Increased activation of the WNT pathway in brain tissue from patients with cortical dysplasia type IIb: genetics and functional aspects

doi:10.21203/rs.3.rs-5199690/v1

Focal Cortical Dysplasia (FCD) is a malformation of cortical development characterized by a heterogeneous group of lesions with high epileptogenic activity. The origin of FCD may be related to neuronal proliferation and differentiation, with the Wnt/β-catenin pathway being one of the main factors responsible for mediating these processes. Residual samples were obtained from the neocortex of five patients diagnosed with FCD type IIb who underwent surgery. For the control group, residual samples from patients with hippocampal sclerosis (HS) were used. The samples were used to evaluate relative gene expression levels, immunohistochemical characteristics, and the quantification of proteins related to the WNT pathway by Western blot. Gene expression analysis showed increased fold-changes in the genes LRP5, LRP6, DKK1, and DVL1. Immunohistochemistry analysis revealed that the FCD brain samples exhibited more staining for LRP6 compared to control brain tissue. All patients with FCD showed stronger staining for β-catenin. The increased gene expression of WNT pathway genes, combined with the intensified anti-LRP6 antibody staining and increased β-catenin staining, along with the reduced rate of β-catenin phosphorylation observed in patients with FCD, suggests a more pronounced activation of the WNT pathway.

Biological sciences/Molecular biology

Biological sciences/Neuroscience

Health sciences/Medical research

Health sciences/Molecular medicine

Focal Cortical Dysplasia

WNT pathway

epilepsy

beta-catenin

LRP5

LRP6

Focal Cortical Dysplasia (FCD) is a malformation of the cerebral cortex accompanied by lesions with high epileptogenic activity and is one of the main causes of refractoriness to drug treatment 1. Its origin may be related to disturbances in neuronal proliferation and differentiation, resulting in a series of visible structural abnormalities in the cortical layers, which may or may not be accompanied by dimorphic neurons and balloon cells 2,3.

FCD is highly heterogeneous and can affect any region of the cortex. The most recent histological classification of FCD, proposed in 2022 by the International League Against Epilepsy (ILAE), distinguishes between FCD types I and II, which are characterized by cortical delamination and structural abnormalities. Dysmorphic neurons and balloon cells are found only in FCD type II during histopathological analysis. FCD type III is associated solely with cortical delamination and specific structural lesions, and is subdivided into four types: hippocampal sclerosis, brain tumors, vascular malformations, and lesions acquired early in life 5.

The Wnt/β-catenin pathway plays a key role in the development of the cerebral cortex by mediating processes of cell migration, cell proliferation, and cell fate specification, as well as maintaining the balance between cell proliferation and differentiation in the ventricular zone 6–8. Considering the importance of this pathway, new studies have been conducted to better understand the Wnt/β-catenin pathway in FCD. A study by Marinowic et al. found molecular changes in the Wnt pathway in dysplastic and perilesional tissue that were predictive of seizures in patients 9.

The main mechanism of action of the Wnt/β-catenin pathway is the inactivation of the β-catenin protein destruction complex, leading to the accumulation of β-catenin in the cytoplasm 10. In the absence of Wnt pathway signal transduction, β-catenin is degraded by a multiprotein complex. The activation signals of the canonical pathway are transmitted through the binding of the Wnt protein to seven-pass transmembrane Frizzled (FZD) receptors and to low-density lipoprotein receptor-related protein-5 or -6 (LRP5/6 coreceptors). This interaction promotes the recruitment of the Dishevelled protein (DVL), creating conditions conducive to the inactivation of the β-catenin destruction complex. This mechanism inactivates the GSK3β protein, resulting in the release of β-catenin from the multiprotein destruction complex 11. As a result, cytoplasmic β-catenin levels increase and translocate to the nucleus, where it interacts with the TCF/LEF complex, allowing the transcription of several genes responsible for regulating the cell cycle, proliferation, and cell adhesion. Dickkopf-related protein 1 (DKK1) is the main inhibitor of the Wnt/β-catenin pathway, and its C-terminal region binds to one of the four helices of LRP5/6, inhibiting the pathway 12,13.

