Harnessing Haloarchaea from Halophyte Atriplex nummularia Rhizosphere to Enhance Salt Tolerance in Maize Seedlings

doi:10.21203/rs.3.rs-5200323/v1

Soil salinization is a critical global issue threatening agricultural productivity and significantly reducing the availability of arable land. Effective mitigation and recovery strategies are vital for sustaining food production, especially in the context of climate change. Halophytic plants, such as Atriplex nummularia, have shown potential for remediating saline soils, but their application remains limited. An alternative approach involves leveraging microorganisms adapted to saline environments to enhance plant stress tolerance. In this study, we investigated the microbiome of A. nummularia under saline and non-saline irrigation conditions to identify extremophilic microorganisms that promote salt stress tolerance. Through 16S rRNA analysis, we identified members of the genus Haladaptatus exclusively in the rhizosphere of salt-irrigated plants. These microorganisms were isolated and inoculated into maize crop systems to evaluate their ability to confer salt tolerance. Our results demonstrate that Haladaptatus strains significantly enhance salinity tolerance in maize, with a marked increase in the relative abundance of archaeal 16S rRNA in soils as NaCl irrigation levels rise. This study provides the first evidence that Haladaptatus, an archaeon isolated from the rhizosphere of a halophyte, can significantly enhance salt tolerance in an agriculturally important crop. These findings suggest a promising biotechnological application for improving crop resilience in saline environments, offering a sustainable strategy for addressing soil salinization and securing food production in the context of global climate challenges.

Archaea

plant-microbiome

salinity

Atriplex nummularia

Haladaptatus

Soil salinization has emerger as a problematic abiotic stressor in woldwide, leading to a decline in global crop productivity, promoting desertification, and reducing arable land[1–4]. From 1986 to 2016, soil salinity increased by 100 million hectares globally and continues to expand, driven by the intensification of agricultural and fertilizer practices[5–6]. This scenario is particularly alarming in regions where agriculture is the cornerstone of economic stability and food security[7].

Salt accumulation significantly impacts glycophytic plants, such as maize, by increasing sodium and chloride concentrations in the soil. This leads to substantial agricultural production losses, primarily due to ionic and osmotic stress caused by soil salinization[8–11]. Conversely, halophytic plants such as Atriplex nummularia require a specific salt concentration in the soil for optimal development. They possess potent mechanisms for the phytoremediation of saline areas, absorbing salts directly from the rhizosphere and accumulating them in their leaves [12]. Moreover, the strategic use of halophytes in bioremediation projects has been highlighted as a viable approach for reclaiming saline soils, thereby mitigating the environmental and economic impacts of soil salinization [13].

In response to environmental stresses, plants establish beneficial relationships with microbes, hosting a complex associated community. This community has the potential to enhance plant growth and improve mechanisms such as nutrient and mineral uptake, nitrogen fixation, and phytohormone production. Additionally, these microorganisms play a key role in protecting plant against pathogens and significantly bolstering the well-being and salt tolerance of halophytes [14–16]. Therefore, while some halotolerant and halophilic microorganisms, including Bacillus, Halobacillus, Halomonas, and Salinibacter, have been widely explored for their ability to promote salt stress tolerance in plants, the potential of archaea in interacting with plants and protecting them against biotic and abiotic stress remains underinvestigated. Specifically, the interaction between plants and haloarchaea warrants further exploration [17–19].

This microbial group thrives under extreme conditions characterized by high salt concentrations and elevated temperatures [20]. Their unique metabolic pathways and stress response mechanisms offer a rich source for biotechnological applications, especially in developing bioinoculants for saline agriculture [21]. These microorganisms, belonging to the archaea domain, possess mechanisms for regulating the intracellular concentration of Na + and Cl- ions, enabling them to flourish in environments with salt concentrations exceeding 25% [11, 22–23].

Recent studies suggest that Archaea should be recognized as an essential component of microbiome analysis, given their beneficial potential in interacting with their host and their involvement in plant health and nutrient cycling [18, 24]. Additionally, due to the adaptation mechanisms, halophilic archaea represent a promising biotechnology source of novel enzymes and other bioactive compounds that operate under stress conditions, including varying temperatures, high salt concentrations, and pH levels, which pose limitations for other microorganisms [25–26].

The potential of archaea in assisting plants has recently garnered attention trouht unveiling their role in inducing resistance against both abiotic and biotic stress factors, such as cobalt exposure, salinity, and water restriction. However, the limited number of studies hinders a comprehensive understanding of the potential of archaea in agricultural systems [27–29]. Consequently, these findings suggest a broader application of archaea in agriculture, expanding beyond the mitigation of salt stress to address challenges associated with climate change. This opens a new frontier in exploring the role of archaea in plant-microbe interactions, stress mitigation, and environmental bioremediation, which could be pivotal for developing sustainable agricultural practices in saline and metal-contaminated soils.

However, the complex mechanism involved in the interaction between plants and archaea remain enigmatic, primarily due to the challenges associated with cultivating and deploying these microorganisms in agriculture [30]. Despite these constraints, archaea have surfaced as a novel strategy to navigate extreme conditions and enhance sustainable agriculture [31].

Our hypothesis suggests that the rhizosphere of halophytic plants, such as Atriplex spp., hosts a specialized halophilic microbiome adapted to fluctuations in soil salt concentrations. This association are expected to stimulate growth and enhance salt tolerance. Thus, our study aims to assess the impact of saline irrigation on the microbiome of Atriplex nummularia and explore the potential of halophilic archaea isolated from the rhizosphere to induce salt tolerance in maize plants under greenhouse conditions. This approach represents a novel strategy for enhancing plant tolerance to abiotic stress through microbiome engineering.

Soil Sampling and Area Characterization

The soil samples were collected from two different sites (CEC and SNT) located in Petrolina city, Pernambuco state, Brazil, part of Caatinga Biome, (CEC, 9°04'04.6"S 40°19'04.0"W; SNT, 9°03'13.4"S 40°17'51.4"W). Samples were collected in triplicate from three distinct points at each site (Table 1) and were kept refrigerated during transport to the laboratory. At the SNT site, plants were irrigated with non-saline water, resulting in lower values for electrical conductivity, potassium content, and pH compared to the CEC site, indicating the absence of salinity in irrigation practices (Table 1).

Table 1 – The chemical characterization of soil sample

Sample		Determination of Soil Chemical Properties
Sample			C.E	pH	P	K	Na	Ca	Mg	H+Al	SB	CTC	V%	Cu	Fe	Mn	Zn
Field	Sample	Point	mS/cm ^-1		mg.dm^-3	cmol.dm ^-3								mg.dm^-3
CEC	Rhizosphere	P1	5.76	7.8	43.2	1.5	1.74	2.6	1.1	0	6.9	6.9	100	0.78	36.1	48.91	4.96
CEC	Rhizosphere	P2	5.55	8.1	63.51	2.07	1.92	2.3	1.2	0	7.5	7.5	100	0.79	37.82	48.06	7.07
CEC	Rhizosphere	P3	5.98	8.2	33.69	1.65	1.95	2	0.8	0	6.4	6.4	100	0.82	39.28	43.37	2.46
CEC	Bulk Soil	P1	6.51	8.1	97.21	0.84	0.75	3.7	1.5	0	6.8	6.8	100	0.59	38.54	58.65	4.86
SNT	Rhizosphere	P1	3.6	7.3	118.6	0.19	0.26	4.7	1.5	0	6.7	6.7	100	0.78	34.52	70.23	7.9
SNT	Rhizosphere	P2	1.43	7	29.59	0.2	0.16	2.2	1.1	0.2	3.7	3.9	93.8	0.7	32.22	48.76	3.78
SNT	Rhizosphere	P3	1.87	6.8	48.45	0.25	0.11	2.8	1.4	0.2	4.6	4.8	95	0.69	40.34	64.09	7.76
SNT	Bulk Soil	P1	2.77	8	77.33	2.82	2.58	4.6	1.6	0	11.6	11.6	100	0.87	43.54	68.56	4.77

