Molecular Identification and Characterization of Bacteria Exhibiting Resistance to Different Metal isolated from Industrial Effluents, CETP, and Sirsa River, Baddi, Himachal Pradesh, India

doi:10.21203/rs.3.rs-5201685/v1

Download PDF

Research Article

Molecular Identification and Characterization of Bacteria Exhibiting Resistance to Different Metal isolated from Industrial Effluents, CETP, and Sirsa River, Baddi, Himachal Pradesh, India

https://doi.org/10.21203/rs.3.rs-5201685/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

The rapid industrialization of geologic and human activities has led to the emergence and widespread problem of heavy metal pollution, which poses a considerable menace to both the ecological system and human well-being. The objective of this study is to investigate, extract, recognize, and describe bacteria that possess the ability to reduce and detoxify heavy metals like Cu, Zn, Cd, Ni, Pb, Hg, and Cr found in industrial effluent, CETP, and the Sirsa River. Initially, a combined sum of 100 isolates underwent screening on NA plates containing different heavy metal supplements Pb, Cu, Zn, Cd, Hg, and Cr at a concentration of 50 ppm in their salt form. After screening, the five best isolates that showed high resistance were selected. The MIC of the microbial strains for metallic elements ranged from 50 to 550 ppm. All five isolates with resistance exhibited numerous tolerance to heavy metals and exhibited varying MICs against the aforementioned metallic elements at diverse concentrations. Maximum tolerable concentration and multi-metal resistance were determined. Identification of isolates extended up to the genus level through assessment of their morphological and biochemical characteristics, & analysis of the 16S rRNA gene sequences and were recognized as belonging to the Bacillus cereus (OR243903), Stenotrophomonas maltophila (OR243725), Bacillus cereus (OR244395), Bacillus cereus (OR243740) and E. Coli (OR244383). The bacteria resistant to heavy metals obtained from this research could prove valuable for bioremediation efforts in environments contaminated with heavy metals. Bioremediation, utilizing these bacteria resistant to heavy metals (HMRB), is the most favorable approach to tackle this concern. Therefore, identifying five bacteria for their resistance to heavy metals and capacity for biodegradation serves as a foundational investigation toward developing potential local bioremediation agents for industrial effluent treatment technology.

Resistance to heavy metals

Minimum inhibitory concentration

16S rRNA gene

Bacteria

Water is an indispensable resource for supporting life on Earth. However, its quality has been severely impacted by factors such as population growth, human activities, rapid industrialization, improper utilization of natural water resources, and unplanned urbanization (Vardhan et al., 2019; Kumar et al., 2020; Zamora-Ledezma et al., 2021; Hayder et al., 2022). Heavy metal pollution is a significant environmental and ecosystem challenge encountered by many developing nations, such as India. Extensive studies have investigated heavy metal contamination in water originating from diverse sources like agricultural activities, automobile emissions, industrial waste, and other human practices (Nokman et al., 2019). Among these sources, anthropogenic activities such as industrial waste, household sewage, and farming methods are the primary contributors to elevated concentrations of metals in rivers, endangering the health of both people and aquatic life (Choudhury et al., 2022; Varol & Tokath, 2023). Therefore, monitoring metal levels and evaluating the potential health hazards is essential for safeguarding both stream ecosystems and human welfare (Mokarram et al., 2020; Varol & Tokath, 2023).

The elimination of contaminants, particularly heavy metals from wastewater has become a pressing global issue. While heavy metals are essential for metabolic processes and plant growth at normal levels, they become toxic when present in higher concentrations (e.g., Cu, Co, Zn, and Ni). Moreover, certain other metallic elements, such as Hg, As, Pb, Cr, and Cd, are highly toxic even at low concentrations (EL-Sorogy et al., 2023; DalCorso et al., 2019). Various technologies have been developed to address this problem (Yang et al., 2019), but conventional physical and chemical methods for remediation are often costly and generate large volumes of chemical waste. Consequently, there is an urgent need for effective and affordable techniques to remove heavy metals from wastewater (Wang et al., 2019). Microorganisms, including algae, fungi, yeasts, and bacteria, have shown remarkable abilities to degrade, detoxify, and accumulate both organic and inorganic nature harmful compounds (Medfu et al., 2020; Nokman et al., 2019). In the realm of heavy metal bioremediation, microorganisms play a crucial role (Saeed et al., 2022). Scientists have identified numerous mechanisms by which microorganisms can degrade heavy metals, including biosorption, biomineralization, bioleaching, immobilization, and redox reactions (Zaynab et al., 2022; Nokman et al., 2019). Numerous studies have documented the isolation of heavy metal-tolerant bacteria with the ability to survive and thrive in various sources. Therefore, the objective of this current investigation is to characterize and identify bacteria resistant to heavy metals from the Sirsa River, as well as from industrial effluent and CETP, to further our understanding of their potential in heavy metal bioremediation efforts.

2.1 Study area description

Baddi an industrial area in the Solan district of Himachal Pradesh has established a reputation not only within the state but also in North India as the largest pharmaceutical manufacturing hub in Asia. It stands as a significant center for the development centers for the economy of Himachal Pradesh. Baddi is situated in the embrace of the Shiwalik foothills within the Solan District (Fig. 1). Geographically, the Baddi is located between 30.95⁰N north latitude and 76.79⁰E east longitude. The town of Baddi is positioned at an average elevation of 426 meters. The total geographical area of Baddi tehsil spans 232 square kilometers, with the study area of the industrial town of Baddi encompassing a geographical expanse of 29 square kilometers (Kumar & Mohan, 2019). Besides, the area has been gifted with rich freshwater resources. The Sirsa River serves as the major tributary of the Satluj River, it originates from the foothills of Kasauli near Kalka in Haryana with an overall length of 54.00 kilometers. After spanning 20.00 km in Haryana, it enters Himachal Pradesh in proximity to Baddi Town. Subsequently, it traverses a stretch of 28.00 km within Himachal Pradesh before entering Punjab near Ghanauli. Following a course of 6.00 km in Punjab, it eventually converges into the Satluj River. The River Sirsa is the main perennial river with close to 20 No’s with significant tributaries and an approximate catchment area of 550.00 square kilometers. Numerous streams or riverines are emerging from the northeastern direction flank along the industrial belt frequently burdened with industrial and sewage discharges and join the Sirsa River (Sethi et al., 2022). The mean annual precipitation is approximately 1046 mm, with an average of 56 days of rainfall. Industrial operations exert ecological and environmental repercussions, encompassing the pollution of river water by heavy metals (Herojeet, 2015).