Increased expression of WNT and c-MYC proteins has been observed in balloon cells and giant neurons in patients with FCD types IIa and IIb. This process is believed to be related to abnormal cellular and structural formation in the analyzed patients with FCD 14.

Here, we aimed to identify gene expression changes in the WNT signaling pathway in brain samples from patients with type IIB FCD. We focused primarily on the WNT pathway genes LRP5, LRP6, DKK1, and DVL1. We also assessed LRP6 protein levels on the cell surface and intracellular beta-catenin, including its phosphorylation rate. To correlate gene expression differences with clinical manifestations, we relied on patient records from the pre- and post-surgical phases.

Description of participants

Patients underwent the standard treatment offered in the epilepsy surgery program. In the control group, the decision to perform an anterior temporal lobectomy instead of an amygdalohippocampectomy was made by the program's medical team without the participation of the researchers. All patients or their guardians authorized the use of their biological material for research. No additional cortical fragments were removed during surgery. All patients involved had refractory epilepsy and were referred to the Epilepsy Surgery Program at Hospital São Lucas da PUCRS for resective surgery due to conditions of FCD (dysplasia group) and ELT-EH (control group). The clinical and demographic data of the patients are described in Table 1.

Table 1. Table with clinical data of study participants

Participant (origin)	FCD1	FCD2	FCD3	FCD4	FCD5	ELT1	ELT2	ELT3
Age at onset’	25 years	8 years	15 years	8 years	1 year	23 years	28 years	16 years
Seizure types	convulsions with staring and nonspecific sounds during sleep. Hypermotor seizures	Seizures during sleep, screaming followed by blinking. There is no loss of consciousness or muscle movements (tonic-clonic). Upper limb hypertonia (upper limbs).	Seizures with sensory aura on the right and evolution with simple motor crisis on the right and tonic-clonic crises	Asymmetric tonic attacks with extension of the right arm and right leg	Generalized tonic-clonic seizures during sleep and daily in times of stress. Tonic seizures of the left hemibody	Disconnection, altered thinking, aggression, and verbal outbursts; at times, wandering aimlessly	Generalized tonic-clonic seizures during sleep	Aura, automatisms, and epigastric discomfort
EEG	Continuous epileptform paroxysms in the left frontal region	Paroxysms and parietal epileptic seizures on the right	Parietal and occipital paroxysms on the lef	Left frontal paroxysms	Left parietal-center epileptiform activity	Right temporal lobe seizures	Epileptiform discharges in the right temporal lobe	Irritative activity in the right anterior temporal region
MRI findings (age at investigation)	Transmantic dysplasia in the upper and middle frontal region	Signal change and blurring of the white matter and cortico-subcortical interface of the right parieto-occipital transition	Change in signal and blurring of the cortico-subcortical interface of the left parietal lobe and transmantic dysplasia, compatible with malformation of cortical development	Thickening and changes in the cortico-subcortical transition of the left middle frontal gyrus with transmantle sign	Cortical thickening in the left parietal lobe with alteration of cortical gyri	Right mesial temporal sclerosis	Atrophy and signal alteration in the right hippocampus	Right mesial temporal sclerosis
Histology	IIB	IIB	IIB	IIB	IIB	No change*	No change*	No change*
Postoperative outcome	There are no clinical complications or epileptic seizures after surgery. Engel IA	There are no clinical complications or epileptic seizures after surgery. Engel IA	No seizures after surgery Engel IA	No seizures after surgery Engel IA	Had auras after surgery, currently 20 months without attacks Engel IB	No seizures after surgery	No seizures after surgery

Abbreviations: EEG= Electroencephalogram; MRI= Magnetic resonance imaging

* No histologic change in cortical sample used

Sample collection

Samples from the target population were obtained from different regions of the cerebral cortex of 5 patients (4 male and 1 female) aged 9 to 33 years who underwent surgery in the epilepsy program at Hospital São Lucas da PUCRS and were diagnosed with FCD, with histological evidence of FCD type II. Control group samples were obtained from the neocortex of 5 patients with temporal lobe epilepsy associated with hippocampal sclerosis (TLE-HS) who underwent anterior temporal lobectomy. The samples from the control group were histologically characterized as normal cortical tissue.