Bacterial and Archaea Communities Assessment using 16S rRNA Amplicon Sequencing

The genomic DNA from the microbial community of rhizosphere soils and bulk soils was extracted using the PowerSoil DNA extraction kit (MoBio Laboratories Inc.) following the manufacturer's instructions. The concentration and purity were estimated using a NanoDrop®ND-2000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA). The integrity of the extracted material was confirmed by 1% agarose gel electrophoresis in TAE buffer (1X). The PCR reaction for the amplification of the 16S rRNA gene was conducted with a final volume of 25 μL, consisting of 13 μL of DNase-free ultrapure water, 10 μL Phusion master mix (final concentration 1X), 0.5 μL of primer 515FB (5′- GTGYCAGCMGCCGCGGTAA-3′) (final concentration of 0.2 μM), 0.5 μL of primer 806RB (5′-GGACTACNVGGGTWTCTAAT-3′) (final concentration of 0.2 μM), and 1 μL of genomic DNA (final concentration of 5 ng) (Caporaso et al., 2011). Amplification was conducted in a Veriti thermal cycler (Applied Biosystems, USA) under the following amplification conditions: 94°C for 5 min, followed by 30 cycles of 94°C for 30s, 57°C for 45s, 72°C for 1 min, and final extension of 72°C for 10 min. The size and specificity of the fragments obtained were verified by 1.5% agarose gel electrophoresis, and Illumina adapters were ligated in a PCR reaction (index Nextera XT Index Primer 1 (N7xx) and Nextera XT Index Primer 2 (S5xx)). The purification of PCR products was performed using AMPure XP Beads (Beckman Coulter, Life Sciences). Library quantification was performed with the KAPA Library Quantification kit for Illumina (Roche), and sequencing was performed on Illumina MiSeq equipment in 2x250 bp runs.

Bioinformatics and Data Analysis

The raw data were processed using Dada2 version 1.21.0 [32]. The primers were removed using Cutadapt version 3.4. Quality control was performed and reads of low quality (Q20 or lower) were discarded. To generate ASVs, chimera sequences were removed using the "removechimera" command in the DADA2 package. After data processing, the taxonomic classification was performed using the "AssignTaxonomy" function of the DADA2 package against the SILVA 138 v1.2 database. Sequences assigned as chloroplast or mitochondrial DNA were removed from the ASV table.

Data analyses were conducted in the R environment using the "vegan" and "phyloseq" packages unless otherwise stated. All analyses were based on rarefied data from the sample with the lowest coverage (25,000 reads) using the rrarefy function. Alpha and beta diversity metrics were used to assess the effect of saline irrigation on archaeal composition and diversity [33-34]. PCoA analyses were performed using the Bray–Curtis dissimilarity metric based on the abundance table. The Differentially enriched microbial groups were detected using Microbiome Processa packege the differential statistical results were acessed using the Kruskal Wallis test of the Microbial Process package [35]. The PERMANOVA was used to determine differences between treatments and collection points and ASVs affiliated with the Archaea domain were filtered for subsequent functional prediction analysis using Tax4Fun2 (36). Plots were generated using ggplot2 and microbial process package, and statistical comparisons regarding functional prediction were performed using the STAMP program [37].

The isolation of haloarchaea strainsv

The isolation of halophilic archaea was performed using 1 g of rhizospheric soil from A. nummularia of the CEC fild was added to an Erlenmeyer flask containing 50 mL of modified CMD medium (10 g/L glucose, 10 g/L sucrose, 1 g/L cellulose, 1 mL of pyruvic acid solution (1:1), pH 7.5) [38]. The soil was then incubated at 40°C at 180 rpm, and the enrichment samples were collected at 15-day intervals and inoculated onto a Petri dish containing solid CMD medium. The plates were incubated until the appearance of colonies and the resulting colonies were purified and cryopreserved at -80°C in a solution containing 20 mL of 30% salt water (NaCl 240 g/L, MgCl2.6H2O 30 g/L, MgSO4.7H2O 35 g/L, KCl 7 g/L, 1M Tris. Cl (pH 7.5) 5 mL) and 80 mL of glycerol PA, [38]. The archaeal strains were deposited in the Culture Collection of Microorganisms of Agricultural and Environmental Importance (CMAA) of Brazilian Agricultura Research Corporation – EMBRAPA, Jaguariúna São Paulo State, Brazil.

Identification of isolates using 16S rRNA gene sequence

The isolated strains were cultured in a CMD broth medium, and genomic DNA was extracted using a Wizard® Genomic DNA Extraction kit (Promega, USA) according to the manufacturer's instructions. The 16S rRNA gene sequence was amplified using the universal Archaea primers ARC 8f/ARC 1492r [39]. The PCR product was then purified using the Wizard® SV Gel and PCR Clean-Up System (Promega, USA). Sequencing was performed on an automated ABI Prism 3730 instrument using the BigDye Terminator Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA, USA) with the following primers: ARC 519r (GGTDTTACCGCGGCKGCTG), ARC 915r (GTGCTCCCCCGCCAATTCCT), ARC 1492r (GGCTACCTTGTTACGACTT), ARC 21f (TTCCGGTTGATCCYGCCGGA), ARC 344f (AYGGGGYGCASCAGGSG), and ARC 8f (TCCGGTTGATCCTGCC). The assembly and quality control of the sequences were performed using the software CodonCode Aligner Version 1.6. The partial or full-length 16S rRNA sequences were compared with those of reference strains in the NCBI [41] and EzBioCloud [40] databases for taxonomic classification. In addition, phylogenetic trees based on the full-length 16S rRNA gene sequences of type strains most closely related to the isolates were constructed using MEGA 11 software [42] with the neighbor-joining method [43] with default parameters. Bootstrap values were calculated using 1,000 replications. The sequence data for the strains were deposited in the NCBI database under accession number “PRJNA116850900"

Evaluation of potential halophilic archaea strain in mitigating salt stress in maize

The effects of halophilic archaea on plant protection against salinity were assessed under controlled conditions maintained at a constant temperature of 25°C, with a relative humidity of approximately 80%, and a 12-hour photoperiod, utilizing the EL011 - EletroLabⓇ system. The experimental tests were conducted in 1-liter pots filled with a soil-sand substrate mixture (1:1 ratio) in a completely randomized design with five replications per treatment. Six strains of archaea, both with and without salt treatment, were evaluated, alongside control groups: one without archaea and one with and without salt (Figura 1).

