MyD88 mediates noncytopathic bovine viral diarrhea virus replication by regulating cellular autophagy and proliferation

doi:10.21203/rs.3.rs-5203898/v1

Download PDF

Research Article

MyD88 mediates noncytopathic bovine viral diarrhea virus replication by regulating cellular autophagy and proliferation

https://doi.org/10.21203/rs.3.rs-5203898/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Bovine viral diarrhea virus(BVDV) is classified into cytopathic (CP) and noncytopathic (NCP) types. Previous studies have confirmed that NCP BVDV infection is the main cause of persistent infection and immune suppression in cattle, and the molecular mechanism of its immune evasion remains unclear. We initially examined the replication of the AV303 strain (NCP BVDV) in MDBK cells at different time points. Proteomic analysis at the peak replication time point revealed that the TLR signaling pathway and the adaptor protein MyD88 were upregulated. We subsequently confirmed that AV303 induced autophagy and proliferation in cells, as indicated by increased autophagic activity and cell proliferation rates following viral infection. Knocking down MyD88 downregulated the virus-induced activation of autophagy and proliferation. Mechanistically, AV303 regulates cell proliferation by promoting ERK1/2 and mTOR, and ERK1/2 activity is inhibited after MyD88 is knocked down. AV303 replication levels increased with autophagy activation and decreased with autophagy inhibition. This study demonstrates that the activity of MyD88 mediated by the AV303 strain can regulate host cell autophagy and proliferation, creating advantageous conditions for its replication. This study demonstrates a new mechanism host-NCP BVDV interaction and the potential of MyD88 as a novel anti-NCP BVDV drug.

MyD88

NCP BVDV

Autophagy

Cell Proliferation

Virus Replication

Viruses, as noncellular organisms, rely on their hosts for the energy and environmental conditions necessary for their survival and reproduction. As foreign entities, they are often targeted and eliminated by various defense systems of the host. Consequently, viruses must continually evolve sophisticated strategies to evade host defenses[1]. Bovine viral diarrhea virus (BVDV) is a member of the Flaviviridae and Pestiviridae families and is a single-stranded RNA virus that causes high fever, diarrhea, and damage to the mucous membranes of the esophagus and digestive tract in cattle, which results in significant economic losses to the livestock industry. BVDV can be classified as cytopathic (CP) or noncytopathic (NCP) on the basis of the two different phenotypes (biotypes) exhibited in cell culture[2]. Of these two varieties, NCP BVDV can cause fetal infection and persistent infection in cows during pregnancy, which is also a major cause of immune suppression in cattle[3]. Additionally, CP BVDV can transform into NCP BVDV[4].

Autophagy is a crucial and evolutionarily conserved cellular mechanism that facilitates the encapsulation of damaged proteins, organelles, and microorganisms within double-membraned autophagic vesicles for subsequent lysosomal degradation[5–7]. This process enables cells to eliminate senescent organelles and damaged structures and reuse them, especially under stressful conditions such as cellular starvation, malnutrition, or pathogen invasion. The role of autophagy in essential biological functions, including innate immunity and inflammation, has been well documented[8]. Numerous viruses, such as African swine fever virus (ASFV), foot-and-mouth disease virus (FMDV), pseudorabies virus (PRV), and Japanese encephalitis virus (JEV), are capable of initiating host autophagy following infection[9]. The interaction between autophagy and viruses results in various outcomes; in some cases, the activation of autophagy facilitates viral replication, as observed with Newcastle disease virus (NDV)[10] and JEV[11]. In contrast, the activation of autophagy inhibits the replication of viruses, such as herpes virus (HPV)[12]. Several viruses in the Flaviviridae family have been shown to induce autophagy both in vitro and in vivo. In addition, two biological types of BVDV can activate autophagy[13], but the underlying mechanisms and dynamics remain incompletely understood. Like other viruses, BVDV has developed strategies that allow it to evade host immune responses as it continues to spread and infect hosts[14]; however, it is still uncertain whether autophagy is dominant, even though studies have shown that BVDV-induced autophagy may facilitate replication[15].