RNA extraction and cDNA synthesis

RNA was extracted from the cerebral cortex tissue of all samples using the SV-Total RNA Isolation System kit (Promega, Madison, Wisconsin, USA) according to the manufacturer's instructions. The extracted RNA was then converted into cDNA using the GoScript Reverse Transcriptase kit (Promega) following the manufacturer's instructions. Subsequently, the cDNA was quantified using a Qubit system to determine the recommended concentration for qRT-PCR analysis.

RT‒qPCR

RT-qPCR assays were performed using the PowerUp SYBR Green kit (Applied Biosystems) according to the manufacturer's instructions. Each reaction was conducted in duplicate, with an initial concentration of 20 ng of cDNA added to the master mix. Real-time PCR was performed using a StepOne Plus system (Thermo Fisher Scientific, Massachusetts, USA). Primers for the LRP5, LRP6, DKK1, and DVL1 genes were designed using the NCBI Primer-BLAST platform. The assays for each gene were conducted in 96-well plates, with NSE and ACTB genes used as endogenous expression controls. The sequences of the primers used are described in Table 2.

Immunohistochemistry

The samples were fixed in 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer (pH 7.4) for 24 hours at room temperature. They were then dehydrated and infiltrated with paraffin through 12 subsequent baths (4% PFA, 70% alcohol, 80% alcohol, 90% alcohol, 96% alcohol twice, xylene three times, and paraffin three times), each for 1 hour. The samples were then embedded in paraffin and stored at room temperature.

IHC staining

Slides were cut at 5 μm and fixed onto histological slides coated with (3-Aminopropyl) triethoxysilane. Deparaffinization was performed through subsequent baths in xylene (twice), 90% alcohol, 80% alcohol, 70% alcohol, and distilled water, with each bath lasting 5 minutes. Antigen retrieval was carried out in PBS at 70°C for 40 minutes, followed by blocking of nonspecific binding with a buffer containing 1% BSA, 5% SFB, and 0.2% Triton X-100 at room temperature for 30 minutes. The slides were then washed with PBS and incubated with the primary antibody (Rabbit Anti-LRP5, 1:200) diluted in buffer solution (1% BSA, 5% SFB, 0.2% Triton X-100) (100 μL per slide) at 4°C overnight. The slices were washed with PBS and incubated with the secondary antibody (Goat Anti-Rabbit Alexa Fluor™ 633 – A21070, 1:200) diluted in buffer solution (1% BSA, 5% SFB, 0.2% Triton X-100) (100 μL per slide) at room temperature for 1 hour. Finally, the slices were exposed to 4',6-Diamidino-2-Phenylindole Dihydrochloride (DAPI) for 5 minutes, followed by fixation with Canada balsam.

For each evaluation, 20 visual fields were randomly captured using a 200x objective lens. The images were quantified using the area markup parameter in Image-Pro Plus 7.0 software.

Western blotting

Cortex tissues from patients with FCD were lysed using RIPA buffer (50 mM Tris-HCl, pH 7.5; 150 mM NaCl; 0.5% sodium deoxycholate; 0.1% SDS; 1 mM EDTA; 1% Triton X-100; 10% glycerol) and phosphatase/protease inhibitors (Pierce™ Protease and Phosphatase Inhibitor Mini Tablets, Waltham, MA, USA, #A32959) for 30 minutes, followed by centrifugation for 15 minutes at 400 x g at 4°C. Tissue lysates were then mixed with Laemmli buffer (2% SDS, 10% glycerol, 5% 2-mercaptoethanol, 0.002% bromophenol blue, and 125 mM Tris-HCl, pH 6.8) and heated at 95°C for 5 minutes. The protein concentration was quantified using Qubit™ Protein Assay Kits (Thermo Fisher Scientific, Massachusetts, USA), and 40 μg of protein was used for each run. Protein samples were separated on SDS-PAGE gels and transferred to Immobilon-E membranes (Millipore, Burlington, MA, USA, #IEVH85R). The membranes were blocked for 1 hour with TBS-T containing 2% PVP (Polyvinylpyrrolidone, Sigma, Burlington, MA, USA), and then incubated with a primary antibody for 1 hour at room temperature or overnight at 4°C. The primary antibodies used for Western blot analysis included anti-β-catenin - 85kDa (1:500, MA5-15569 - Thermo Fisher Scientific, Massachusetts, USA), anti-phosphorylated β-catenin - 85kDa (1:500, #702374 - Thermo Fisher Scientific, Massachusetts, USA), and anti-GAPDH - 42kDa (1:3000, AM4302, Invitrogen). The Precision Plus Protein™ ladder, ranging from 10 kDa to 250 kDa (Bio-Rad, catalog no. 1610373), was used as the molecular weight marker. After three washes with TBS-T, the membranes were incubated for 1 hour with HRP-conjugated secondary antibodies (CST). The membranes were visualized by chemiluminescence using SuperSignal West Pico and West Femto (Thermo Fisher, Life Technologies Corporation, Carlsbad, CA, USA). Band intensities were quantified using ImageJ (National Institutes of Health, Bethesda, Maryland, USA) analysis software.