The archaeal strains were cultivated in liquid CMD medium with a modification to the NaCl concentration (110g/L NaCl, MgCl2.6H2O 20g/L; MgSO4.7H2O 15 g/L; KCl 5g/L). After growth, the broth containing the cell culture was centrifuged for 5 min at 10,000g, and the cells were suspended in a saline solution containing 0.85% NaCl (v/w) at a concentration of 10⁸ CFU (OD600_nm), which was adjusted using the NanoQuant Rchisto Infinite M200 PRO spectrophotometer. To assess cell viability, a 100 μL inoculation of the suspension onto solid CMD medium was conducted after exposure to the salinity solution for 1 hour. Subsequently, 10 mL of the inoculum of each strain was applied to the soil prior to planting maize seeds. Three days after the inicial application of the strains to the soil, ten seeds of hybrid maize (variety BM709PRO02 biomatrixⓇ) were planted per pot. Daily irrigation was carried out using sterilized distilled water. An automated irrigation system was programmed to perform irrigation automatically, dispensing 20 mL every 8 hours (60 mL/day). After seed emergence (7 days after planting), seven seedlings were thinned, leaving only three seedlings per pot. Irrigation was then initiated using a saline solution according to the following schedule: 7 days of irrigation with a 100 mM NaCl solution, followed by 7 days of irrigation with a 200 mM NaCl solution, and finally 7 days of irrigation with a 250 mM NaCl solution. Subsequently, continuous irrigation with a 250 mM NaCl solution was maintained until the appearance of the first symptoms in plants that did not receive the strains under the same conditions of saline irrigation. Chlorophyll levels were measured using the SPAD 502 Plus Chlorophyll Meter, and rhizosphere soil samples were collected during changes in salt concentrations during irrigation and stored in an ultra freezer (-80°C) for subsequent analysis of the archaeal 16S rRNA gene.

The effects of plant reactions to inoculation were evaluated by measuring the fresh weight and dry weight of shoots and roots, relative water content, and salt tolerance index. Statistical analyses, including ANOVA and t-test, were applied to determine differences between treatments. Dunnett’s test was then performed to compare each treatment against the control..

Investigating the Dynamics of Archaea in the Maize Rhizosphere During Salt Stress Mitigation

The copy number of the archaean 16S rRNA gene was quantified using quantitative PCR (qPCR) to evaluate the dynamics of Archaea in the maize rhizosphere throughout the experiment. Rhizospheric DNA was isolated from samples and diluted to a final concentration of 5 ng to ensure assay standardization.

Amplifications were performed in triplicate using SYBR Green on a Step One Plus instrument (Applied Biosystems) and white-walled 48-well plates. The qPCR reactions were performed using archaea primers (ARC 344F/ARC 915R). The amplification program consisted of an initial denaturation step at 95 °C for 5 min, followed by 40 amplification cycles of 1 minute at 95 °C, 1 minute at 60 °C, and 1 minute at 72 °C, and a final elongation step of 15s at 95°C and 1 min at 60°C for melting curve analysis. The standard curve was calculated using a pool of all samples with concentrations of 50 ng, followed by dilution to 10⁷ using 5 replicates for each concentration.

Genome Sequencing of Haladaptatus Strains

Genome sequencing was performed using a hybrid approach combining Nanopore and Illumina sequencing technologies . Quality control and adapter trimming were performed using bcl-convert version 3.9.3 for Illumina sequencing and porkchop version 0.2.3_seqan2.1.1 for ONT sequencing. The hybrid assembly of Illumina and ONT reads was performed using Unicycler version 0.4.8, and assembly statistics were recorded using QUAST version 5.0.2. Assembly annotation was performed using Prokka version 1.14.5 and RAST version 2.0. The quality of the genome assembly was checked using BUSCO. Phylogenetic annotation was performed using FastANI. The genoma circular view were creted using circus from web application https://www.bv-brc.org/. Pairwise sequence similarities were calculated using Type Strain Genome Server - TYGS. Phylogenies were inferred by the GGDC web server available at http://ggdc.dsmz.de/ using the DSMZ phylogenomics pipeline adapted to single genes [45].

The effect of salinity on the rhizosphere microbiome of Atriplex nummularia

A total of 832,221 reads with a coverage of approximately 30,000 reads per sample were recovered. After removing ASVs affiliated with unidentified phyla, mitochondria, and chloroplasts, 5,696 ASVs remained. The samples were normalized and rarefied to 25,377 reads per sample. Alpha and beta diversity analyses were then conducted to visualize the effects of saline irrigation on the rhizosphere community. The Salinity irrigation exhibited a significant effect on the rhizosphere microbiome, as evidenced by a decreased diversity index compared to non-saline irrigation. Even for a halophilic plant, the effects were distinct under both conditions. The statistical analysis revealed significant differences in the number of observed ASVs and the Chao1 richness index between the experimental fields CEC and SNT (ANOVA ONE-WAY, p-value < 0.05), particularly among rhizosphere samples (p < 0.001). However, a significat difference in the Shannon diversity index was only observed when comparing the CEC rizosphere to the SNT bulk soil, with other treatments showing no significant differences (Fig. 2b). Despite this, we noted lower diversity indices in the rhizosphere microbiome of CEC field plants that received saline irrigation (Fig. 2).

Beta diversity analyses indicated a strong influence of salinity on the rhizosphere microbiome of A. nummularia. Principal Coordinate Analysis (PCoA) revealed that the soil sample and rhizosphere from the two experimental sites grouped separately, with a significant effect of saline concentration in modulating the rhizosphere community between the experimental fields (P < 0.001) (Fig. 3A). The high dissimilarity observed in the samples from the CEC field, as opposed to the free soil collected from the same field, underscores the cumulative effect of salts in the rhizosphere of A. nummularia..

Intriguingly, we conducted beta diversity analysis separately, focusing solely on sequences affiliated with the Archaea domain. Principal Component Analysis (PCA) also unveiled a significant influence of saline irrigation on the archaeal community in the rhizosphere samples from the CEC field, as indicated by pronounced dissimilarity (Fig. 3B). These findings suggest that enriched archaeal groups may play a role in processes related to soil salts and, consequently, contribute to stress mitigation in A. nummularia plants.

Microbial composition and enrichment of halophilic archaea in the rhizosphere of Atriplex nummularia under saline irrigation

To evaluate variations in microbial composition among samples, comparative analyses were performed on the relative abundance of the most enriched microbial groups. In both high- and low-salinity samples, the phyla Proteobacteriota and Actinobacteriota were dominant (see Fig. 4). However, compositional variations were observed amomg the samples. The abundance of Firmicutes phylum decreased in the rhizosphere with saline irrigation, contrasting with the CEC bulk soil where it was the most abundant phylum. Proteobacteriota and Actinobacteriota emerged as the bacterial phyla with the highest abundance (FIGURE-4).

In the context of Archaea, the phylum Crenarchaeota was present across all samples, with Candidatus Nitrocosmicus being the most abundant genus in both soil and rhizosphere samples (FIGURE-4). Nevertheless, differential abundance analyses revealed a significant enrichment (p < 0.05) exclusively in halophilic archaeal groups belongin to the genus Haladaptatus in salt-irrigated field (CEC), correlating with the direct accumulation of salts in the rhizosphere of A. nummularia (FIGURE 5). Functional prediction analyses were conducted on ASVs belonging to the Archaea domain to explore potential functional attributes that halophilic groups associated with of A. Nummularia rhizosphere might utilize in mitigating salt stress.

Functional Diversity of Archaeal Communities in Rhizosphere of A. numularia under Salt Stress

Using Tax4fun2, we conducted a prediction of the potential functional attributes within the archaeal communities of the A. nummularia rhizosphere, spotlighting crucial functions for salt stress tolerance. Intriguingly, cluster analyses unveiled a notable divergence in functional profiles between the samples from CEC and SNT fields. The rhizosphere archaeal community from the CEC field exhibited enriched functionality associated with sugar transport mechanisms, synthesis of protective osmolytes (e.g., glycine, proline, and choline), and the H+:K transport system. In contrast, the SNT field rhizosphere revealed a pronounced abundance of functions related to polysaccharide metabolism, chaperones, and aquaporins (P < 0.05) (FIGURE-6). These findings illuminate the diverse functional strategies employed by halophilic archaea in the rhizosphere of salt-accumulating sites, potentially acting as a mitigative force against the detrimental effects of salt stress on A. nummularia plants.