2.2 Sample collection

All the water samples of River Sirsa and wastewater samples of industries (mainly pharmaceutical and textile) & Common effluent treatment plant (CETP) were collected in the years 2021-22 and 2022-23 of the study area along the downstream of River Sirsa. A total of 384 water samples were taken in a screw cap sterilized container and brought to the testing center under aseptic conditions in an ice bucket as soon as possible for immediate analysis.

2.3 Isolation and Assessment of Bacteria Resistant to Heavy Metals

Bacteria resistant to metals were cultured on NA medium, Mac Conkey, and Luria Bertani agar. The sample was diluted serially (1 Milli liter from the water sample was used) with sterile saline until reaching a dilution of 10^− 6. 100 µl of this dilution was subsequently spread onto Nutrient Agar, Mac Conkey, and Luria Bertani agar. For the assays, plates underwent incubation at 30–35^◦C for 24 hours, followed by an agar plate count. Colonies were visually inspected, and those dominating each culture medium were chosen. The most prominent colonies were selected for transplantation into a nutrient agar supplemented with specific heavy metal solutions. Petri plates were enhanced with heavy metals such as Copper, Zinc, Cadmium, Lead, Mercury, and Chromium in the form of their salts respectively at a concentration of 50ppm and it was incubated at 37°C for 24–48 hrs. Isolated distinct colonies observed on selective media were subjected to subculture in a similar medium at 37°C. The culture underwent streaking and incubation at 37°C for 24 hours, followed by preservation in slants within a refrigerator.

2.4 Characterization of isolated bacteria

Pure cultures of the isolates underwent morphological characterization based on their cultural traits, Gram staining, and biochemical attributes following the guidelines outlined in Bergey’s Manual of Determinative Bacteriology, 1979. Utilized molecular techniques to confirm the identification of the isolates and selected five isolates with the utmost metal tolerance. Molecular identification was subsequently conducted through 16S rRNA sequencing (Singh & Hiranmani, 2021).

2.5 Determination of minimum inhibitory concentrations (MICs) for heavy metals

The MICs for the metal-tolerant bacterial isolate were ascertained by growing on media enriched with heavy metals against the corresponding heavy metals by incrementally elevating the concentration of metal salts on NA plates until growth inhibition was fully detected. The culture thriving on the initial concentration (50 ppm) was transferred to the higher concentrations such as 100, 150, 200, 250, 300, 350, 400, 450, and 500 ppm applying streak onto the plates. The MIC was recorded when the isolates displayed no growth on the plates, even after 48 hours of incubation. The five best isolates VP7 (V1), VT8 (V2), VRS4 (V3), VCETP8 (V5), and VRS7 (V7) were chosen based on the level of resistance to different heavy metals.

2.6 Optimization of growth conditions

2.6.1 Determining the most favorable temperature and pH conditions for optimal growth.

Determined the most favorable growth conditions in terms of pH and temperature. In the case of determining the optimum pH, the isolated strain was introduced into a nutrient broth medium with varying pH values (4, 5, 6, 7, 8, and 9) set utilizing the predefined amount of filter-sterilized 1 M HCl and 1 M NaOH and incubation was carried out at 37^oC for 24 hrs. The absorbance was ascertained at 600nm to assess the growth. The optimal pH was determined by creating a graph correlating pH and OD values. To determine the optimum temperature, isolates were introduced into NB medium and placed in incubation overnight in a shaking incubator, subsequently adjusting the different temperatures, i.e. 10^oC, 28^oC, 37^oC, 45^oC, and 55 ^oC for 24 h individually for each bacterial isolate. Measured the OD at 600 nm for growth determination. Calculated the optimum temperature by creating a graph correlating temperature and OD values (Pandit et al., 2013; Biswas et al., 2017).

2.6.2 Growth Studies

The flask containing 50 ml of NB medium enriched with all seven metals Cu, Zn, Hg, Cr, Cd, and Pb (50 ppm) was studied for growth studies of bacteria. The medium was inoculated with 100 µl of overnight culture and placed on a rotary shaker at 150 rpm, incubated overnight at 37°C. Monitoring of growth occurred by measuring absorbance at 600 nm using a UV-Vis spectrophotometer at different time intervals: 2, 4, 6, 8, 10, 24, 48, and 72 hours.

2.7 Genomic DNA isolation

The genomic DNA from selected isolates was extracted using the phenol-chloroform method. Pure bacterial cultures were sub-cultured overnight in nutrient broth, and the culture was centrifuged at 13,000 rpm for 10 minutes to generate a pellet from 5 milliliters of the sample. The bacterial pellet was then suspended in 500 µl of extraction buffer (0.5M EDTA, 5M NaCl, 10mM Tris HCL, pH 8.0) and 50 µl of 10% SDS. After vortexing or pipetting to suspend the cell pellet, the samples underwent incubation at 65°C in a water bath for 30 minutes until the lysate became transparent. The lysate was combined with an equivalent volume of phenol-chloroform mixture (1:1), thoroughly mixed, and then subjected to centrifugation at 10,000 rpm for 5 minutes at room temperature. The upper aqueous phase was carefully transferred to a fresh tube, and the phenol-chloroform extraction process was repeated. To the aqueous phase, 1/10 volume of 5 M NaCl and 2.5 times its volumes of absolute ethanol were added, followed by overnight incubation at -20°C. Following centrifugation at 12,000 rpm for 20 minutes at room temperature, the supernatant was removed, and the DNA pellet was rinsed with 1 milliliter of 70% ethanol. After centrifugation at 12,000 rpm for 5 minutes at room temperature, the supernatant was decanted, and the DNA pellet was air-dried for approximately 15 minutes to remove any residual ethanol. Subsequently, the DNA pellet was resuspended in an adequate volume (90 µl) of TE buffer (10 mM Tris HCL, 1 mM EDTA) and stored at -20°C for future applications. (Garima, 2017).

2.8 Sequencing of 16SrRNA gene, identification of bacterial isolates, and phylogenetic analysis

The isolation of genomic DNA was carried out, and the amplification of the bacterial 16S rRNA gene involved the utilization of universal bacterial primers, specifically F27 5'AGAGTTTGATCCTGGCTCAG3’ and R1492 5’CGGTTACCTTGTTACGACTT3’. The PCR process was carried out with (20 µL total volume) containing bacterial genomic (2 µL) and 1X Taq buffer at 2 µL, 0.4 Taq polymerase, 1µL MgCl2, 1.2µL dNTPs, 1µL of each primer and 11.4 µL HPLC water.