Data analysis

For analysis of the gene expression profile, ΔΔCt values were calculated using the Ct values of the NSE and ACTB genes as endogenous controls, compared to the Ct values of the target genes (DKK1, LRP5, LRP6, and DVL1). Samples from healthy brain tissue were used as reaction controls, while samples from brain tissue with FCD were assigned to the research group. The 2^-ΔΔCt method was used for HR generation. Additionally, an evaluation of the 2^-ΔCt values for each analyzed sample was performed, allowing for the construction of a heatmap and a correlation map.

For the Western blotting analysis, band intensity values were used for normalization through the ratio of GAPDH to β-catenin and phosphorylated β-catenin. For the analysis of β-catenin expression, the ratio of total to phosphorylated β-catenin was calculated to demonstrate the activation of the WNT pathway. Additionally, the percentage of β-catenin phosphorylation was calculated for the two groups analyzed. The Shapiro–Wilk and Anderson–Darling tests were used to determine data normality, and the Levene test was employed to assess data variance. The results indicated that the data were parametric and that the variances were not equal. Consequently, Welch ANOVA, followed by the Games-Howell post hoc test, was used.

Table 2. Primer sequences used in the PCR

Genes	sequence
LRP5	Forward: GGACACCAACATGATCGAGTCG Reverse: CGCTCAATGCTGTGCAGATTCC
LRP6	Forward: CAGTTGGAGTGGTGCTGAAAGG Reverse: CCATCCAAAGCAGCCCGTTCAA
DKK1	Forward: GGTATTCCAGAAGAACCACCTTG Reverse: CTTGGACCAGAAGTGTCTAGCAC
DVL1	Forward: GACCCTGTCATCTGTCCCAC Reverse: TTCAGACTGTTGCCGGATGG
NSE	Forward: CTGTATCGCCACATTGCTCAGC Reverse: AGCTTGTTGCCAGCATGAGAGC
ACTB	Forward: CACCATTGGCAATGAGCGGTTC Reverse: AGGTCTTTGCGGATGTCCACGT

Gene expression

Analyzing the fold-change values of the FCD group generated from the 2^-ΔΔCt equation using the cortical tissue of participants who underwent hippocampectomy (control tissue), there was an increase in the expression of the genes LRP5, LRP6, DKK1, and DVL1.

The mean 2^-ΔΔCt values for the FCD group were 2.25 for the LRP5 gene, 2.27 for LRP6, 2.23 for DKK1, and 1.58 for DVL1. The comparison of the 2^-ΔCt results between the FCD and control tissues was performed using 2^-ΔCt values. The results, presented as a heatmap, showed different values in the FCD brain tissue compared to the control brain tissue for the LRP5, LRP6, DKK1, and DVL1 genes (Figure 1).

Immunohistochemistry

Patients with FCD showed stronger anti-LRP6 antibody staining. The area marked in pixels per nucleus was 4.54 pixels, which was significantly different from the area marked in the control tissue, which was 0.41 pixels (p = 0.0101). The labeled area represents the ratio between the number of nuclei and the amount of staining in each captured field.