Isolation and identification of halophilic archaeal strain

To delve into the functional role of the rhizosphere community and recognizing the potential of the genus Haladaptatus in processes potentially related to the osmotic regulation of A. nummularia, we implemented a meticulous strategy unfolded to enrich rhizosphere soils from the field, with the goal of isolating of strains belong to this microbial group. The crafted enrichment strategy aimed to isolate halophilic archaeal strains in a culture medium, resulting in the successful isolation of six strains with robust growth potential across a spectrum of salt concentrations (6–30%, w:v) and temperatures (30°C to 50°C).

Taxonomic affiliation was determined through sequencing the 16S rRNA gene, revealing spanning from 93.61–97.89% with the genus Haladaptatus (see Table 2). The phylogenetic tree, constructed from sequences most closely related, delineates the evolutionary relationships of lineage CMAA 1924 with the species Haladaptatus paucihalophilus and Haladaptatus litoreum (refer to FIGURE 7). Strains CMAA 1908, CMAA 1924, CMAA 1911, CMAA 1909, CMAA 1928, and CMAA 1923 coalesced into a distinct clade, hinting at a possible affiliation as a new species. These strains exhibit similar morphological growth in the medium with a range of 10 to 27% NaCl concentration. Interestingly, some salt crystals were forming during the growth of certain strains (see FIGURE 7).

Table 2

Taxonomic identification based on the 16S rRNA gene of archaea against the Eztaxon database.
Strain	Top-hit taxon		Similarity (%)
CMAA 1923	DX253		95.72	Archaea;Euryarchaeota;Halobacteria;Halobacteriales;Halobacteriaceae;Haladaptatus
CMAA 1909		DX253	96.67	Archaea;Euryarchaeota;Halobacteria;Halobacteriales;Halobacteriaceae;Haladaptatus
CMAA 1911	DX253		93.61	Archaea;Euryarchaeota;Halobacteria;Halobacteriales;Halobacteriaceae;Haladaptatus
CMAA 1928	DX253		96.32	Archaea;Euryarchaeota;Halobacteria;Halobacteriales;Halobacteriaceae;Haladaptatus
CMAA 1908	DX253		97.49	Archaea;Euryarchaeota;Halobacteria;Halobacteriales;Halobacteriaceae;Haladaptatus
CMAA 1924	DX253		97.89	Archaea;Euryarchaeota;Halobacteria;Halobacteriales;Halobacteriaceae;Haladaptatus

Effects of soil inoculation with Haloadaptatus strains on maize seedlings under saline conditions

The evaluation of archaeal inoculation revealed a significant increase in fresh biomass (Tukey's test at 5%) in plants treated with Haloadaptatus strains compared to the control. The most notable enhancements were observed in plants treated with the archaea strains CMAA 1923, CMAA 1909, and CMAA 1924 (FIGURE-9B). This surge in fresh weight likely corresponds to enhanced water accumulation in response to salt stress. However, non-inoculated plants exhibited more severe symptoms under 250 mM NaCl irrigation, indicating heightened susceptibility to osmotic stress induced by saline irrigation (FIGURE-8).

Moreover, plants inoculated with haloarchaea exhibited increased root and shoot dry biomass content. Strains CMAA 1911 and CMAA 1909 showed enhanced dry biomass compared to control plants upon inoculation. Treatments involving CMAA 1908, CMAA 1928, and CMAA 1923 resulted in elevate plant fresh weight relative to the control (FIGURE-9A). Under salt stress conditions, all strains enhanced root development, with strains CMAA 1911 and CMAA 1923 achieving the highest dry weight among treatments, showing significant differences (p < 0.001). The remaining strains displayed varied increments in root biomass (FIGURE-9B), albeit values surpassing those of the control. Strain CMAA 1923 particularly exerted a stronger effect on the root than the on the aboveground compartment (FIGURE-9). Overall, inoculated plants exhibited superior development under salt stress (FIGURE 8). No statistical differences (p > 0.05) were observed in shoot length between treatments (FIGURE-9D)

Chlorophyll measurements indicated a decline in the photosynthetic capacity of maize plants corresponding to higher NaCl concentrations in the irrigation water. Nonetheless, inoculated plants displayed an enhanced photosynthetic response and more effective mitigation of salinity effects, as evidenced by their chlorophyll levels (FIGURE 10). The most significant effect on Chlorophyll was observed under 250 mM NaCl irrigation. Inoculation with isolates CMAA 1924 and CMAA 1909 resulted in elevated chlorophyll levels in plant leaves. Notably, plants inoculated with strain CMAA 1908 exhibited elevated chlorophyll levels only after the initiation of saline irrigation. The most notable difference in chlorophyll levels emerged in plants irrigated with 250 mM NaCl. Control treatment experienced a reduction of approximately 25% in their initial chlorophyll levels compared to those irrigated without saline after 24 hours of irrigation with 250 mM NaCl.

Unveiling the population dynamics of archaea inoculation in maize rhizosphere under saline irrigation

The qPCR analyses unveiled a direct correlation between the 16S gene copy number in the rhizosphere of inoculated plants and the progressively increasing saline irrigation (Fig. 11), whereas it remained stable in rhizosphere samples from non-inoculated plants. A surge in the number of copies became apparent from the second collection with the initial saline irrigation of 100 mM NaCl. However, significant differences in the archaea population in the rhizosphere of the different treatments demonstrate a distinct colonization potential and density among the strains in the maize rhizosphere. Interestingly, population enrichment was more evident after irrigation treatment with 200mM NaCl (third sampling).

The rhizosphere of plants inoculated with strains CMAA 1908, CMAA 1928, CMAA 1909, and CMAA 1923 displayed the highest copy numbers following irrigation with 200mM and 250mM NaCl (FIGURE – 11). However, a decline in copy numbers coincided with seedlings exhibiting symptoms of salt-induced damage, except in treatments with strains CMAA 1928, CMAA 1911, and CMAA 1923CMAA 1923, which maintained a more stable archaea population even during the period of incrementally increasing salt irrigation (FIGURE 11).

Genome sequencing and annotation of potential mechanisms for plant salt tolerance induction in Haladaptatus strains

Whole-genome sequence analysis of the strains provided reliable taxonomic classification and identified genes or pathways potentially contributing to the plant response to salinity stress. The strain exhibited the closest relation to the genus Haladaptatus, with 87% similarity according to the GBDT. Protein-encoding genes included those implicated in potassium, nitrogen, phosphorus, and iron metabolism, all associated with promoting plant growth. Strains CMAA 1911 and CMAA 1909 harbored genes related to carotenoids, phytoene synthase, and L-tryptophan, directly correlating with phytohormone production. The pairwise ANI similarity between strains CMAA 1911 and CMAA 1909 was 99.95%, with some gene differences, primarily those related to osmotic and oxidative stress. The CMAA 1909 genome contains 246 genes encoding for oxidative stress, while CMAA 1911 has approximately 334 genes. Notably, the CMAA 1911 genome carries a higher number of osmotic stress genes compared to CMAA 1909 (109 and 56, respectively) (FIGURE 12D). Additionally, genes encoding amino acid biosynthesis, such as arginine, cysteine, and methionine, crucial for plant development under salinity stress, were identified. A gene cluster related to the production of compatible solutes, such as trehalose, betaine, proline, and ectoine, exhibited a strong connection to the mechanisms of uptake, transport, and synthesis. The SEED functional subsystem pinpointed key roles in the strain's potential to induce plant salt tolerance. Strain CMAA 1911 harbored 59 genes associated with plant hormone production via auxin and tryptophan synthase, while strain CMAA 1909 possessed 35 essential metabolic genes known to enhance the root system.