DNA amplification occurred in a thermocycler with the following temperature profile: an initial denaturation step at 95°C for 3 minutes, followed by 35 cycles consisting of denaturation at 95°C for 1 minute, annealing at 55°C for 30 seconds, extension at 72°C for 1 minute and 30 seconds, and a final extension at 72°C for 8 minutes, with a subsequent hold at 4°C. The size of the entire PCR product for the 16S rRNA genes was determined via electrophoresis on a 1.5% Agarose gel. The resultant amplified products were then forwarded to Eurofins Genomics India Pvt. Ltd. in Bengaluru, Karnataka, India, for sequencing. The DNA sequencing procedure employed the dideoxy chain termination method. The sequences obtained were modified using the Bio Edit sequence alignment editor. For sequence analysis, BLASTn was employed, utilizing the NCBI database (Albdaiwi et al., 2019). The partial nucleotide sequences were recorded in the Gene Bank. Sequence alignments were conducted using the Clustal W software, and the construction of the phylogenetic tree utilized the neighbor-joining method. Evolutionary analyses were conducted in MEGA11.

2.9 Statistical analysis

The statistical analysis employed the statistical package for social sciences (SPSS software version 20). All experimental procedures involving the observation and evaluation of bacterial growth under varying levels of heavy metals were conducted in triplicate. In each instance, a minimum of three distinct flasks were typically preserved for each isolate within a given treatment. For each reading session, three measurements were acquired, and the mean value, accompanied by its standard error, was calculated.

3.1 The identification of bacteria resistant to heavy metals such as Copper, Zinc, Cadmium, Lead, Mercury, and Chromium. The bacterial isolates underwent isolation and characterization as part of the investigation to identify bacteria displaying resistance to heavy metals within the industries (pharmaceutical and textile), CETP, and Sirsa River. The process of obtaining bacteria resilient to metals involved nutrient agar culture media supplemented with a 50ppm concentration of heavy metal salts such as copper sulfate pentahydrate (CuSo₄.5H₂O), Zinc acetate dehydrate (Zn(CH₃COO)₂, Cadmium chloride (CdCl₂), Lead(II) nitrate (PbNO₃)₂), Mercury(II) chloride (HgCl₂), and Potassium dichromate (K₂Cr₂O₇) respectively. 100 bacterial isolates were selected from each of the effluent samples & Sirsa River and subjected to scrutiny for cellular shape and arrangement. Out of 100 isolates, 40 bacterial isolates representing various morphological shapes, and cell arrangements were selected and they were then evaluated for their ability to thrive in the presence of Cu, Zn, Cd, Pb, Hg, and Cr, and designated as VP1 to VP10 from Site 1 & 2 (Pharmaceutical industries); VT1 to VT10 from Site 3 & Site 4 (Textile industries); VRS1 to VRS10 from Site 5, 6 & 7 (River Sirsa) & VCETP1 to VCETP10 from Site 8 (Common effluent treatment plant). Out of 40 isolates, 7 isolates were copper resistant, 6 were chromium resistant, 6 were mercury resistant, 7 were zinc resistant, 4 were cadmium resistant, 5 were identified as Lead resistant bacteria, and out of the tested heavy metals, five isolates demonstrated resistance to all of them. During the initial screening, each of the bacterial isolates was resistant to one or more metals but among them five (5) isolates were capable of flourishing in the presence of the entire set of six tested heavy metals. Five isolates were stored on NA slants at 4°C for subsequent biochemical and molecular identification, and distinct codes were assigned to them V1, V2, V3, V5, and V7. Out of 5 isolates, three of them were detected as gram + ve rods, whilst the remaining two were characterized as gram-ve rods. The outcomes of phenotypic studies and biochemical characterization have been consolidated in Table 1.

Table 1

Gram staining, colony characteristics, and biochemical assessment of selected six isolates
Bacterial Strains	Grams staining (Gram stain, Cell shape)	Colony Morphology (Colour, Shape, Margin)	Catalase test	TSIA test	Indole production test	Methyl Red test	Citrate utilization test
V1 (VP7)	+ve, Rods	Cream, Circular, Entire	+	A, Y, X Gas -ve
V2(VT8)	-ve, Rods	Light Green, Circular, Entire	+	K, K, X Gas -ve			+
V3(VRS4)	+ve, Rods	White, Irregular, Unclear margin	+	K, K, X Gas -ve
V5 (VCETP8)	+ve, Rods	Reddish, Circular, Entire		K, K, X Gas -ve
V7(VRS7)	-ve, Rods	Pink, Irregular, Undulate	+	A, Y, X Gas + ve	+	+
RS	-ve, Rods	Pink, Irregular, Undulate	+	A, Y, X Gas + ve	+	+
Where, TSIA- Triple Sugar Iron Agar test, AYX- Acidic slant acid butt and no production of H₂S, KYX- Alkaline slant acid butt and no H2S production, KKX- Alkaline slant alkaline butt and no H2S production, +ve, +: Positive and -ve, -: negative, RS-:Reference strain (E.coli MTCC 1303)

Numerous investigations have been conducted for the isolation of metal-resistant bacteria from soil and water samples. From following similar studies made earlier it is evident that biochemical test helps in the identification of bacterial isolates. Reports include findings on both bacteria classified as Gram-positive and Gram-negative to possess resistance against heavy metals and have been isolated from different sources (Su, 2016; Nwagwu et al., 2017; Naz et al., 2016). Abd Elhady et al. (2020) used morphological and biochemical characterization for identifying bacteria resilient to metals (Bacillus spp.) which were isolated from industrial wastewater effluent. Biswas et al. (2019) used the glucose fermentation test, lactose fermentation test, MR test, mannitol test, indole test, Voges Proskauer test, and assessment of citrate utilization to characterize metal-resistant isolates from Yamuna River, India. Verma et al. (2017) used biochemical tests for the identification of bacteria with resistance to lead which were derived from Udaisagar Lake and Gadwa Pond, Rajasthan, India. Niveshikha et al. (2016) identified Pseudomonas, Serratia, Enterobacter, and Proteus vulgaris by using cultural, morphological, and biochemical characteristics.

3.2 Determination of minimum inhibitory concentration (MIC)

The current investigation involved the assessment of the minimum inhibitory concentration (MIC) for heavy metals across various concentrations of each metal ranging from 50 to 1000 ppm. All experiments were performed in triplicate. Minimum Inhibitory levels of Cu, Zn, Cd, Ni, Pb, Hg, and Cr were determined for each heavy metal. The levels of heavy metals were progressively increased to evaluate the resistance of the five bacterial isolates to the metals by 100 ppm in nutrient agar medium up to the point where the strains exhibited an inability to give colonies on the agar surfaces for determination of accurate MIC against each heavy metal. Table 2 & Fig. 2 illustrates the Minimum Inhibitory Concentrations (MICs) of five bacterial isolates in response to the tested heavy metals, including Cu, Zn, Cd, Pb, Hg, and Cr in the form of their respective salts.