Cell proliferation results from cell growth and division, which are primarily controlled by the cell cycle[16]. After cell proliferation, it can create replication conditions for viruses. For example, human papillomavirus (HPV) interferes with host cell cycle regulation by expressing specific proteins, thereby promoting cell proliferation and creating an environment conducive to virus proliferation[17]. HIV utilizes the polymerase and nucleotides of host cells for genome replication[18]. In addition, certain viruses, such as the EB virus, can activate the proliferation signaling pathway of host cells, leading to latent or persistent infection within the host's body[19, 20]. Therefore, we assume that the NCP BVDV also has evolved similar abilities. We investigated whether NCP BVDV regulates host cells by detecting the activity of the classical cell proliferation signaling pathways Akt/mTOR and MAPK/ERK 1/2.

Previous omics studies have provided insights into the changes in life processes within the host following viral infection[21, 22]; however, the mechanisms underlying the interaction between BVDV infection and the host remain poorly understood. In this study, we conducted a proteomic analysis of MDBK cells infected with NCP BVDV to elucidate alterations in intracellular biological processes after viral infection. The results reveal a significant association between AV303 infection and the TLR7‒MyD88 axis. Toll-like receptors (TLRs), as pattern recognition receptors, quickly identify pathogen characteristics and initiate the signaling cascades involved in immune defense[23, 24]. There is plentiful evidence suggesting a significant association between TLRs and the process of autophagy following various infections[25]. For example, single-stranded RNA (ssRNA) and other TLR7 agonists are recognized as potent inducers of autophagy[26]. Similarly, TLR4, activated by lipopolysaccharides (LPS), and TLR3, activated via the TRIF-dependent pathway, have been shown to activate autophagy[27]. Moreover, TLR8 is crucial for the induction of autophagosomes in response to HIV-1 infection[28]. MyD88 is a bridging protein that activates all TLR pathways except TLR3, although several studies indicate that MyD88 activity is essential for autophagy[29–31]; however, reports regarding its role in the context of pathogenic infections have been inconsistent. Additionally, MyD88 has been shown to target signaling pathways related to immune cell and cancer cell proliferation[32–34], which prompted us to study its involvement in the cell proliferation influenced by NCP BVDV.

In this study, we report that AV303 (NCP type) induces cellular autophagy through MyD88 and promotes the proliferation rate of MDBK cells after infection, and identify a new immune evasion mechanism for NCP BVDV and the important role of MyD88 in NCP BVDV replication

Cells and viruses.

MDBK cells were stored in our laboratory and cultured in RPMI-1640 containing 10% fetal bovine serum (cell-box, AUS-01S-02-S). The AV303 strain (NCP type) was purchased from the China Veterinary Culture Collection Center and preserved by our laboratory.

Proteomic sequencing and analysis.