Microorganisms play a crucial role in shaping ecologically sustainable and efficient crop management systems. To devise effective strategies for their optimal utilization in agricultural production, it is imperative to delve into their unique characteristics, including resilience to hursh environments, genetic diversity, and the potential to associations with cultivated plants (46–47). Employing microbial bioinoculants in saline soils offers a means to mitigate saline stress, promote plant development, and enhance disease resistance (48–49).

Harnessing the potential of microorganisms in saline environments, farmers can effectively manage and mitigate the impacts of abiotic stress on crop [50]. They can improve soil health, nutrient uptake, and water utilization, ultimately resulting in increased yield and profitability. Studies have highlighted the promising role of growth-promoting rhizobacteria (PGPR) isolated from halophyte and halotolerant plant species as enhancers of crop growth in saline-affected agricultural areas. [48, 51–54].

In this study, delving into the microbiome of plants acclimatized to saline stress conditions, exemplified by the halophyte plant A. nummularia, unveiled a significant potential for bio-protection by microorganisms suitable for agricultural use in salinity conditions. This can be largely attributed to the community's adaptation to osmotic regulation and its ability to survive under these conditions [55].

The metataxonomic approach was employed to investigate the effects of saline irrigation on the rhizosphere microbiome of the halophyte plant A. nummularia cultivated in experimental fields in the brazilian Caatinga biome. The findings revealed a reduction in both diversity and richness of the microbial community in the rhizospheres of plants subjected to saline irrigation. It is important to note that even minimal salt quantities in the soil could suffice to influence the biological community of a given environment [19]. This observation also indicates the recruitment and maintenance of a specialized halophilic microbiome adept at mitigating the adverse effects of saline stress through potential regulatory mechanisms, with osmotic regulation playing a crucial role in adapting to stress levels.

Consequently, recruiting and interacting with a rhizosphere microbiome more specialized to these conditions may assist the development and growth of Atriplex under the stress conditions imposed by elevated environmental salt concentrations. Benidire et al., observed that differences in genus composition between environments are mainly associated with salinity's influence on the population size of dominant species and the selection of subdominant taxa that are more specialized or tolerant to increased soil salinity [56]. The abundance analysis revealed the impact of salinity on the taxonomic composition of the A. nummularia rhizosphere microbiome. There was an enrichment of the phyla Proteobacteria and Actinobacteriota, which commonly dominate in saline soils and semi-arid [57–58], as well as the predominant archaea from the Halobacteriaceae family with halophilic characteristics.

Microorganisms, including bacteria, fungi, protists, and archaea, serve as vital functional components of the plant microbiome and can found in both the rhizosphere and endosphere [18]. Although relatively unexplored, these groups of microorganisms may play a crucial role in promoting plant growth, providing essential nutrients, and protecting against various abiotic stresses [20, 59]. The exclusive presence of halophilic archaea Haladaptatus in the rhizosphere of A. nummularia cultivated under high salt concentrations underscores its potential role in helping the host mitigate the deleterious effects of salt stress. Haladaptatus spp. isolated from saline environments showcases robust adaptive potential to survive adverse environmental conditions [ 60].

The enrichment of functional categories related to the transport of osmoprotective sugars, such as proline, betaine, glycine, and trehalose, along with the H⁺: K⁺ transport system, suggests that salinity modulates a rhizosphere community with enhanced osmoregulatory potential. Indeed, osmoadaptation mechanisms in halophilic members of the order Halobacteriales, particularly Haladaptatus, involve the synthesis and absorption of compatible solutes, such as glycine-betaine [61–63].

In addition to investigating the impacts of salinity in modulation the A. nummularia microbiome, greenhouse experimental was conducted to assess the potential of Haladaptatus strains hosting the A. nummularia rhizosphere, in alleviating saline stress in maize. Following the inoculation of the strains into the soil, significant effects were observed in inducing tolerance to saline stress in maize seedlings subjected to irrigation with a gradual increase in NaCl concentration (100mM, 200mM, and 250mM).

It is well understood that elevated salt concentrations in the soil reduce the plant's photosynthetic capacity, inhibiting or diminishing leaf growth and accelerating senescence [55, 64–65]. However, the inoculated plants exhibited enhanced development despite the deleterious effects of salinity, primarily fostering an increase in root biomass, which improve the nutrient acquisition and stress tolerance. Additionally, leaves of seedlings grown in previously inoculated soil also displayed higher SPAD levels, indicating greater photosynthetic capacity.

The application of plant growth-promoting bacteria (PGPB) involves several knowledge gaps concerning their interaction mechanisms and beneficial effects on plant growth and health, including their ability to colonize the rhizosphere and thrive under varying environmental conditions [65]. Therefore, when developing and applying bioinoculants, it is crucial to consider the capacity of plant growth-promoting rhizobacteria (PGPR) to successfully compete and colonize the rhizosphere. In this study, although the specific interaction mechanisms remained elusive due to their complexity, the successful colonization capacity of Haladaptatus strains in the maize rhizosphere was evidenced by increase of the 16S rRNA gene copy number, as determined by QPCR analyses. The population dynamics varied according to the strain and NaCl concentration of soil. Haloarchaeal groups are known for their adaptability to fluctuations in in external osmolarity [67]. However, the mechanisms governing the interaction between plants and archaea, as well as their establishment in the rhizosphere environment still remain unknown. The colonization potential of different strains correlated with the gradual increase in saline concentration. Interestingly, plants displaying improved physiological responses and growth were inoculated with strains CMAA 1908 and CMAA 1923 boasting, which boasted a higher population density in the rhizosphere compartment. This correlation suggests a direct contribution to the development of plant-associated functions aimed at mitigating the effects of salts on growth.

Recent studies have shed light on the significant presence of archaea in plant-associated ecosystems, both above- and below-ground phytobiomes. Despite being relatively underexplored and often overlooked in plant microbiomes, their widespread association with plants suggests an as-yet-unknown role in host health [68]. Metagenomic insights indicate the genetic capacity of archaea to interact with plants through (i) promotion of plant growth via auxin biosynthesis (Kauri et al.), (ii) nutrient supply, and (iii) protection against abiotic stress, especially oxidative and osmotic stress (Taffner et al., 2018). White et al., reported for the first time the ability of the thermophilic archaea Sulfolobus acidocaldarius to secrete the plant growth-promoting hormone indole acetic acid (IAA) at levels a thousand times higher than those observed in plant extracts [69], which points to the possibility of the associated archaeal promoting plant growth. Additionally, the role of phosphate-solubilizing halophilic archaea in supporting the development of plants thriving in hypersaline soils by enhancing phosphorus availability has been proposed [59].