Table 2

Minimum inhibitory concentration (MIC) of multiple metals Cu, Zn, Cd, Pb, Hg, and Cr for isolated heavy metal-resistant bacteria
Isolate name	Bacterial Strain	MIC (ppm)
Isolate name	Bacterial Strain	Cu	Zn	Cd	Pb	Hg	Cr
VP7 (V1)	Bacillus cereus	400	500	150	100	450	250
VT8 (V2)	Stenotrophomonas maltophila	400	550	100	150	400	200
VRS4 (V3)	Bacillus Cereus	250	250	100	100	200	100
VCETP8 (V5)	Bacillus Cereus	100	150	100	100	100	150
VRS7 (V7)	E. coli	200	200	100	100	250	100
RS	E. coli (MTCC 1303)	150	150	100	50	200	50
Highlights are the highest MIC values, RS-: Reference strain (E.coli MTCC 1303)

MIC of Copper for the isolates VP7 (V1) and VT8 (V2) was 400 ppm, while for isolate VRS4 (V3) it was 250 ppm. All remaining isolates as well as reference strain showed MIC values ranging from 100–200 ppm for Cu. MIC of Zinc was 550 ppm for VT8 (V2), and 500 for VP7 (V1), while for VRS4 (V3), it was 250 ppm. All remaining isolates and reference strain showed MIC values varying from 150–200 ppm for Zn. MIC of cadmium was 150 ppm for VP7 (V1), while for other isolates it was only 100 ppm including the reference strain. MIC of Lead for the isolates VT8 (V2) was 150 ppm, while for other isolates it was only 100 ppm and 50 ppm for the reference strain. MIC of mercury for the isolates VP7 (V1) and VT8 (V2) was 450 and 400 ppm, while for isolate VRS7 (V7) it was 250 ppm. All remaining isolates showed MIC values ranging from 100–200 ppm for mercury as well as for reference strain. MIC of chromium for the isolates VP7 (V1) and VT8 (V2) was 250 and 200 ppm, while for isolate VCETP8 (V5) it was 150 ppm. Two isolates (VRS7 (V7) & VRS4 (V3)) displayed similar MIC values against Cr (100 ppm). Among the heavy metals Copper, Zinc, Mercury, and Chromium exhibited lower toxicity, while Cd and Pb demonstrated high levels of toxicity to all isolates (Fig. 2). The majority of the bacterial isolates thrived in the presence of copper, zinc, mercury, and chromium. Out of five bacterial isolates (VP7 (V1) and VT8 (V2)) showed a very high degree of resistance against all tested metals. The ranking of resistance to metals was found to be Zn > Cu > Hg > Cr > Cd > Pb. Previous research suggests that certain bacterial isolates might exhibit tolerance to concentrations of Cr (1,000 ug/ml). Nearly all isolates demonstrated limited tolerance to Cd, Ni, and Pb, with MIC values below 150 ppm. Faudzi et al., 2019; Syatiqah & Yussof, 2018. Multiple heavy metal tolerance of bacteria against copper, cadmium, cobalt, and zinc was also reported by Mihdhir et al. (2016). Pseudomonas aeruginosa showed multiple metal resistances to Cadmium (100%), Chromium (23.1%), Nickel (64.3%), and Zinc (53.9%). The bacteria isolated exhibited efficacy in the removal of heavy metals found in effluent from petroleum refineries (Oaikhena et al., 2016).

3.3 The impact of temperature and pH on the proliferation of bacteria resistant to metals

Maximum growth was shown by all five isolates as well as the reference strain (E. coli MTCC 1303) under conditions of pH 7 and pH 8, noticeable growth was recorded, while minimal growth was observed at 4 and 5 which indicates that growth was inhibited by acidic pH. Isolates V1, V2, and V7 were comparatively fast-growing than other isolates as depicted in Fig. 3. The optimum temperature obtained was 28^oC and 37^oC for all the isolates except V7 and reference strain (E.coli MTCC 1303) as both the isolates exhibited 45^oC as the optimum temperature. Similar growth was observed at both temperatures. No growth or very little growth was observed at 10^oC and 55^oC (Fig. 4). Growth studies were conducted for large-scale biomass production. Jahan et al., 2016 also reported the same optimum temperature (37^oC) and pH (7 & 8) for chromium-resistant specifically, the bacteria identified as B. thuringiensis (Cr-S1) and B pumilus (Cr-S2).

3.4 The growth dynamics of the bacterial isolate when exposed to metal concentrations

The growth curves of five isolates under different heavy metals were performed in liquid cultures at a concentration of 50 ppm and exhibited different growth patterns. The same has been depicted in Fig. 5 to 10 respectively. Increased growth was observed and growth rates of all five isolates as well as the reference strain (E. coli MTCC 1303) showed analogous stages in the presence of heavy metals; nevertheless, the proliferation was slightly inhibited compared to the control. Previous studies have also reported analogous results (Pandit et al., 2013; Nokman et al., 2019). The results were compared with a control which is the free metal nutrient-rich growth medium. Measuring the optical density (O.D = 600) was used to determine growth kinetics. The bacterial isolates' growth was specifically examined during the exponential phase while exposed to metals and reached maximum growth at 24–48 hours. A growth curve was generated by plotting the time intervals against the optical density for both stressed and control conditions. Individual growth curves were constructed for each bacterium for each tested metal.

3.5 Identification of the bacterial isolates

Sequencing of the 16S rRNA gene and subsequent phylogenetic analysis

The DNA was extracted from the genomic material of all five isolates. The isolation of DNA was accomplished, and its visualization revealed a distinct band on a 1.5% Agarose gel. A fragment of approximately 1.5 kb from the 16S rRNA gene was generated using universal primers F27 and R1492. The phylogenetic linkage and taxonomic identity of the bacterial strain isolated from effluents and Sirsa River were determined using 16S rRNA gene sequence analysis. The obtained sequences for these isolates by PCR amplification of the 16S rRNA gene (1500 bp) were successfully visualized, as illustrated in Fig. 11. Following sequencing, the amplified DNAs underwent identification via the Gene Bank database using the Blast search program, after which the sequences were submitted to NCBI (Table 3). Based on 16S rRNA gene sequencing, the bacterial isolate VP7 (V1) showed 93.3% similarity to Bacillus cereus, VT8 (V2) showed 98.94% similarity to Stenotrophomonas maltophila, VRS4(V3) showed 95.19% similarity to Bacillus cereus, VCETP8(V5) showed 95.17% similarity to Bacillus Cereus and VRS7(V7) showed 96.93% similarity to E. coli. The permanent accession No. generated by NCBI is shown in Table 3.