The protein was extracted using the SDT lysis method (4% (w/v) SDS, 100 mM Tris/HCl pH 7.6, 0.1 M DTT) and then quantified using the BCA method. An appropriate amount of protein was extracted from each sample, and the filter-aided protein preparation (FASP) method was used for trypsin hydrolysis. 18 cartridges were used to desalinate the peptide segments. After freeze-drying, 40 µL of 0.1% formic acid solution was added for reconstitution, and the peptide segments (OD280) were quantified. Peptide segments (100 µg) from each sample were labeled according to the instructions of the Thermo TMT labeling kit. Each group contained 3 biological replicates, for a total of 6 samples. The labeled peptides were fractionated with a high-pH reversed-phase peptide fractionation kit (Thermo Scientific). The dried peptide mixture was reconstituted and acidified with 0.1% TFA solution and loaded onto an equilibrated, high-pH, reversed-phase fractionation spin column. Peptides are bound to the hydrophobic resin under aqueous conditions and desalted by washing the column with water via low-speed centrifugation. A step gradient of increasing acetonitrile concentrations in a volatile high-pH elution solution is then applied to the columns to elute bound peptides into 10 different fractions collected by centrifugation. The collected fractions were desalted on C18 cartridges (EmporeTM SPE cartridges C18 (standard density), bed I.D. 7 mm, Volume 3 ml, Sigma) and concentrated by vacuum centrifugation. Each sample was separated via an easy nLC HPLC system with a nanoliter flow rate. The chromatographic column was equilibrated with 95% A solution, and the sample was loaded onto a loading column (Thermo Scientific Acclaim PepMap100, 100 µm * 2 cm, nanoViper C18) via an automatic sampler. The sample was then separated on an analytical column (Thermo Scientific EASY column, 10 cm, ID 75 µm, 3 µm, C18-A2) at a flow rate of 300 nL/min. After chromatographic separation, the sample was analyzed via mass spectrometry using a Q Exactive mass spectrometer. The detection method was positive ion mode, with a scanning range of 300–1800 m/z for parent ions, a primary mass spectrometry resolution of 70000 at 200 m/z, an automatic gain control (AGC) target of 1e6, a maximum internal time (IT) of 50 ms, and a dynamic exclusion time of 60.0 s. The mass-charge ratios of the peptides and peptide fragments were determined using the following method: 20 fragment spectra (MS2 scan) were collected after each full scan, with an MS2 activation type HCD isolation window of 2 m/z, a secondary mass spectrometry resolution of 17500 at 200 m/z, a normalized collision energy of 30 eV, and an underwater energy of 0.1%. The raw data used for mass spectrometry analysis were RAW files, and the software programs Mascot 2.2 and Proteome Discoverer 1.4 were used for inventory identification and quantitative analysis, including principal component analysis (PCA), partial least square discriminant analysis (PLS-DA), univariate analysis, and pathway analysis. For metabolomics analysis, multivariate statistical analyses such as PCA and PLS-DA and univariate statistical analyses (Student’s t test, Mann–Whitney-Wilcoxon U test, analysis of variance [ANOVA], and correlation analysis) were performed.

Cell proliferation assay.

Adherent cells and cell suspensions after virus infection were treated using the BeyoClick™ EdU Cell Proliferation Kit with Alexa Fluor 594 and observed using a confocal fluorescence microscope (Ningbo Sunny RX50RFL) and flow cytometry (Thermo CytoFLEX).

Total RNA was extracted, and real-time quantitative reverse transcription PCR (RT‒qPCR) was performed.

The cells were lysed using RNAiso Plus (Takara, Kyoto, Japan). Cell RNA was extracted using reagents, including chloroform, isopropanol, and absolute ethanol, with shaking and centrifugation according to the manufacturer's protocol. One percent gel electrophoresis was used to verify the integrity of the RNA, after which the RNA was reverse transcribed to cDNA using EasyScript® One-Step gDNA Removal and cDNA Synthesis SuperMix. The quantitative detection of mRNA was performed using a real-time PCR instrument (qTOWER3G, Analytik Jena) with a program set at 94°C/5 min, 94°C/30 s→ 60°C/30 s × 35 cycles. The following primers (Table 1A) were designed in NCBI (National Center for Biotechnology Information) and Primer3 Input 4.0 and synthesized by Sango, and detection was performed using MCE (MedChemExpress) qPCR Master Mix and YBR Green qPCR Master Mix (Universal).

Assessment of autophagy flux.

The cells were seeded onto slides and transfected at a density of 50–70% using the lentiviral vector Mchery EGFP-LC, purchased from HanBio Technology (Shanghai, China). The principle is based on the stability of two fluorescent environments with different pH values. When autophagosomes are formed both green and red fluorescence can be detected, and autophagosomes can be observed as yellow fluorescence. However, when autophagosomes are formed and the pH is acidic, and GFP fluorescence is quenched, only red fluorescence can be observed. Therefore, when both red dot fluorescence (mCherry) and green dot fluorescence (GFP) increase, this indicates an increase in autophagy flux.

Western blotting.