The accumulation of information has sparked scientific interest in investigating the role of archaea in plant health and their potential symbiosis in ecosystems. One mechanism directly related to plant-microorganism interaction is the production of N-acyl-L-homoserine lactones (AHLs), signaling molecules used by Pseudomonas species to modulate plant growth and defense responses [70]. As in bacteria, the production of these signaling molecules by archaeal isolates suggests the possibility of signaling and interactions between plants and archaea that modulate plant growth [71]. Song et al. demonstrated, for the first time, the interaction of soil archaea with Arabidopsis thaliana, promoting growth and inducing systemic resistance against the necrotrophic bacterium Pectobacterium carotovorum subsp. Carotovorum SCC1 and the biotrophic bacterium Pseudomonas syringae pv. Tomato DC3000. Nitrosocosmicus oleophilus MY3, an ammonia-oxidizing archaea colonized the root surface of Arabidopsis and increased resistance against pathogenic species by emitting volatiles and activating the salicylic acid-independent signaling pathway, mechanisms similar to that found in soil bacteria and fungi [29]. Also, a recent study showcased the ability of the haloarchaea Halolamina pelagica to alleviate the drought stress in wheat plants and induced the expression of key stress-responsive genes [72]. The remarkable viability an adaptability of archaea to extreme environments also suggests their potential contribution to plant tolerance against various abiotic stresses, including high salinity, limited water availability, and high temperature. Metagenomic analysis of the rhizosphere of Jatropha curcas, a plant adapted to saline and high-temperature conditions, showed a high abundance of Crenarchaeota and Euryarchaeota [73]. Although the mechanisms are yet to be elucidated, members of these groups may play a role in enhancing tolerance to salt stress and high temperature. Despite the metagenomic evidences, many of these mechanisms remain unknown.

Hadaptatus isolates recovered from the A. nummularia rhizosphere growing in saline-irrigated fields exhibited normal growth in a medium with 25% NaCl concentrations. Notably, the formation of salt crystals was observed in cultivation areas on agar plates containing 23% NaCl (Fig. 6C). This suggests that the potential to alleviate salt stress in the rhizosphere may be directly linked to mechanisms of salt accumulation in the biofilm, helping to increase root growth and consequently alleviating symptoms of salt stress in inoculated plants. One adaptative strategy observed in halophilic archaea, known as “salt-in,” involves the intracellular accumulation of salts to regulate the osmotic balance with the external environment, typically employing ATP-dependent proton transport pumps [74]. Another mechanism commonly used by halophilic microorganisms is the production of osmoprotectant compounds, such as proline, glycine, betaine, and ectoine [75].

The genome analyses of Haladaptatus strains revealed a repertoire of genes potentially crucial for enhancing plant resilience to saline stress, particularly those involved in tryptophan biosynthesis and metabolism. Tryptophan metabolism stands out as a pivotal pathway for the production of indole-3-acetic acid (IAA), a recognized phytohormone involved in abiotic stress response [76–77]. Moreover, the presence of genes related to phytohormones, including those contributing to ABA synthesis via the carotenoid pathway, indicates the capacity of Haladaptatus strains to modulate plant physiological responses. Additionally, the detection of genes involved in the production of compatible solutes, such as trehalose, betaine, proline, and ectoin, indicates the ability to regulate osmotic balance and protect cellular structures from salt-induced damage. These findings underscore the genetic potential of Haladaptatus for enhancing salt tolerance. Future investigations focusing on differential expression analyses of some target genes in the rhizosphere of inoculated plants may validate the mechanisms underlying salt stress mitigation.

For the first time, we are harnessing the potential of Haladaptatus sp., an archaeal specie, to assist plants in mitigating saline stress, unveiling novel insights into the potential agricultural applications of archaea.

The increase of soil salinity modulates the rhizospheric microbiome of halophyte plant A. nummularia growing in experimental fileds subjected to saline irrigation, resulting in an enrichement of halophilic arqueon, especially belong to the Haloadaptatus genus. Strains of Haladaptatus isolated isolated from the rhizosphere showed potential in ameliorating the adverse effects of saline stress on maize seeddlings upon soil inoculation in greesnhouse experiments. Furthermore, Haladaptatus strains exhibited competitive viability, with population density increasing in accordance with the gradual rise in salt concentration of irrigation. Genome analysis of Haladaptatus unveiled a repertoire of genes supporting the premise that these microorganisms have the potential to protect plants from the detrimental impacts of soil salinization.

Ethics approval and consent to participate

Not applicable

Consent for publication

Not applicable.

Availability of data and materials

All that support the findings of this study have been deposited in the NCBI with the project code PRJNA116850900

Competing interests

No, I declare that the authors have no competing interests as defined by BMC, or other interests that might be perceived to influence the results and/or discussion reported in this paper.

Funding

This study was supported by the the Brazilian National Council for Scientific and Technological Development(CNPq Process No. 142270/2020-5).

Authors' contributions - provide individual author contribution

JPV, ISM, and GVL designed the project. JPV, GVL, and PIF conducted the field sampling and the soil characterization. AB, TR, and JPV performed the genome analysis. JPV conducted the experiments and performed the microbiome data analysis. JPV, ISM, and GVL wrote the manuscript. All authors reviewed, edited, and approved the final manuscript.

Acknowledgements

Not applicable

Authors' information

João Paulo Ventura is a PhD candidate in the Graduate Program in Agricultural Microbiology at the "Luiz de Queiroz" College of Agriculture (ESALQ/USP) and Embrapa Environment, Jaguariúna, SP, Brazil.

Gileno Vieira Lacerda Júnior is a postdoctoral researcher at the Laboratory of Environmental Microbiology, Embrapa Environment, Jaguariúna, SP, Brazil.

Alex Bisson is an Assistant Professor in the Department of Biology at Brandeis University, Waltham, MA, USA.

Thoepi Rados is a Research Associate in the Bisson Lab at Brandeis University, Waltham, MA, USA.

Paulo Ivan Fernandes Júnior is a researcher at Embrapa Semiarid, Petrolina, PE, Brazil.

Itamar Soares de Melo is a Senior Researcher at Embrapa Environment, Jaguariúna, SP, Brazil.