Table 3

Identification of isolated bacterial strains based on 16S rRNA gene sequence analysis (NCBI) along with permanent accession number is as detailed below
Strain ID	Identified bacteria	Permanent Accession number (NCBI database)	Similarity percentage (%) (BLASTn)
VP7 (V1)	Bacillus cereus	OR243903	93.90
VT8 (V2)	Stenotrophomonas maltophila	OR243725	98.94
VRS4 (V3)	Bacillus cereus	OR244395	95.19
VCETP8 (V5)	Bacillus cereus	OR243740	95.17
VRS7 (V7)	Escherichia .coli	OR244383	96.93

Molecular phylogeny aids in elucidating the connections between organisms and serves as an alternative to traditional identification methods. The results of phylogenetic analysis of the 16S rRna sequence confirmed that most of the isolated heavy metal tolerant strains belonged to diverse genera including both gram + ve (Bacillus sp.) and gram –ve (E.coli & Stenotrophomonas maltophila). The neighbor-joining method was used to infer the evolutionary history. Evolutionary analyses were conducted in MEGA XI. The dendrogram based on homology was also created and shown in Fig. 12. Both Gram + ve and Gram –ve bacteria have been reported to possess resistance against heavy metals.

The town of Baddi, an industrial hub, is grappling with significant pollution issues. Industries and Common Effluent Treatment Plants (CETP) in the area releasing substantial amounts of heavy metals into the Sirsa River presents a peril to the ecosystem, local population, marine biodiversity, and agricultural environment. Consequently, the Sirsa River has experienced an accumulation of heavy metals. Microorganisms, through their evolutionary adaptations, have developed mechanisms to survive and thrive in environments with elevated metal concentrations. The interactions between microorganisms and metals have substantial implications for both the environment and human welfare (Noreen et al., 2020; Navarro-Noyaa et al., 2012). Certain bacteria have demonstrated the ability to tolerate elevated concentrations of heavy metals present in their surroundings, making them potential candidates for the bioremediation of environments tainted with metal pollutants (Mihdhir et al., 2016). Therefore, there is a need to investigate and isolate bacteria exhibiting resilience to metals and characterize their capability for the bioremediation of heavy metals (Nwagwu et al., 2017). In this study, our attention was directed towards the identification and analysis of numerous bacteria exhibiting resistance to various heavy metals by involving isolation and characterization processes in both effluents and the Sirsa River. The isolates exhibited a remarkable level of ability to withstand heavy metal exposure and they belonged to diverse genera, including bacteria of both Gram + ve and Gram-ve. This research provides valuable insights into the microbial diversity and metal tolerance capabilities within the contaminated environments of Baddi, laying the foundation for potential bioremediation strategies targeting heavy metals.

One hundred colonies were assessed during the initial stage on Nutrient Agar medium supplemented with heavy metals. Forty isolates were selected in the secondary screening. Finally, the selection of five bacterial isolates i.e. Bacillus cereus (OR243903), Stenotrophomonas maltophila (OR243725), Bacillus cereus (OR244395), Bacillus cereus (OR243740), and Escherichia coli (OR244383) was made based on thorough examination for a high concentration of heavy metals tested (Cu, Zn, Cd, Pb, Hg, and Cr). The bacteria's ability to resist heavy metals occurred through either displacement of the metal from the local binding site of the bacteria or through ligand interactions (Abidina et al., 2020; Wuana & Okieimen, 2011). Out of five bacterial isolates, (VP7 (V1) and VT8 (V2)) demonstrated an exceptional level of resilience against all heavy metals tested. The order of metal resistance was found to be Zn > Cu > Hg > Cr > Cd > Pb (Table 2). The presence of diverse resistance mechanisms and variations in cell wall composition among heavy metal-resistant bacteria contributes to their multiple tolerance (Nokman et al., 2021; Murthy et al., 2012). In general, nearly all isolates exhibited pronounced resistance to copper (Cu), zinc (Zn), and mercury (Hg), while demonstrating lower tolerance levels towards cadmium (Cd), lead (Pb), and chromium (Cr). Various investigations have suggested that certain isolated bacteria may exhibit tolerance to chromium concentrations (1,000 ug/ml) (Faudzi et al., 2019; Syatiqah & Yussof, 2018). Multiple heavy metal tolerance of bacteria against copper, cadmium, cobalt, and zinc was also reported by Mihdhir et al., (2016). In Marzan et al. (2017) research, Gemella sp. was noted for its capability to tolerate multiple heavy metals, including cadmium (Cd) at 1350 µg/L and chromium (Cr) at 360 µg /L as well as Pb-1900 µg/L. Pseudomonas aeruginosa showed multiple metal resistances to cadmium (Cd) at 100%, chromium (Cr) at 23.1%, nickel (Ni) at 64.3%, and zinc (Zn) at 53.9%. Multiple metal resistance ability for Ni, Cd, Pb, Zn, and Cu was reported in Pseudomonas, Serratia, and Klebsiella by Perelomov et al., (2022). P. aeruginosa, Chryseobacterium sp., B. amyloliquefaciens, B. aerius, B. subtilis, and B. cereus exhibited diverse tolerance levels to the tested metals i.e. cadmium, lead, and nickel. Bacillus cereus and Bacillus amyloliquefaciens demonstrated the capability to withstand concentrations as high as 2000 µg/ml of Pb, while the remaining metal-resistant microorganisms exhibited tolerances of up to 1200 µg/ml for Cd and Ni (Su, L. S. (2016). Neeta et al. (2016) observed that isolates of Pantoea agglomerans and Enterobacter asburiae were capable of withstanding both Cd (3000 µg/ml) and Ni (2000 µg/ml) simultaneously.

The growth dynamics of each isolate were monitored during exposure to heavy metals, and the growth rates of all five isolates displayed analogous phases when subjected to heavy metal exposure. However, the presence of heavy metals slightly impeded growth compared to the control. Previous studies have documented comparable findings (Nokman et al., 2019; Marzan et al., 2017; Abo-Amer et al., 2015; Pandit et al., 2013). Maximum growth was shown by all six isolates at pH 7 & 8 and minimal growth was observed at 4 & 5 which indicates that growth was retarded by acidic pH. Isolates V1, V2, and V7 were comparatively fast-growing than other isolates as shown in Fig. 3. The optimum temperature obtained was 28^oC and 37^oC for all the isolates except V7 and reference strain (E.coli MTCC 1303) as both the isolates exhibited 45^oC as the optimum temperature (Fig. 4). Our observations align with prior studies that have reported analogous outcomes in different bacterial species (Pandit et al., 2013; Jahan et al., 2016).

