treatment.

On the other hand, there were no significant differences in blood pressure, lipid profile, and blood glucose levels between esaxerenone and control group. Esaxerenone is a drug used clinically for hypertension, but the selected dosage did not affect blood pressure as previously reported [28–30]. There was no difference in blood pressure in these reports, but esaxerenone showed beneficial effects on vascular dysfunction. We thought the possibility that esaxerenone directly exerts favorable anti-atherosclerotic effects by reducing oxidative stress and inflammation.

There is limitation in this study. First, there was significant improvement in plaque area and mRNA levels in diabetic mice, however no significant improvement was observed in non-diabetic mice. In non-diabetic mice, plaque formation was significantly less compared to diabetic mice, which may explain the lack of significant differences. Although there was no significant difference in expression levels of mRNA, inflammatory cytokines showed a decreasing trend. Therefore, if the intervention period is extended, significant differences may occur even under non-diabetic conditions.

In conclusion, specific blocking of mineralocorticoid signaling with esaxerenone exerts favorable effects on the development of plaque formation and progression of atherosclerosis, which was independent of blood pressure and glucolipid metabolism. To the best of our knowledge, this is the first report showing that MR blocking per se exerts favorable anti-atherosclerotic effects presumably due to reduction of oxidative stress and/or inflammation, independently of blood pressure and glucolipid metabolism. Therefore, we think that the data obtained in this study would be informative and useful in atherosclerosis research area as well as from the clinical point of view.

ApoE

apolipoprotein E

STZ

streptozotocin

triglyceride

LDL-C

low density lipoprotein cholesterol

HDL-C

high density lipoprotein cholesterol

ROS

reactive oxygen species

8-OHdG

8-hydroxy-2’-deoxyguanosine

Il-1β

interleukin 1β

Mcp-1

monocyte chemotactic protein-1

iNos

inducible nitric oxide synthase

Vcam-1

vascular cell adhesion molecule

Icam-1

intracellular adhesion molecule

Timp-1

tissue inhibitor metalloproteinase 1

Mmp-2

matrix metalloproteinase 2

Ethics approval and consent to participate: The study was approved by the animal use committee of Kawasaki Medical School (No. 23-037) and conducted in compliance with the animal use guidelines of Kawasaki Medical School.

Consent for publication: Not applicable.

Availability of data and materials: The datasets generated and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Competing interests: H.K. has received honoraria for lectures, received scholarship grants, and received research grant from Novo Nordisk Pharma, Sanofi, Eli Lilly, Boehringer Ingelheim, Taisho Pharma, Sumitomo Pharma, Takeda Pharma, Ono Pharma, Daiichi Sankyo, Mitsubishi Tanabe Pharma, Kissei Pharma, MSD, AstraZeneca, Astellas, Novartis, Kowa, Abbott. K.K. has been an advisor to, received honoraria for lectures from, and received scholarship grants from Novo Nordisk Pharma, Sanwa Kagaku, Takeda, Taisho Pharma, MSD, Kowa, Sumitomo Pharma, Novartis, Mitsubishi Tanabe Pharma, AstraZeneca, Boehringer Ingelheim, Chugai, Daiichi Sankyo, Sanofi. All other authors have no conflict of interests.

Funding: This work was supported by Research Project Grant from Kawasaki Medical School (No. R05-002 to Y.F.).

Authors’ contributions: H.I., J.S., T.K. and H.K. designed the experiments. H.I. performed the experiments and wrote the manuscript. J.S. and T.K. performed guidance and supervision of the experiments. J.S., T.K., M.S., Y.I., K.D., Y.F., Y.K., Y.N., Y.S., Y.Y., S.N., T.M. and K.K. participated in discussion. H.K. participated in discussion and reviewed the manuscript. All authors reviewed the manuscript and approved the submission of the final version of this manuscript.

Acknowledgements: We greatly thank Tomoko Ikeda for excellent technical assistance. We also thank central research institute of Kawasaki Medical School for technical supports of experiments.