Western blotting

Brain tissue samples from patients with FCD showed increased β-catenin staining compared to the control. In the control group, the values for total β-catenin and phosphorylated β-catenin were very similar, with the calculated phosphorylation percentage being 97.5%. In FCD, there was a difference between total and phosphorylated β-catenin, resulting in a phosphorylation percentage of 65.7%. This difference was statistically significant between the groups (p = 0.008). The higher concentration of unphosphorylated β-catenin indicated that the canonical WNT pathway was more active in dysplastic brain tissue (Figure 2).

The increased activity of the WNT pathway in the brain tissue of patients can trigger distinct cellular responses, which are important for understanding the pathophysiology of seizures in patients with FCD.

Specifically, in relation to epilepsy, the main focus of research on the WNT pathway has been its relationship with the control mechanisms of neurogenesis induced by seizures and neuronal death in both the acute and chronic phases of the disease. Using various methods to induce seizures, several studies have found that elevated expression of WNT pathway components is associated with increased aberrant neurogenesis and neuronal death commonly observed following seizures 15. Modulation of the interaction between WNT receptors presents great potential as a therapeutic target for many diseases, such as osteoporosis, multiple myeloma, osteosarcoma, and melanoma 12. Additionally, modulation of the WNT pathway through DKK has shown protective effects against the progression of hippocampal sclerosis in a kainic acid-induced epilepsy model 16.

Relative expression analysis allows for the identification of differences in the amount of messenger RNA transcribed in the cytoplasm of cells. In this study, we analyzed the expression profiles of the genes LRP5, LRP6, DKK1, and DVL1 in the cortical tissue of patients with FCD type IIb compared to residual cortical tissue from patients with TLE-HS. Changes in gene expression may be due to several factors. The regulation of many genes in humans is related to the response to stimuli or stress, which can induce or reprogram gene transcription. Furthermore, the magnitude and duration of such responses are proportional to the time and severity of the disturbance, taking into account an individual's exposure to different simultaneous stresses 17.

The severity of drug-resistant epilepsy depends on several variables, such as etiology, seizure type, age at disease onset, time elapsed until surgery, location of the epileptogenic lesion, proximity to eloquent areas, and tolerance and response to medication. The numerous variables involved in the drug-resistant epilepsy phenotype prevent a definitive conclusion regarding the observed differences between the groups. However, we believe that these differences should be considered in future studies and offer a new perspective for evaluating cortical dysplasia 18. The study by Kalilani et al. evaluated several risk factors related to the development of refractory epilepsy, including age at seizure onset, etiology of epilepsy, and the presence of neuropsychiatric disorders. Additionally, factors such as a history of febrile seizures, status epilepticus, abnormal EEG, and abnormal neuroimaging results were also identified as being associated with an increased risk of refractory epilepsy 19.

Patients with FCD exhibited stronger staining for β-catenin, along with a lower rate of β-catenin phosphorylation, indicating higher activity of the WNT pathway. Regardless of gene expression behavior, the pathway was more active in all analyzed patients with FCD. In an animal model study, adult rats exposed to kainic acid-induced seizures showed increased levels of Wnt3a, β-catenin, and cyclin D1 in the hippocampus, with peak expression of these proteins occurring 14 days after the condition. Another study using a Wnt signaling reporter mouse strain (Topgal mice) revealed that Wnt/β-catenin signaling was increased in reactive astrocytes after focal cortical ischemia 20. Theilhaber et al. investigated the activation of functional pathways during hypoxic seizures using microarray profiling. The study revealed an increase in the gene expression of several components of the Wnt/β-catenin pathway, including genes for β-catenin (CTNNB1), the inhibitory protein SFRP2, the transducer Dvl3, the co-receptor LRP6, and components of the β-catenin regulatory complex such as CSNK1E, GSK3β, Axin2, and APC. Additionally, increases were observed in the gene expression of the ligands Frizzled, Wnt2, Wnt5a, and Wnt10a 21. The development of new antiseizure therapies that are not based on classical mechanisms of action, such as modulating the excitatory-inhibitory balance, has received extensive attention in recent years. Many indirect mechanisms can increase susceptibility to seizures by enhancing connectivity and communication between cells and nervous tissues 18. Therapeutic alternatives based on signaling pathways are innovative and offer new approaches for controlling seizures and chronic epilepsy 22.