All five isolates were chosen for molecular identification through the utilization of the 16S rRNA gene due to their robust heavy metal-resistant characteristics. Successful PCR amplification of the 16S rRNA gene (1500 bp) for these isolates is illustrated in Fig. 11. The sequenced DNAs were subjected to identification through the Gene Bank database using the Blast search program, and the obtained sequences were submitted to the NCBI. Based on 16SrRNA gene sequencing, the bacterial isolate VP7 (V1) showed 93.3% similarity to Bacillus cereus group sp., VT8 (V2) showed 98.94% similarity to Stenotrophomonas maltophila, VRS4 (V3) showed 95.19% similarity to Bacillus cereus, VCETP8 (V5) showed 95.17% similarity to Bacillus Cereus and VRS7 (V7) showed 96.93% similarity to E. coli. A phylogenetic tree of bacterial isolates resistant to heavy metals was created using the nucleotide sequences of the 16S rRNA genes. Isolates V1, V3, and V5 demonstrated significant resemblance to Bacillus sp., with V2 displaying close affinity to Stenotrophomonas, and V7 exhibiting a close relationship to E. coli. Numerous investigations have suggested that Bacillus sp. exhibits notable resistance to heavy metal toxicity and possesses the ability to eliminate metals (Abidina et al., 2020). This discovery aligns with other studies indicating that strains of Bacillus sp. and Pseudomonas sp. exhibit a capacity for resistance to multiple metals (Pereira & Ramaiah, 2019; Abidina et al., 2020). The identification of five bacteria with resistance to metals and the ability for biodegradation capabilities serves as a foundational study for the development of potential candidates for local bioremediation in the treatment of toxic effluents. These bacteria have demonstrated their ability to tolerate high metal concentrations and exhibit the potential to degrade or detoxify these harmful substances. This study lays the groundwork for further research and optimization of these bacteria, leading to the design and implementation of efficient treatment strategies for contaminated effluents. The utilization of these local bioremediation agents holds promise for addressing heavy metal pollution to protect both human health and the environment.

The objective of this investigation was to isolate and identify bacteria exhibiting resistance to heavy metals from industrial effluent, CETP, and the Sirsa River in Baddi, Himachal Pradesh. Six specific heavy metals (Cu, Zn, Cd, Pb, Hg, and Cr) were the focus of attention in this study. Through the investigation, five heavy metal-resistant bacteria were successfully isolated and identified as Bacillus cereus (OR243903), Stenotrophomonas maltophila (OR243725), Bacillus cereus (OR244395), Bacillus cereus (OR243740), and E. coli (OR244383). Their ability to tolerate heavy metals makes them potential candidates for the development of local bioremediation agents in effluent treatment technology. All the isolated bacteria exhibited a high capacity for multi-metal tolerance, indicating their suitability for potential future use in remediating sites contaminated with heavy metals. The contaminated environment has exerted pressure on these microorganisms, leading to the development of various survival mechanisms in the presence of high metal concentrations. As a result, these bacteria hold promise as effective tools for removing heavy metals from contaminated effluents and river bodies.

The findings of this study support the notion that the identified bacteria (Bacillus cereus, Stenotrophomonas maltophila, Bacillus cereus, Bacillus cereus, and E. coli) possess significant bioremediation potential. They can be harnessed to develop bioremediation agents for detoxifying effluents in the industrial area of Baddi and the Sirsa River. Furthermore, these bacteria's ability to resist different heavy metals offers a valuable tool for monitoring multiple contaminants and pollutants in the environment simultaneously. Bioremediation, relying on microbial action, is considered a safe and effective technology. Bacteria, in particular, are crucial candidates that warrant further exploration of their bioremediation capabilities. While some studies have been conducted in this area, more comprehensive and extensive research is needed to fully harness the potential of bacterial systems as mitigators of heavy metal contamination.

Consent to participate

The authors collectively acknowledged their involvement in the preparation of the manuscript.

Conflict of interest

All authors have carefully reviewed and approved the manuscript, and they have disclosed no conflicts of interest related to the present study.

Funding

No funding was obtained for this study.

Author Contribution

Conceptualization: V. G., S. K.; Methodology: V. G.; Formal analysis and investigation: V. G., C.K.; Writing-preparation of the original draft: V. G. & M. D. S.; Writing-review and editing: S.K., P.K. ; Resources & Supervision: S. K. All authors have carefully reviewed and approved the manuscript, and they have disclosed no conflicts of interest related to the present study.

Acknowledgments

We express our gratitude to Professor P. K. Khosla, Chancellor of Shoolini University of Biotechnology and Management Sciences, Solan, for his unwavering support and encouragement.