Björkegren, JLM., Lusis, AJ. Atherosclerosis: Recent developments. Cell. 185, 1630-45 (2022)
Brownlee, M. Biochemistry and molecular cell biology of diabetic complications. Nature. 414, 813-20. DOI: 10.1038/414813a (2001)
Lee, J. et al. Interaction of IL-6 and TNF-α contributes to endothelial dysfunction in type 2 diabetic mouse hearts. PLoS One. 12, e0187189 (2017)
Kassan, M. et al. Enhanced NF-kappaB activity impairs vascular function through PARP-1-, SP-1-, and COX-2-dependent mechanisms in type 2 diabetes. Diabetes. 62, 2078-87. DOI: 10.2337/db12-1374 (2013)
Belmadani, S., Palen, DI., Gonzalez-Villalobos, RA., Boulares, HA., Matrougui, K. Elevated epidermal growth factor receptor phosphorylation induces resistance artery dysfunction in diabetic db/db mice. Diabetes. 57, 1629-37. DOI: 10.2337/db07-0739 (2008)
Zhang, H., Dellsperger, KC., Zhang C. The link between metabolic abnormalities and endothelial dysfunction in type 2 diabetes: an update. Basic Res Cardiol. 107, 237. DOI: 10.1007/s00395-011-0237-1 (2012)
Sena, CM., Pereira, AM., Seiça, R. Endothelial dysfunction - a major mediator of diabetic vascular disease. Biochim Biophys Acta. 1832, 2216-31. DOI: 10.1016/j.bbadis.2013.08.006 (2013)
Huynh, DTN., Heo, KS. Therapeutic targets for endothelial dysfunction in vascular diseases. Arch Pharm Res. 42, 848-861. DOI: 10.1007/s12272-019-01180-7 (2019)
Odegaard, AO. et al. Oxidative stress, inflammation, endothelial dysfunction and incidence of type 2 Diabetes. Cardiovasc Diabetol. 15, 51. DOI: 10.1186/s12933-016-0369-6 (2016)
Gisterå, A., Hansson, GK. The immunology of atherosclerosis. Nat Rev Nephrol. 13, 368-80. DOI: 10.1038/nrneph.2017.51 (2017)
Spitz, C. et al. Regulatory T cells in atherosclerosis: critical immune regulatory function and therapeutic potential. Cell Mol Life Sci. 73, 901-22. DOI: 10.1007/s00018-015-2080-2 (2016)
Ammirati, E., Moroni, F., Magnoni, M., Camici, PG. The role of T and B cells in human atherosclerosis and atherothrombosis. Clin Exp Immunol. 179, 173-187. DOI: 10.1111/cei.12477 (2015)
Ohashi, R., Mu, H., Yao, Q., Chen, C. Cellular and molecular mechanisms of atherosclerosis with mouse models. Trends Cardiovasc Med. 14, 187-190. DOI: 10.1016/j.tcm.2004.04.002 (2004)
Lusis, AJ. Atherosclerosis. Nature. 407, 233-241. DOI: 10.1038/35025203 (2000)
Schiffrin, EL., Effects of aldosterone on the vasculature. Hypertension. 47, 312–318. doi: 10.1161/01.HYP.0000201443.63240.a7 (2006)
Ana Paula, D., Iris Z, J., Rita C, Tostes., Frederic, J. New roles of aldosterone and mineralocorticoid receptors in cardiovascular disease: translational and sex-specific effects. Eric J Belin de Chantemele. Am J Physiol Heart Circ Physiol. 315, H989-H999. DOI: 10.1152/ajpheart.00073.2018. Epub 2018 Jun 29 (2018)
Adam P, M.et al. Aldosterone increases early atherosclerosis and promotes plaque inflammation through a placental growth factor-dependent mechanism. J Am Heart Assoc. 2, e000018. doi: 10.1161/JAHA.112.000018. (2013)
Bonnard, B. et al. Mineralocorticoid receptor antagonism improves diastolic dysfunction in chronic kidney disease in mice. J Mol Cell Cardiol. 121, 124-133. DOI: 10.1016/j.yjmcc.2018.06.008 (2018)
Kolkhof, P. et al. Finerenone, a novel selective nonsteroidal mineralocorticoid receptor blocker protects from rat cardiorenal injury. J Cardiovasc Pharmacol. 64, 69-78. DOI: 10.1097/FJC.0000000000000091 (2014)
Sanada, J. et al. Dulaglutide exerts beneficial anti atherosclerotic effects in ApoE knockout mice with diabetes: the earlier, the better. Sci Rep. 11, 1425. DOI: 10.1038/s41598-020-80894-x (2021)
Nguyen Dinh Cat, A., Montezano, AC., Burger, D., Touyz, RM. Angiotensin II, NADPH oxidase, and redox signaling in the vasculature. Antioxid Redox Signal. 19, 1110-1120. DOI: 10.1089/ars.2012.4641 (2013)
Li, W. et al. Long-term spironolactone treatment reduces coronary TRPC expression, vasoconstriction, and atherosclerosis in metabolic syndrome pigs. Basic Res Cardiol. 112, 54. DOI: 10.1007/s00395-017-0643-0 (2017)
Kratz, MT., Schirmer, SH., Baumhäkel, M., Böhm, M. Atherosclerosis. Improvement of endothelial function in a murine model of mild cholesterol-induced atherosclerosis by mineralocorticoid antagonism. Atherosclerosis. 251, 291-298. DOI: 10.1016/j.atherosclerosis.2016.06.018 (2016)
Raz-Pasteur, A., Gamliel-Lazarovich, A., Gantman, A., Coleman, R., Keidar, S. Mineralocorticoid receptor blockade inhibits accelerated atherosclerosis induced by a low sodium diet in apolipoprotein E-deficient mice. J Renin Angiotensin Aldosterone Syst. 15, 228-35. DOI: 10.1177/1470320312467558 (2014)
Pitt, B. et al. Cardiovascular Events with Finerenone in Kidney Disease and Type 2 Diabetes. N Engl J Med. 385, 2252-2263. DOI: 10.1056/NEJMoa2110956 (2021)
Bonnard, B. et al. Mineralocorticoid receptor antagonism improves diastolic dysfunction in chronic kidney disease in mice. J Mol Cell Cardiol. 121, 124-133. DOI: 10.1016/j.yjmcc.2018.06.008 (2018)
Kolkhof, P. et al. Finerenone, a novel selective nonsteroidal mineralocorticoid receptor blocker protects from rat cardiorenal injury. J Cardiovasc Pharmacol. 64, 69-78. DOI: 10.1097/FJC.0000000000000091 (2014)
Iwashima, F. et al. Aldosterone induces superoxide generation via Rac1 activation in endothelial cells. Endocrinology. 149, 1009-1014. DOI: 10.1210/en.2007-0864 (2008)
Newfell, BG. et al. Aldosterone regulates vascular gene transcription via oxidative stress-dependent and -independent pathways. Arterioscler Thromb Vasc Biol. 31, 1871-1880. DOI: 10.1161/ATVBAHA.111.229070 (2011)
Caprio, M. et al. Functional mineralocorticoid receptors in human vascular endothelial cells regulate intercellular adhesion molecule-1 expression and promote leukocyte adhesion. Circ Res. 102, 1359-1367. DOI: 10.1161/CIRCRESAHA.108.174235 (2008)
Muñoz-Durango, N. et al. Modulation of Immunity and Inflammation by the Mineralocorticoid Receptor and Aldosterone. Biomed Res Int. 652738. DOI: 10.1155/2015/652738 (2015)
Matsumoto, T., Kudo, M., Taguchi, K., Kobayashi, T. Effect of Nonsteroidal Mineralocorticoid Receptor Blocker Esaxerenone on Vasoreactivity to an Endothelial Stimulator in Superior Mesenteric Arteries of Type 2 Diabetic Goto-Kakizaki Rat. Biol Pharm Bull. 45, 1825-31. DOI: 10.1248/bpb.b22-00616 (2022)
Munkhjargal, U. et al. A Selective Mineralocorticoid Receptor Blocker, Esaxerenone, Attenuates Vascular Dysfunction in Diabetic C57BL/6 Mice. J Atheroscler Thromb, 30, 326-334. DOI: 10.5551/jat.63382 (2023)
Bavuu, O. et al. Esaxerenone, a selective mineralocorticoid receptor blocker, improves insulin sensitivity in mice consuming high-fat diet. Eur J Pharmacol. 931, 175190. DOI: 10.1016/j.ejphar.2022.175190 (2022)