Adherent cells were lysed with RIPA protein lysis buffer (Solarbio), and their concentrations were determined and normalized using a BCA protein quantification kit (Shanghai Yaenzyme Biotechnology). The extracted protein was added to the sample buffer in equal proportions, and the SDS‒PAGE mixture was prepared for electrophoresis with a Bio-Rad electrophoresis-transfer device and a PVDF membrane for transfer. The membrane was subsequently placed in commercial rapid blocking solution (Shanghai Yazyme) for 15 min, after which the primary antibodies were incubated at 4°C overnight. The following primary antibodies were used: BVDV E2 mAb (rabbit, VMRD P130715), ATG5 (rabbit, Abcam Cat#ab228668), LC3B (rabbit, Abcam Cat#ab48394), nucleoprin p62 (rabbit, Abcam Cat#ab96134), Akt (rabbit, Abcam Cat#ab8805), Akt (S473) (rabbit, Abcam Cat#ab81283), mTOR (rabbit, Abcam Cat#ab32028), mTOR (phospho S2448) (rabbit, Abcam Cat#ab109268), MyD88 (rabbit, Proteintech Cat#23230-1-AP), TLR7 (rabbit, cst Cat#5632), IRF3 (rabbit, HUABIO Cat#ET1612-14), IRF7 (rabbit, ABclonal Cat#A0159), and ERK1/2 (rabbit, ABclonal, The samples were subsequently rinsed with TBST 3‒5 times for 10 min and incubated with the secondary antibody at room temperature for 1‒2 h after aspiration. The secondary antibodies used were goat anti-rabbit IgG H&L (Bioss, bs-80295G-HRP) and goat anti-mouse IgG H&L (Bioss, bs-0296G-HRP).

Immunofluorescence.

After cells are infected by viruses, the cells were fixed with 4% paraformaldehyde, permeabilized with 0.2% Triton X-100 and PBST (PBS + 0.1% Twenn20) supplemented with 1% BSA, and incubated with the Alexa Fluor-conjugated primary antibody in a wet cassette for 1 h, followed by incubation with the secondary antibody for 1 h at room temperature in the dark, and incubation for 5–10 min with the nuclear dye Hoechst. Mounting medium was used to mount and observe the samples under a fluorescence microscope.

Transfection by Electroporation.

RNA oligonucleotides were synthesized by GenePharma. The sequences for the Si MyD88 oligonucleotides are as follows (5' to 3'): Sense: CUUGACGAAUACCUGCAATT; Antisense: UUGCAGGUAUUCGUCAGAGTT. The sequences for the NC (negative control) oligonucleotides were as follows: sense: UUCUCCGAACGUCACGUTT; antisense: ACGUGACACGUUCGGAGAATT. Cells that had been passaged normally were cultivated to 80% confluence. Next, the cells were trypsinized, centrifuged, and washed three times with serum-free medium. The cells were then resuspended in electrophoresis buffer. For electroporation, 10 µL of NC or Si MyD88 plasmids were added to each 200 µL of cell suspension, which was then transferred into an electrode cup. The electroporation instrument was set to deliver a 900 V square wave. After electroporation, the cell suspensions were transferred to a six-well cell culture plate and stabilized by the addition of 5% fetal bovine serum. The cells were then incubated for 6 hours.

Transmission electron microscopy.

Discard the culture medium from the cell culture well plate (cell density not greater than 80%) then trypsin and medium were added to obtain a cell suspension, which was aspirated into a centrifuge tube and centrifuged at low speed (no more than 3000 rpm) for approximately 3–5 min. The supernatant was discarded, electron microscope fixative solution was added (the fixative solution needed to be restored to room temperature in advance), and the cell mass was removed and resuspended. The mixture was fixed at room temperature in the dark for 30 min, transferred to 4°C for storage, and transferred to Wuhan Saiwei Biotechnology Co., Ltd., for imaging.

Statistical analysis.