Abd Elhady, M. A. E., Elsayed, A. I., Mohamed, S. H., Aboellil, A. H., & Ahmad, M. S. (2020). Isolation and identification of heavy metal tolerant bacteria from sugarcane industrial wastewater. Applied Ecology and Environmental Research, 18(1), 1387-1406. https://doi.org/ 10.15666/aeer/1801_13871406
Abidina, Z. A. Z., Badaruddinb, P. N. E., & Chowdhury, A. J. K. (2020). Isolation of heavy metal resistance bacteria from lake sediment of IIUM, Kuantan. Desalination and water treatment, 188, 431-435. https://doi.org/ 10.5004/dwt.2020.25298
Albdaiwi, R. N., Khyami-Horani, H., Ayad, J. Y., Alananbeh, K. M., & Al-Sayaydeh, R. (2019). Isolation and characterization of halotolerant plant growth promoting rhizobacteria from durum wheat (Triticum turgidum subsp. durum) cultivated in saline areas of the Dead Sea region. Frontiers in Microbiology, 10, 1639. https://doi.org/ 10.3389/fmicb.2019.01639
Abo-Amer, A. E., El-Shanshoury, A. E. R. R., & Alzahrani, O. M. (2015). Isolation and molecular characterization of heavy metal-resistant Alcaligenes faecalis from sewage wastewater and synthesis of silver nanoparticles. Geomicrobiology Journal, 32(9), 836-845. https://doi.org/ .1080/01490451.2015.1010754
Biswas, A., Sharma, Y., Kundu, N., & Bala, K. (2019). Isolation and molecular characterization of heavy metal resistant bacteria from barrages of Yamuna River, New Delhi, India. Plant Cell Biotechnology and Molecular Biology, 212-221.
Biswas, J. K., Mondal, M., Rinklebe, J., Sarkar, S. K., Chaudhuri, P., Rai, M., Shaheen, S. M., Song, H., & Rizwan, M. (2017). Multi-metal resistance and plant growth promotion potential of a wastewater bacterium Pseudomonas aeruginosa and its synergistic benefits. Environmental Geochemistry and Health, 39:1583-93. https://doi.org/ 10.1007/s10653-017-9950-5
Choudhury, T. R., Ferdous, J., Haque, M. M., Rahman, M. M., Quraishi, S. B., & Rahman, M. S. (2022). Assessment of heavy metals and radionuclides in groundwater and associated human health risk appraisal in the vicinity of Rooppur nuclear power plant, Bangladesh. Journal of Contaminant Hydrology, 251, 104072. https://doi.org/ 10.1016/j.jconhyd.2022.104072
DalCorso, G., Fasani, E., Manara, A., Visioli, G., & Furini, A. (2019). Heavy metal pollution: state of the art and innovation in phytoremediation. International Journal of Molecular Sciences, 20(14), 3412. https://doi.org/10.3390/ijms20143412
El-Sorogy, A. S., Youssef, M., & Al-Hashim, M. H. (2023). Water quality assessment and environmental Impact of heavy metals in the red sea coastal seawater of Yanbu, Saudi Arabia. Water, 15(1), 201. https://doi.org/10.3390/w15010201
Faudzi, F., Yunus, K., Miskon, M. F., & Azid, A. (2019). Assessment of trace metals using chemometric analysis in Kuantan River, East Coast Malaysia. Journal Clean WAS, 3(2), 01-04. http://doi.org/10.26480/jcleanwas.02.2019.01.04
Garima V. (2017). Studies on isolation of heavy metal resistant bacteria from Berach river system and their characterization. Mohan Lal Sukhadia University, Udaipur India.
Hayder, R., Hafeez, M., Ahmad, P., Memon, N., Khandaker, M. U., Elqahtani, Z. M., et al. (2022). Heavy Metal Estimation and Quality Assurance Parameters for Water Resources in the Northern Region of Pakistan. Water, 15(1), 77. https://doi.org/ 10.3390/w15010077
Herojeet, R., Rishi, M. S., & Kishore, N. (2015). Integrated approach of heavy metal pollution indices and complexity quantification using chemometric models in the Sirsa Basin, Nalagarh valley, Himachal Pradesh, India. Chinese Journal of Geochemistry, 34, 620-633. https://doi.org/ 10.1007/s11631-015-0075-1
Jahan, N., Idrees, M., Zahid, M., Ali, N., & Hussain, M. (2016). Molecular identification and characterization of heavy metal resistant bacteria and their role in bioremediation of chromium. British Microbiology Research Journal, 13(6), 1-11. https://doi.org/ 10.9734/BMRJ/2016/22909
Kumar, V., & Mohan, K. (2019). Land use-land cover change in Baddi industrial town, Himachal Pradesh. International Journal of Research and Analytical Reviews, 6, 985-995.
Kumar, V., Sharma, A., Kumar, R., Bhardwaj, R., Kumar Thukral, A., & Rodrigo-Comino, J. (2020). Assessment of heavy-metal pollution in three different Indian water bodies by combination of multivariate analysis and water pollution indices. Human and Ecological Risk Assessment: An International Journal, 26(1), 1-16. https://doi.org/10.1080/10807039.2018.1497946
Marzan, L. W., Hossain, M., Mina, S. A., Akter, Y., & Chowdhury, A. M. A. (2017). Isolation and biochemical characterization of heavy-metal resistant bacteria from tannery effluent in Chittagong city, Bangladesh: Bioremediation viewpoint. The Egyptian Journal of Aquatic Research, 43(1), 65-74. https://doi.org/10.1016/j.ejar.2016.11.002
Medfu Tarekegn, M., Zewdu Salilih, F., & Ishetu, A. I. (2020). Microbes used as a tool for bioremediation of heavy metal from the environment. Cogent Food & Agriculture, 6(1), 1783174. https://doi.org/10.1080/23311932.2020.1783174
Mihdhir, A. A., Assaeedi, A. S., Abulreesh, H. H., & Osman, G. E. (2016). Detection, identification and characterization of some heavy metals tolerant bacteria. Journal of Microbial and Biochemical Technology, 8(3), 226-230. https://doi.org/10.4172/1948-5948.1000290
Mokarram M, Saber A, Sheykhi V (2020). Effects of heavy metal contamination on river water quality due to release of industrial effluents. Journal of Cleaner Production, 277: 123380. https://doi.org/10.1016/j.jclepro.2020.123380
Murthy, S., Bali, G., & Sarangi, S. K. (2012). Lead biosorption by a bacterium isolated from industrial effluents. International Journal of Microbiology Research, 4(3), 192.
Navarro-Noya, Y. E., Hernández-Mendoza, E., Morales-Jiménez, J., Jan-Roblero, J., Martínez-Romero, E., & Hernández-Rodríguez, C. (2012). Isolation and characterization of nitrogen-fixing heterotrophic bacteria from the rhizosphere of pioneer plants growing on mine tailings. Applied Soil Ecology, 62, 52-60. https://doi.org/ 10.1016/j.apsoil.2012.07.011
Naz, T., Khan, M. D., Ahmed, I., Rehman, S. U., Rha, E. S., Malook, I., & Jamil, M. (2016). Biosorption of heavy metals by Pseudomonas species isolated from sugar industry. Toxicology and Industrial Health, 32(9), 1619-1627. https://doi.org/10.1177/0748233715569900
Neeta, B., Maansi, V., & Harpreet, S. B. (2016). Characterization of heavy metal (cadmium and nickle) tolerant Gram negative enteric bacteria from polluted Yamuna River, Delhi. African Journal of Microbiology Research, 10(5), 127-137. https://doi.org/ 10.5897/AJMR2015.7769
Niveshika, Singh, S., Verma, E., & Mishra, A. K. (2016). Isolation, characterization, and molecular phylogeny of multiple metal tolerant and antibiotics resistant bacterial isolates from river Ganga, Varanasi, India. Cogent Environmental Science, 2(1), 1273750. https://doi.org/10.1080/23311843.2016.1273750
Nokman W, Benluvankar V, Packiam SM, Vincent S. Screening and molecular identification of heavy metal resistant Pseudomonas putida S4 in tannery effluent wastewater. Biocatalysis and Agricultural Biotechnology. 2019 Mar 1;18:101052. https://doi.org/10.1016/j.bcab.2019.101052
Noreen, A., Elahi, A., Bukhari, D. A., & Rehman, A. (2020). Multiple Metal Resistant Bacillus cereus 3.1 S Isolated from Industrial Effluent has Promising Arsenite Oxidizing Potential. Pakistan Journal of Zoology, 52(6), 2173. https://doi.org/ 10.17582/journal.pjz/20190620050601
Nwagwu, E. C., Yilwa, V. M., Egbe, N. E., & Onwumere, G. B. (2017). Isolation and characterization of heavy metal tolerant bacteria from Panteka stream, Kaduna, Nigeria and their potential for bioremediation. African Journal of Biotechnology, 16(1), 32-40. https://doi.org/10.5897/AJB2016.15676
Oaikhena, E. E., Makaije, D. B., Denwe, S. D., Namadi, M. M., & Haroun, A. A. (2016). Bioremediation potentials of heavy metal tolerant bacteria isolated from petroleum refinery effluent. American Journal of Environment Protection, 5(2), 29-34. https://doi.org/10.11648/j.ajep.20160502.12
Pandit, R. J., Patel, B., Kunjadia, P. D., & Nagee, A. (2013). Isolation, characterization and molecular identification of heavy metal resistant bacteria from industrial effluents, Amala-khadi-Ankleshwar, Gujarat. International Journal of Environmental Sciences, 3(5), 1689-1699. https://doi.org/10.6088/ijes.2013030500037
Pereira, E. J., & Ramaiah, N. (2019). Chromate detoxification potential of Staphylococcus sp. isolates from an estuary. Ecotoxicology, 28, 457-466. https://doi.org/10.1007/s10646-019-02038-w
Perelomov, L., Sizova, O., Rahman, M. M., Perelomova, I., Minkina, T., Sokolov, S., & Atroshchenko, Y. (2022). Metal-Tolerant Bacteria of Wastewater Treatment Plant in a Large City. Sustainability, 14(18), 11335. . https://doi.org/10.3390/su141811335
Saeed, M. U., Hussain, N., Sumrin, A., Shahbaz, A., Noor, S., Bilal, M., et al. (2022). Microbial bioremediation strategies with wastewater treatment potentialities–A review. Science of the Total Environment, 818, 151754. https://doi.org/ 10.1016/j.scitotenv.2021.151754
Sethi, V., Walia, Y. K., Rana, V., & Gautam, D. (2022) Evaluation of water quality using physicochemical parameters of Riverine Areas of Baddi (HP), India. Ecology, Environment and Conservation, 28, S171-S176. http://doi.org/10.53550/EEC.2022.v28i04s.024
Singh, S., & Hiranmai, R. Y. (2021). Monitoring and molecular characterization of bacterial species in heavy metals contaminated roadside soil of selected region along NH 8A, Gujarat. Heliyon, 7(11). https://doi.org/10.1016/j.heliyon.2021.e08284
Su, L. S. (2016). Isolation and identification of heavy metal-tolerant bacteria from an industrial site as a possible source for bioremediation of cadmium, lead, and nickel. Advances in Environmental Biology, 10, 10-15.
Syafiqah, I., & Yussof, H. W. (2018). The use of factorial design for analysis of mercury removal efficiency using palm oil fuel ash. Water Conservation and Management, 2(1), 10-12. https://doi.org/10.26480/wcm.01.2018.10.12
Vardhan KH, Kumar PS, Panda RC (2019). A review on heavy metal pollution, toxicity and remedial measures: Current trends and future perspectives. Journal of Molecular Liquids, 290, 111197. https://doi.org/10.1016/j.molliq.2019.111197
Varol, M., & Tokatlı, C. (2023). Evaluation of the water quality of a highly polluted stream with water quality indices and health risk assessment methods. Chemosphere, 311, 137096. https://doi.org/10.1016/j.chemosphere.2022.137096
Verma, G., Chishty, N., & Veer, C. (2017). Isolation and characterization of Pseudomonas stutzeri as lead tolerant bacteria from water bodies of Udaipur, India using 16S rDNA sequencing technique. Journal of Pure and Applied Microbiology, 11(2), 975-979. https://doi.org/10.22207/JPAM.11.2.39
Wang L, Wang Y, Ma F, Tankpa V, Bai S, Guo X, Wang X (2019). Mechanisms and reutilization of modified biochar used for removal of heavy metals from wastewater: A Review. Science of the Total Environment, 668, 1298-1309. https://doi.org/10.1016/j.scitotenv.2019.03.011
Wuana, R. A., & Okieimen, F. E. (2011). Heavy metals in contaminated soils: a review of sources, chemistry, risks and best available strategies for remediation. International Scholarly Research Notices, 2011. https://doi.org/ 10.5402/2011/402647
Yang, J., Hou, B., Wang, J., Tian, B., Bi, J., Wang, N., et al. (2019). Nanomaterials for the removal of heavy metals from wastewater. Nanomaterials, 9(3), 424. https://doi.org/ 10.3390/nano9030424
Zamora-Ledezma C, Negrete-Bolagay D, Figueroa F, Zamora-Ledezma E Ni M, Alexis F, Guerrero VH (2021) Heavy metal water pollution: A fresh look about hazards, novel and conventional remediation methods. Environmental Technology & Innovation, 101504. https://doi.org/10.1016/j.eti.2021.101504
Zaynab, M., Al-Yahyai, R., Ameen, A., Sharif, Y., Ali, L., Fatima, M., et al. (2022). Health and environmental effects of heavy metals. Journal of King Saud University-Science, 34(1), 101653. https://doi.org/10.1016/j.jksus.2021.101653