The current sample size and the number of variables involved in the drug-resistant epilepsy phenotype do not allow for analytical statistical treatment that could determine the strength of the association between disease severity and molecular profiles. FCDs remain challenging entities, with a low response rate to medical treatments and the need for tailored resections to ensure the removal of all dysplastic lesions while avoiding eloquent regions. The classification of FCDs currently proposed by the ILAE is restricted to histopathological alterations 5.

The findings of this work, although preliminary, may offer new perspectives regarding diagnosis, classification, and treatment. In neuro-oncology, genetic and molecular criteria, as well as the new classifications of brain tumors, have become the determinants for tumor classification, as biological behavior is more closely related to these variables than to histopathology 23. In the case of FCDs, the current classification is entirely based on histopathology. This study, although seminal, appears to suggest a similar direction of clinical-biological-molecular correlation, revealing differences in gene expression levels, receptor numbers, and canonical WNT activation in dysplastic brain tissue.

Author Contributions

Conceptualization: F.J.V., F.A.C.X., D.R.M., E.P.; Methodology: F.J.V., F.A.C.X., D.R.M., E.P., G.Z., D.C.M.; Writing – original draft: F.J.V., F.A.C.X., D.B.P., D.R.M.; Writing – review & editing: F.J.V., F.A.C.X., G.Z., J.I.B.G., T.T.R.P., D.B.P., N.G.P.N., E.P., W.A.M., A.P., A.S.S., J.G.A., K.S.L., D.C.M., J.C.C., D.R.M.; Data curation: G.Z., W.A.M., A.S.S.; Formal analysis: J.I.B.G., W.A.M.; Investigation: J.I.B.G., J.G.A.; Supervision: D.R.M; E.P.

Funding

This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) – Brazil – Finance Code 001.

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.

Data Availability

All data generated or analysed during this study are included in this published article [and its supplementary information files].

Ethics approval

This study was approved by the Research Ethics Committee of the Pontifical Catholic University of Rio Grande do Sul (CAAE: 19776619.9.0000.5336, approval number: 3.577.035). All participants signed a free and informed consent form in accordance with Resolution No. 466/12 of the National Health Council of Brazil. For patients under 18 years of age, the form was signed by their parents or guardians.