GraphPad Prism version 8.0 (GraphPad software) was used for statistical analysis. All data are presented as means ± SDs, and p < 0.05 was considered to indicate a statistically significant difference. All the samples were analyzed in triplicate. Proteomics uses Fisher's exact test to compare the distribution of various GO classifications (or KEGG pathways or domains) in the target protein set and overall protein set and performs GO annotation or KEGG pathway enrichment analysis on the target protein set.

NCP BVDV infection activates the TLR7‒MyD88 signaling pathway.

RT‒qPCR detection of the copy number of AV303 at different time points and the generation of growth curves revealed that the highest replication rate was observed between 36 and 48 hpi (Fig. 1A). Immunofluorescence detection of MDBK cells infected with the AV303 strain at 48 hpi was then performed, and the amount of viral mRNA in the infected cells was determined. The results revealed that the virus successfully infected the cells with high infection efficiency (Fig. 1B). Based on the above results, we selected 48 hpi for proteomics sample collection. Significantly differentially expressed proteins, including MyD88 (Fig. 1C), were identified among the protein entries with significant differences. Western blotting and qRT‒PCR confirmed the significant upregulation of MyD88 protein and mRNA levels, as well as activation of the TLR7 pathway (Fig. 1D). The functional annotation results of the differentially expressed proteins revealed significant differences in protein biological processes between the upregulated and downregulated MDBK cells after infection. The important differentially expressed terms included extracellular organelles, drug metabolic processes, small-molecule metabolic processes, oxidation reduction processes, the mitochondrial inner membrane, and the organelle inner membrane (Fig. 1E). In the control vs. NCP proteomics, KEGG-identified differentially expressed proteins, including those associated with the pentose phase pathway, the Toll and Imd signaling pathway, the AMPK signaling pathway, the MAPK signaling pathway, and the Toll-like receptor signaling pathway, were significantly upregulated. The significantly downregulated genes were involved in geraniol degradation, tryptophan metabolism, complex and coagulation cascades, the hematopoietic cell lineage, the integrated immune network for lgA production, and the production of cell adhesion molecules and stereoid biosynthesis (Fig. 1F).

MyD88 mediates AV303-induced autophagy in MDBK cells.

To detect the autophagy activity of MDBK cells infected with the AV303 virus strain, we examined the expression of autophagy-related proteins, including the autophagosome marker LC3, the autophagy-related gene ATG5, and the autophagosome-related protein SQSTM1 (P62). Compared with the control group, the ratio of LC3II/LC3I and the expression level of ATG5 were significantly greater in the infected group, and the activity of P62 was also significantly lower (Fig. 2A). The transmission electron microscopy results revealed a significant increase in the number of autophagosomes (autolysosomes) in the infected group (Fig. 2B). In addition, further detection of autophagy flux using a dual color tag fused with LC3 (mCherry GFP-LC3) revealed a significant increase in the number of autophagosomes and autolysosomes (Fig. 2C).

Many studies have shown that MyD88 can activate autophagy[35], but it has not been confirmed whether BVDV-induced autophagy is related to MyD88. The MyD88 gene was knocked down by Si RNA with high efficiency (Fig. 2D). We subsequently infected MyD88-knockdown cells with AV303 and found that the expression levels of LC3 and ATG5 were significantly decreased following MyD88 knockdown, whereas the expression of P62 was upregulated, although the difference was not significant (Fig. 2E). The TEM results further revealed that there was no significant difference in the number of autophagosomes/autophagosomes between the MyD88-knockdown and control groups after infection (Fig. 2F). In addition, the mCherry GFP‒LC3 autophagy fluorescence system revealed that autophagy was blocked after MyD88 knockdown (Fig. 2G).

MyD88 activity affects cell proliferation.