No competing interests reported.

Suplementarytable.docx

Download PDF

Editorial decision: Revision requested
21 Oct, 2024
Editor assigned by journal
21 Oct, 2024
Submission checks completed at journal
21 Oct, 2024
First submitted to journal
04 Oct, 2024

You are reading this latest preprint version

Molecular Identification and Characterization of Bacteria Exhibiting Resistance to Different Metal isolated from Industrial Effluents, CETP, and Sirsa River, Baddi, Himachal Pradesh, India

Status:

Version 1

Abstract

Figures

1. Introduction

2. Methodology

2.1 Study area description

2.2 Sample collection

2.3 Isolation and Assessment of Bacteria Resistant to Heavy Metals

2.4 Characterization of isolated bacteria

2.5 Determination of minimum inhibitory concentrations (MICs) for heavy metals

2.6 Optimization of growth conditions

2.6.1 Determining the most favorable temperature and pH conditions for optimal growth.

2.6.2 Growth Studies

2.7 Genomic DNA isolation

2.8 Sequencing of 16SrRNA gene, identification of bacterial isolates, and phylogenetic analysis

2.9 Statistical analysis

3. Results and Discussion

3.2 Determination of minimum inhibitory concentration (MIC)

3.3 The impact of temperature and pH on the proliferation of bacteria resistant to metals

3.4 The growth dynamics of the bacterial isolate when exposed to metal concentrations

3.5 Identification of the bacterial isolates

Discussion

Conclusion

Declarations

Consent to participate

Funding

Author Contribution

Acknowledgments

References

Additional Declarations

Supplementary Files

Status:

Version 1