Ivushkin K, Miklyaeva E, Trushkov I, Volkova O. Soil salinization: Causes, consequences, and perspectives of mitigation. In: Agricultural Technologies for Climate Change Mitigation and Adaptation in Developing Countries. Springer; 2019. p. 51-63.
Machado RMA, Serralheiro RP. Soil salinity: effect on vegetable crop growth. Management practices to prevent and mitigate soil salinization. Horticulturae. 2017;3(2):30.
Munns R, Tester M. Mechanisms of salinity tolerance. Annu Rev Plant Biol. 2008;59:651–81.
Shahid SA, Zaman M, Heng L. Soil salinity: historical perspectives and a world overview of the problem. In: Guideline for salinity assessment, mitigation and adaptation using nuclear and related techniques. Springer; 2018. p. 43–53.
Hassani A, Manzano-Agugliaro F, Khiari L, Ghodbane N. A review of soil salinity measurements and spatial mapping possibilities using remote sensing techniques. J Sensors. 2020;2020:1-13.
Satir O, Berberoglu S. Crop yield prediction under soil salinity using satellite derived vegetation indices. Field Crops Res. 2016;192:134–43.
Qadir M, Quillérou E, Nangia V, Murtaza G, Singh M, Thomas RJ, Drechsel P, Noble AD. Economics of salt-induced land degradation and restoration. Nat Resour Forum. 2014;38:282–95. https://doi.org/10.1111/1477-8947.12054.
Kholová J, Hash CT, Kumar PL, Yadav RS, Kocová M, Vadez V. Terminal drought-tolerant pearl millet [Pennisetum glaucum (L.) R. Br.] have high leaf ABA and limit transpiration at high vapour pressure deficit. J Exp Bot. 2009;60(5):1431-1440.
Kumar D, Maurya BR, Raghuwanshi R. Soil salinity: A review of types, effects, and management strategies. Int J Curr Microbiol Appl Sci. 2022;11(2):126-142.
Shrivastava P, Kumar R. Soil salinity: A serious environmental issue and plant growth promoting bacteria as one of the tools for its alleviation. Saudi J Biol Sci. 2015;22(2):123-131.
Mullakhanbhai M, Larsen H. Halobacterium volcanii spec. nov., a Dead Sea halobacterium with a moderate salt requirement. Arch Microbiol. 1975.
Ben Salem H, Norman HC, Nefzaoui A, Mayberry DE, Pearce KL, Revell DK. Potential use of oldman saltbush (Atriplex nummularia Lindl.) in sheep and goat feeding. Small Ruminant Res. 2010;91(1):13–28. https://doi.org/10.1016/j.smallrumres.2009.10.017.
Debez A, Huchzermeyer B, Abdelly C, Koyro HW. Current challenges and future opportunities for a sustainable utilization of halophytes. In: Sabkha Ecosystems: Volume III: Africa and Southern Europe. Dordrecht: Springer Netherlands; 2010. p. 59–77.
Xiong Q, Hu J, Wei H, Zhang H, Zhu J. Relationship between plant roots, rhizosphere microorganisms, and nitrogen and its special focus on rice. Agriculture. 2021;11(3). https://doi.org/10.3390/agriculture11030234
Mendes R, Garbeva P, Raaijmakers JM. The rhizosphere microbiome: significance of plant beneficial, plant pathogenic, and human pathogenic microorganisms. FEMS Microbiol Rev. 2013;37(5):634–63.
Ruppel S, Franken P, Witzel K. Properties of the halophyte microbiome and their implications for plant salt tolerance. Functional Plant Biology. 2013;40(9):940–951.
Yadav AN, Kaur T, Devi R, Kour D, Yadav N. Biodiversity and biotechnological applications of extremophilic microbiomes: current research and future challenges. In: Microbiomes of Extreme Environments. 2021. p. 278–90.
Taffner J, Bergna A, Cernava T, Berg G. Tomato-associated archaea show a cultivar-specific rhizosphere effect but an unspecific transmission by seeds. Phytobiomes J. 2020;4(2):133–41. https://doi.org/10.1094/pbiomes-01-20-0017-r.
Zhang K, Shi Y, Cui X, Yue P, Li K, Liu X, et al. Salinity is a key determinant for soil microbial communities in a desert ecosystem. mSystems. 2019;4
Alori ET, et al. Plant–archaea relationships: a potential means to improve crop production in arid and semi-arid regions. World Journal of Microbiology and Biotechnology. 2020;36(9):133.
Oren A. Halophilic archaea on Earth and in space: growth and survival under extreme conditions. Philosophical Transactions of the Royal Society A: Mathematical, Physical and Engineering Sciences. 2014;372(2030):20140194.
Kottemann M, Kish A, Iloanusi C, Bjork S, DiRuggiero J. Physiological responses of the halophilic archaeon Halobacterium sp. strain NRC1 to desiccation and gamma irradiation. Extremophiles. 2005;9(3):219–27. https://doi.org/10.1007/s00792-005-0437-4
Lapaglia C, Hartzell PL. Stress-induced production of biofilm in the hyperthermophile Archaeoglobus fulgidus. Appl Environ Microbiol. 1997;63(8):3158–63. https://doi.org/10.1128/aem.63.8.3158-3163.1997
Taffner J, Erlacher A, Bragina A, Berg C, Moissl-Eichinger C, Berg G, Tamaki H. What is the role of Archaea in plants? New insights from the vegetation of alpine bogs. mSphere. 2018;3(3). https://doi.org/10.1128/mSphere.00122-18
Rodriguez R, Durán P. Natural holobiome engineering by using native extreme microbiome to counteract the climate change effects. Front Bioeng Biotechnol. 2020;8:568.
Leontidou K, Genitsaris S, Papadopoulou A, Kamou N, Bosmali I, Matsi T, Madesis P, Vokou D, Karamanoli K, Mellidou I. Plant growth promoting rhizobacteria isolated from halophytes and drought-tolerant plants: genomic characterisation and exploration of phyto-beneficial traits. Sci Rep. 2020;10(1):14857. https://doi.org/10.1038/s41598-020-71652-0
Singh D, Kaushik R, Chakdar H, et al. Unveiling novel insights into haloarchaea (Halolamina pelagica CDK2) for alleviation of drought stress in wheat. World J Microbiol Biotechnol. 2023;39:328. https://doi.org/10.1007/s11274-023-03781-3.
Selim S, Akhtar N, Hagagy N, Alanazi A, Warrad M, et al. Selection of newly identified growth-promoting archaea Haloferax species with a potential action on cobalt resistance in maize plants. Front Plant Sci. 2022;13:872654. https://doi.org/10.3389/fpls.2022.872654.
Song GC, Im H, Jung J, Lee S, Jung MY, Rhee SK, Ryu CM. Plant growth-promoting archaea trigger induced systemic resistance in Arabidopsis thaliana against Pectobacterium carotovorum and Pseudomonas syringae. Environ Microbiol. 2019;21:940–8. https://doi.org/10.1111/1462-2920.14486.
Bang C, Schmitz RA. Archaea: forgotten players in the microbiome. Emerg Top Life Sci. 2018;2(4):459–68. https://doi.org/10.1042/ETLS20180035
Chow C, Padda KP, Puri A, Chanway CP. An archaic approach to a modern issue: endophytic archaea for sustainable agriculture. Current Microbiology. 2022.
32 - Callahan B, McMurdie P, Rosen M, et al. DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods. 2016;13:581–3. https://doi.org/10.1038/nmeth.3869.
Oksanen FJ, et al. Vegan: community ecology package. R package version 2.4-3; 2017.
McMurdie PJ, Holmes S. phyloseq: an R package for reproducible interactive analysis and graphics of microbiome census data. PLoS ONE. 2013;8(4). https://doi.org/10.1371/journal.pone.0061217.
XU, S. et al. MicrobiotaProcess: a comprehensive R package for deep mining microbiome. The Innovation, v. 4, n. 2, Mar. 2023.
Wemheuer F, Taylor JA, Daniel R, Johnston E, Meinicke P, Thomas T, Wemheuer B. Tax4Fun2: prediction of habitat-specific functional profiles and functional redundancy based on 16S rRNA gene sequences. Environ Microbiome. 2020;15(1):11. https://doi.org/10.1186/s40793-020-00358-7.
Parks DH, Tyson GW, Hugenholtz P, Beiko RG. STAMP: statistical analysis of taxonomic and functional profiles. Bioinformatics. 2014;30(21):3123–4. https://doi.org/10.1093/bioinformatics/btu494.