We were interested in investigating the potential association between cellular activities and MyD88 and hypothesized that viruses may manipulate cellular proliferation to facilitate their replication. Therefore, we examined postinfection cellular proliferative activity. Immunofluorescence and flow cytometry demonstrated the enhancement of cell proliferation signals after infection (Fig. 3A, 3B). Cell proliferation refers to the vital process of cell division, which is regulated by extracellular signals (such as growth factors[36]), intracellular signals (such as the cell proliferation signaling pathways Akt/mTOR[37] and MAPK/ERK[38]), and environmental factors (such as nutrients and oxygen levels). Consequently, we examined the signaling pathways that regulate cell growth and proliferation and the activities of Akt/mTOR and ERK1/2. The results revealed that the phosphorylation of Akt/mTOR and ERK1/2 increased (Fig. 3C). These findings confirmed that AV303 can promote cell proliferation by activating the extracellular signaling pathway. Furthermore, we examined whether knocking down MyD88 resulted in any changes, and the results revealed that the proliferative activity of MyD88-knockdown cells was alleviated after infection with AV303 (Fig. 3D, 3E); however, Akt/mTOR was still activated, and ERK1/2 was inhibited (Fig. 3F). Therefore, we confirmed that the activity of MyD88 affects cell proliferation, which is related to the activation of the Akt/mTOR and ERK1/2 pathways.

The autophagic activity of MDBK regulates the replication of AV303.

Based on these findings, we speculated that the replication of NCP BVDV is related to the autophagic activity of MDBK. Therefore, we treated the cells with the autophagy activator rapamycin and the autophagy inhibitor MHY1485 and then infected them with the virus. The western blotting results revealed that the Akt/mTOR pathway was activated by MHY1485, inhibited by rapamycin (Fig. 4A), and regulated the autophagy induced by AV303 infection (Fig. 4B). Moreover, the use of both rapamycin and MHY1485 for viral infection affected the replication of the virus. The accumulation of NCP BVDV mRNA and the protein expression of E2 were promoted by rapamycin but inhibited by MHY1485 (Fig. 4C, 4D). As shown in Fig. 4E, Autophagy inhibitors reduce the fluorescence signal of BVDV E2, while autophagy activators increase the fluorescence signal of BVDV E2. Therefore, the replication ability of AV303 is closely related to its ability to induce autophagy. When autophagy is significantly inhibited, the replication ability of the AV303 virus decreases significantly; when autophagy activity is increased, replication increases

MyD88 activity mediates AV303 replication.

These results indicate that the replication of AV303 is closely related to the autophagy and proliferation of MDBK. To directly understand the relationship between MyD88 activity and AV303 replication, we simultaneously detected the mRNA levels of MyD88 knockdown and BVDV. BVDV mRNA levels exhibited a MyD88-dependent trend (Fig. 5A, B). In addition, western blotting and immunofluorescence revealed a significant decrease in BVDV E2 protein expression after MyD88 knockdown compared with the NC group (Fig. 5C, D).

The fact is that viruses have evolved various mechanisms to respond to host immunity, while the molecular mechanisms of immune evasion vary among different viruses. The preliminary omics results revealed that the number of upregulated DEPs was greater than that of downregulated DEPs, indicating that BVDV inhibits the host immune system during viral infection, which is beneficial for survival. However, during the metabolic process, the number of upregulated DEPs was significantly greater than that of downregulated DEPs, indicating that BVDV may hijack host metabolism during replication. Although it is a long-standing and serious virus, the mechanism by which BVDV evades its host has not been clearly elucidated. Previous studies have confirmed that both the CP and NCP types of BVDV induce autophagy, but only the CP type induces apoptosis[39]. There is growing evidence that the active state of autophagy can affect the immune system[40, 41]. In this study, we still observed that AV303, an NCP BVDV, can induce complete autophagic flow in cells and that the replication of NCP BVDV is closely related to autophagic activity. This process is similar to that of the Newcastle disease virus[42], where autophagy activity is not dependent on mTOR but is regulated by it.