Competing interest reported. H.K. has received honoraria for lectures, received scholarship grants, and received research grant from Novo Nordisk Pharma, Sanofi, Eli Lilly, Boehringer Ingelheim, Taisho Pharma, Sumitomo Pharma, Takeda Pharma, Ono Pharma, Daiichi Sankyo, Mitsubishi Tanabe Pharma, Kissei Pharma, MSD, AstraZeneca, Astellas, Novartis, Kowa, Abbott. K.K. has been an advisor to, received honoraria for lectures from, and received scholarship grants from Novo Nordisk Pharma, Sanwa Kagaku, Takeda, Taisho Pharma, MSD, Kowa, Sumitomo Pharma, Novartis, Mitsubishi Tanabe Pharma, AstraZeneca, Boehringer Ingelheim, Chugai, Daiichi Sankyo, Sanofi. All other authors have no conflict of interests.

SupTableScientificReports.docx

Download PDF

Editorial decision: Revision requested
12 Nov, 2024
Reviews received at journal
04 Nov, 2024
Reviews received at journal
24 Oct, 2024
Reviewers agreed at journal
20 Oct, 2024
Reviewers agreed at journal
16 Oct, 2024
Reviewers invited by journal
15 Oct, 2024
Editor assigned by journal
15 Oct, 2024
Editor invited by journal
13 Oct, 2024
Submission checks completed at journal
10 Oct, 2024
First submitted to journal
03 Oct, 2024

You are reading this latest preprint version

Blocking mineralocorticoid signaling with esaxerenone reduces atherosclerosis in ApoE KO mice without affecting blood pressure and glycolipid metabolism

Status:

Version 1

Abstract

Figures

Introduction

Methods

Animals and diets

Measurement of biochemical markers

RNA isolation and real time PCR

Histological and immunohistological analyses

Statistical analysis

Results

There was no significant difference in factors related to atherosclerosis between control and esaxerenone group

Esaxerenone treatment reduced oxidative stress and inflammatory cytokines in diabetic mice

Discussion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1