Palmini A, Gambardella A, Andermann F, et al. Intrinsic epileptogenicity of human dysplastic cortex as suggested by corticography and surgical results. Ann Neurol.37(4),476-487. doi:10.1002/ana.410370410 (1995).
Brown WH, Neill JRO, Pate RR. Acesso público HHS Manuscrito do autor.(607),1-14. doi:10.1002/ana.24793.Malforma (2018).
Guerreiro MM. Malformations of cortical development. Arq Neuropsiquiatr.67(2 B),570-574. doi:10.1590/S0004-282X2009000300041 (2009).
Blümcke I, Thom M, Aronica E, et al. The clinicopathologic spectrum of focal cortical dysplasias: A consensus classification proposed by an ad hoc Task Force of the ILAE Diagnostic Methods Commission. Epilepsia.52(1),158-174. doi:10.1111/j.1528-1167.2010.02777.x (2011).
Najm I, Lal D, Alonso Vanegas M, et al. The ILAE consensus classification of focal cortical dysplasia: An update proposed by an ad hoc task force of the ILAE diagnostic methods commission. Epilepsia. 63(8),1899-1919. doi:10.1111/epi.17301 (2022).
Kilander MBC, Dahlström J, Schulte G. Assessment of Frizzled 6 membrane mobility by FRAP supports G protein coupling and reveals WNT-Frizzled selectivity. Cell Signal.26(9),1943-1949. doi:10.1016/j.cellsig.2014.05.012 (2014).
Harrison-Uy SJ, Pleasure SJ. Wnt signaling and forebrain development. Cold Spring Harb Perspect Biol.4(7),1-11. doi:10.1101/cshperspect.a008094 (2012).
Noelanders R, Vleminckx K. How Wnt Signaling Builds the Brain: Bridging Development and Disease. Neuroscientist. 23(3),314-329. doi:10.1177/1073858416667270 (2017).
Marinowic DR, Zanirati GG, Xavier FAC, et al. WNT pathway in focal cortical dysplasia compared to perilesional nonlesional tissue in refractory epilepsies. BMC Neurol.23(1),1-11. doi:10.1186/s12883-023-03394-1 (2023).
Miller JR. Protein family review The Wnts. Gene. Published online.1-15 (2001).
Kerekes K, Bányai L, Trexler M, Patthy L. Structure, function and disease relevance of Wnt inhibitory factor 1, a secreted protein controlling the Wnt and hedgehog pathways. Growth Factors. 37(1-2),29-52. doi:10.1080/08977194.2019.1626380 (2019).
Cheng Z, Biechele T, Wei Z, et al. Crystal structures of the extracellular domain of LRP6 and its complex with DKK1. Nat Struct Mol Biol. 18(11),1204-1210. doi:10.1038/nsmb.2139 (2011).
Rothbächer U, Lemaire P. Crème de la Kremen of Wnt signalling inhibition. Nat Cell Biol. 4(7),172-173. doi:10.1038/ncb0702-e172 (2002).
Kumari K, Sharma MC, Kakkar A, et al. mTOR pathway activation in focal cortical dysplasia. Ann Diagn Pathol. 46,151523. doi:10.1016/j.anndiagpath.2020.151523 (2020).
Yang J, Zhang X, Wu Y, et al. Wnt/β-catenin signaling mediates the seizure-facilitating effect of postischemic reactive astrocytes after pentylenetetrazole-kindling. Glia.64(6),1083-1091. doi:10.1002/glia.22984 (2016).
Busceti CL, Biagioni F, Aronica E, et al. Induction of the Wnt inhibitor, Dickkopf-1, is associated with neurodegeneration related to temporal lobe epilepsy. Epilepsia.48(4),694-705. doi:10.1111/j.1528-1167.2007.01055.x (2007).
López-Maury L, Marguerat S, Bähler J. Tuning gene expression to changing environments: From rapid responses to evolutionary adaptation. Nat Rev Genet. 9(8), 583-593. doi:10.1038/nrg2398 (2008).
Lucke-Wold BP, Nguyen L, Turner RC, et al. Traumatic brain injury and epilepsy: Underlying mechanisms leading to seizure. Seizure. 33,13-23. doi:10.1016/j.seizure.2015.10.002 (2015).
Kalilani L, Sun X, Pelgrims B, Noack-Rink M, Villanueva V. The epidemiology of drug-resistant epilepsy: A systematic review and meta-analysis. Epilepsia.59(12),2179–93. DOI: 10.1111/epi.14596 (2018).
Qu Z, Su F, Qi X, Sun J, Wang H, Qiao Z, et al. Wnt/β-catenin signalling pathway mediated aberrant hippocampal neurogenesis in kainic acid-induced epilepsy. Cell Biochem Funct. 35(7),472–6. https://doi.org/10.1002/cbf.3306 (2017).
Theilhaber J, Rakhade SN, Sudhalter J, Kothari N, Klein P, Pollard J, et al. Gene Expression Profiling of a Hypoxic Seizure Model of Epilepsy Suggests a Role for mTOR and Wnt Signaling in Epileptogenesis. PLoS One. 8(9), doi: 10.1371/journal.pone.0074428 (2013).
Huang C, Fu XH, Zhou D, Li JM. The Role of Wnt/β-Catenin Signaling Pathway in Disrupted Hippocampal Neurogenesis of Temporal Lobe Epilepsy: A Potential Therapeutic Target? Neurochem Res. 40(7),1319-1332. doi:10.1007/s11064-015-1614-1 (2015).
Louis DN, Perry A, Wesseling P, et al. The 2021 WHO classification of tumors of the central nervous system: A summary. Neuro Oncol. 23(8),1231-1251. doi:10.1093/neuonc/noab106 (2021).

No competing interests reported.

Increased activation of the WNT pathway in brain tissue from patients with cortical dysplasia type IIb: genetics and functional aspects

Status:

Version 1

Abstract

Figures

Introduction

Methods

Results

Discussion

Declarations

References

Additional Declarations

Status:

Version 1