Previous research has shown that after NCP BVDV infection the viability of infected cells was significantly greater than that of normal cells[43, 44]. Our research further investigated cell proliferation after infection. After AV303 infection, the cells proliferated more efficiently, which also indicated that the virus had a greater chance of replicating. We tested two classical pathways related to cell proliferation, namely, the Akt/mTOR and ERK pathways, which were previously shown to be closely related to cell proliferation: Akt/mTOR activation promotes cell proliferation[45], and the activity of ERK can mediate different antiapoptotic events[46]. One study revealed the relationship between these two cell types of viral strains and ERK, with the CP type activating the ERK pathway but the NCP type not doing so[47]. However, we found that ERK1/2 can be activated by the AV303 virus strain (NCP BVDV) in bovine kidney cells. The ERK pathway is not only involved in the differentiation and activation of immune cells but also regulates the immune response, which both promotes and prevents overimmunity in the immune system[48]. In addition, detection of the Akt/mTOR pathway revealed that the degree of phosphorylation of Akt and mTOR was significantly increased, and their activity still increased after MyD88 was knocked down. We believe that Akt/mTOR could inhibit apoptosis after activation. In this case, we suggest that this may explain why NCP BVDV does not cause cell apoptosis.

There has been no consensus on the effect of NCP BVDV on IFN I for a long time. This may arise from variations in the effects of different strains or differences in virulence within the same strain [49, 50]. As a foreign substance, NCP BVDV can still be sensed after invading host cells. This study investigated the immune evasion strategy of AV303 through interactions between viruses and cells. Clarifying the evasion strategy of the virus will aid in the development of vaccines and drugs. This study revealed that MyD88 can mediate the regulation of host cell autophagy and proliferation by AV303, thereby aiding in its replication (Fig. 6). These findings suggest the potential of MyD88 as a molecular target for anti-BVDV drugs.

In conclusion, our results preliminarily reveal the important role of MyD88 in the replication of NCP BVDV in cells, revealing that NCP BVDV-induced autophagy and proliferation are beneficial for replication.

Funding

This study was supported by the National Natural Science Foundation of China(32360904) and the Key Project of Yunnan Provincial Department of Science and Technology (202101AS070296)

Authors' contributions

KW: Writing–original draft, Validation, Data curation, Visualization, Writing–review & editing. JY: Methodology, Writing–original draft, Writing–review & editing. HY: Methodology, Writing–review & editing. JX: Investigation, Writing–review & editing. YC: Validation, Writing–review & editing. SL: Validation. KJ: Methodology, Validation, Supervision Writing–review & editing. XL: Funding acquisition, Resources, Supervision, Project administration, Writing–review and editing. All authors contributed to the article and approved the submitted version.