Dyall-Smith M. The Halohandbook Protocols for halobacterial genetics. 2009. p. 144. version 7.2
Lloyd KG, Lapham L, Teske A (2006) An anaerobic methane-oxidizing community of ANME-1b archaea in hypersaline Gulf of Mexico sediments. Appl Environ Microbiol. 72(11): 7218–7230.
Yoon SH, Ha SM, Kwon S, Lim J, Kim Y, Seo H, Chun J. Introducing EzBioCloud: A taxonomically united database of 16S rRNA and whole genome assemblies. Int J Syst Evol Microbiol. 2017;67:1613-1617.
Sayers EW, Bolton EE, Brister JR, et al. Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 2022;50(D1) –D26. https://doi.org/10.1093/nar/gkab1112.
Tamura K, Stecher G, Kumar S. MEGA11: Molecular Evolutionary Genetics Analysis version 11. Mol Biol Evol. 2021;38(7):3022–7. https://doi.org/10.1093/molbev/msab120.
Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4(4):406–25.
Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22(22):4673–80.
Meier-Kolthoff JP, Göker M. TYGS is an automated high-throughput platform for state-of-the-art genome-based taxonomy. Nat. Commun. 2019;10: 2182. DOI: 10.1038/s41467-019-10210-3
Jorquera MA, Graether SP, Maruyama F. Editorial: Bioprospecting and Biotechnology of Extremophiles [Editorial]. Front Bioeng Biotechnol. 2019;7:204. https://doi.org/10.3389/fbioe.2019.00204.
Yadav AN, Kaur T, Devi R, Kour D, Yadav N. Biodiversity and biotechnological applications of extremophilic microbiomes: current research and future challenges. In: Microbiomes of Extreme Environments. 2021. p. 278–90.
Yao L, Wu Z, Zheng Y, Kaleem I, Li C. Growth promotion and protection against salt stress by Pseudomonas putida Rs-198 on cotton. Eur J Soil Biol. 2010;46:49–54.
Mukhtar S, Mehnaz S, Mirza MS, Hameed S, Malik KA. Role of halotolerant and halophilic microorganisms in plant growth promotion. In: Microbial Strategies for Crop Improvement. Springer; 2019. p. 207-224.
Goswami SK, Kashyap AS, Kumar R, Gujjar RS, Singh A, Manzar N. Harnessing Rhizospheric Microbes for Eco-friendly and Sustainable Crop Production in Saline Environments. Curr Microbiol. 2023 Nov 25;81(1):14. doi: 10.1007/s00284-023-03538-z. PMID: 38006515.
JHA, B.; GONTIA, I.; HARTMANN, A. The roots of the halophyte Salicornia brachiata are a source of new halotolerant diazotrophic bacteria with plant growth–promoting potential. Plant Soil, v. 356, p. 265–277, 2012
YUAN Z, et al. Specialized microbiome of a halophyte and its role in helping non-host plants to withstand salinity. Sci Rep. 2016;6(1):32467.
ALEXANDER A, et al. Halotolerant PGPR Stenotrophomonas maltophilia BJ01 induces salt tolerance by modulating physiology and biochemical activities of Arachis hypogaea. Front Microbiol. 2020;11:2530.
CASTIGLIONE S, et al. Effects of compost amendment on glycophytes and halophytes crops grown on saline soils: isolation and characterization of rhizobacteria with plant growth promoting features and high salt resistance. Appl Sci. 2021;11(5):2125.
OTLEWSKA A, et al. When salt meddles between plant, soil, and microorganisms. Front Plant Sci. 2020;11:1429.
BENIDIRE L, et al. Phytobeneficial bacteria improve saline stress tolerance in Vicia faba and modulate microbial interaction network. Sci Total Environ. 2020;729:139020.
LACERDA-JÚNIOR GV, et al. Land use and seasonal effects on the soil microbiome of a Brazilian dry forest. Front Microbiol. 2019;10:648.
MORRISSEY EM, et al. Evolutionary history constrains microbial traits across environmental variation. Nat Ecol Evol. 2019;3(7):1064-9.
YADAV AN, et al. Haloarchaea endowed with phosphorus solubilization attribute implicated in phosphorus cycle. Sci Rep. 2015;5(1):1-10.
ROH SW, LEE ML, BAE JW. Haladaptatus cibarius sp. nov., an extremely halophilic archaeon from seafood, and emended description of the genus Haladaptatus. Int J Syst Evol Microbiol. 2010;60(5):1187-90.
CHEN PW, et al. Exploring the additive bio-agent impacts upon ectoine production by Halomonas salina DSM5928T using corn steep liquor and soybean hydrolysate as nutrient supplement. J Biosci Bioeng. 2020;130(2):195-9.
ARORA NK, et al. Halo-tolerant plant growth promoting rhizobacteria for improving productivity and remediation of saline soils. J Adv Res. 2020;26:69-82.
MUKHTAR S, et al. Phylogenetic analysis of halophyte-associated rhizobacteria and effect of halotolerant and halophilic phosphate-solubilizing biofertilizers on maize growth under salinity stress conditions. J Appl Microbiol. 2020;128(2):556-73.
GEILFUS CM, et al. Early response to salt ions in maize (Zea mays L.). J Plant Physiol. 2018;220:173-80.
FAROOQ M, et al. Salt stress in maize: effects, resistance mechanisms, and management: a review. Agron Sustain Dev. 2015;35(2):461-81.
SANTOYO G, et al. Rhizosphere colonization determinants by plant growth-promoting rhizobacteria (PGPR). Biology. 2021;10:475.
EICHLER J, ABU-QARN M, KONRAD Z, MAGIDOVICH H, PLAVNER N, YURIST-DOUTSCH S. The cell envelopes of haloarchaea: staying in shape in a world of salt. In: Prokaryotic Cell Wall Compounds: Structure and Biochemistry. 2010. p. 253-70.
JUNG J, et al. Archaea, tiny helpers of land plants. Comput Struct Biotechnol J. 2020;12:2494-500.
WHITE RH. Indole-3-acetic acid and 2-(indol-3-ylmethyl)indol-3-yl acetic acid in the thermophilic archaebacterium Sulfolobus acidocaldarius. J Bacteriol. 1987;169(12):5859-60.
ORTÍZ-CASTRO R, et al. The role of microbial signals in plant growth and development. Plant Signal Behav. 2009;4(8):701-12.
CHARLESWORTH J, et al. Archaea join the conversation: detection of AHL-like activity across a range of archaeal isolates. FEMS Microbiol Lett. 2020;367(16)
SINGH D, KAUSHIK R, CHAKDAR H, et al. Unveiling novel insights into haloarchaea (Halolamina pelagica CDK2) for alleviation of drought stress in wheat. World J Microbiol Biotechnol. 2023;39:328. https://doi.org/10.1007/s11274-023-03781-3.
DUBEY G, et al. Diversity of bacteria and archaea in the rhizosphere of bioenergy crop Jatropha curcas. 3 Biotech. 2016;6(2):257.
OREN A. Microbial life at high salt concentrations: phylogenetic and metabolic diversity. Saline Syst. 2008;4:1-13.
SIDDIQUI SA, KUMARI A, RATHORE MS. Glycine betaine as a major osmolyte under abiotic stress in halophytes. In: GRIGORE MN, editor. Handbook of halophytes: from molecules to ecosystems towards biosaline agriculture. Springer; 2020. p. 2069-87.
ZHANG H, et al. Thriving under Stress: How Plants Balance Growth and the Stress Response. Dev Cell. 2020;7(5):529-43.
SHAHZAD R, HARLINA PW, GALLEGO PP, FLEXAS J, EWAS M, LEIWEN X, KARUNIAWAN A. The seaweed Ascophyllum nodosum-based biostimulant enhances salt stress tolerance in rice (Oryza sativa L.) by remodeling physiological, biochemical, and metabolic responses. J Plant Interact. 2023;18(1):2266514.

No competing interests reported.

Harnessing Haloarchaea from Halophyte Atriplex nummularia Rhizosphere to Enhance Salt Tolerance in Maize Seedlings

Status:

Version 1

Abstract

Figures

INTRODUCTION

Methodology

Results

Isolation and identification of halophilic archaeal strain

Effects of soil inoculation with Haloadaptatus strains on maize seedlings under saline conditions

Unveiling the population dynamics of archaea inoculation in maize rhizosphere under saline irrigation

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1