Ploegh HL (1998) Viral strategies of immune evasion. Science 280:248–253
Lindberg A, Houe H (2005) Characteristics in the epidemiology of bovine viral diarrhea virus (BVDV) of relevance to control, Preventive veterinary medicine. 72:55–73
Peterhans E, Bachofen C, Stalder H, Schweizer M (2010) Cytopathic bovine viral diarrhea viruses (BVDV): emerging pestiviruses doomed to extinction, Veterinary research. 41
Duan H, Ma Z, Xu L, Zhang A, Li Z, Xiao S (2020) A novel intracellularly expressed NS5B-specific nanobody suppresses bovine viral diarrhea virus replication, Veterinary microbiology. 240:108449
Parzych KR, Klionsky DJ (2014) An overview of autophagy: morphology, mechanism, and regulation, Antioxidants & redox signaling. 20:460–473
Zhang Z-Y, Bao X-L, Cong Y-Y, Fan B, Li G-Y (2020) Autophagy in age-related macular degeneration: A regulatory mechanism of oxidative stress, Oxidative medicine and cellular longevity. 2020
Mathew R, Karantza-Wadsworth V, White E (2007) Role of autophagy in cancer. Nat Rev Cancer 7:961–967
Xu Y, Liu X-D, Gong X, Eissa NT (2008) Signaling pathway of autophagy associated with innate immunity. Autophagy 4:110–112
Jiang H, Kan X, Ding C, Sun Y (2022) The multi-faceted role of autophagy during animal virus infection, Frontiers in Cellular and Infection Microbiology. 12:858953
Gong Y, Tang N, Liu P, Sun Y, Lu S, Liu W, Tan L, Song C, Qiu X, Liao Y (2022) Newcastle disease virus degrades SIRT3 via PINK1-PRKN-dependent mitophagy to reprogram energy metabolism in infected cells. Autophagy 18:1503–1521
Li W, Li H, Liu Y, Pan Y, Deng F, Song Y, Tang X, He Q (2012) New variants of porcine epidemic diarrhea virus, China, 2011, Emerging infectious diseases. 18:1350
Rubio RM, Mohr I (2019) Inhibition of ULK1 and Beclin1 by an α-herpesvirus Akt-like Ser/Thr kinase limits autophagy to stimulate virus replication, Proceedings of the National Academy of Sciences. 116:26941–26950
Rajput MK, Abdelsalam K, Darweesh MF, Braun LJ, Kerkvliet J, Hoppe AD, Chase CC (2017) Both cytopathic and non-cytopathic bovine viral diarrhea virus (BVDV) induced autophagy at a similar rate, Veterinary immunology and immunopathology. 193:1–9
Pang F, Long Q, Wei M (2023) Immune evasion strategies of bovine viral diarrhea virus, Frontiers in Cellular and Infection Microbiology. 13
Fu Q, Shi H, Zhang H, Ren Y, Guo F, Qiao J, Jia B, Wang P, Chen C (2014) Autophagy during early stages contributes to bovine viral diarrhea virus replication in MDBK cells. J Basic Microbiol 54:1044–1052
Ogrodnik M (2021) Cellular aging beyond cellular senescence: Markers of senescence prior to cell cycle arrest in vitro and in vivo. Aging Cell 20:e13338
McCance DJ (2005) Human papillomaviruses and cell signaling, Sci. STKE. 2005:pe29-pe29
Spence RA, Kati WM, Anderson KS, Johnson KA (1995) Mechanism of inhibition of HIV-1 reverse transcriptase by nonnucleoside inhibitors. Science 267:988–993
Guasparri I, Bubman D, Cesarman E (2008) EBV LMP2A affects LMP1-mediated NF-κB signaling and survival of lymphoma cells by regulating TRAF2 expression, Blood. J Am Soc Hematol 111:3813–3820
Luo Y, Liu Y, Wang C, Gan R (2021) Signaling pathways of EBV-induced oncogenesis. Cancer Cell Int 21:93
Ma Y, Wang L, Jiang X, Yao X, Huang X, Zhou K, Yang Y, Wang Y, Sun X, Guan X (2022) Integrative transcriptomics and proteomics analysis provide a deep insight into bovine viral diarrhea virus-host interactions during BVDV infection. Front Immunol 13:862828
Mirosław P, Rola-Łuszczak M, Kuźmak J, Polak MP (2022) Transcriptomic analysis of MDBK cells infected with cytopathic and non-cytopathic strains of bovine viral diarrhea virus (BVDV), Viruses. 14:1276
Urcuqui-Inchima S, Cabrera J, Haenni A-L (2017) Interplay between dengue virus and Toll-like receptors, RIG-I/MDA5 and microRNAs: Implications for pathogenesis, Antiviral Research. 147:47–57
Delgado M, Deretic V (2009) Toll-like receptors in control of immunological autophagy. Cell Death Differ 16:976–983
Thompson JM, Iwasaki A (2008) Toll-like receptors regulation of viral infection and disease. Adv Drug Del Rev 60:786–794
Iwasaki A (2007) Role of autophagy in innate viral recognition, Autophagy. 3:354–356
Zhan Z, Xie X, Cao H, Zhou X, Zhang XD, Fan H, Liu Z (2014) Autophagy facilitates TLR4-and TLR3-triggered migration and invasion of lung cancer cells through the promotion of TRAF6 ubiquitination, Autophagy. 10:257–268
Pietrobon AJ, Yoshikawa FS, Oliveira LM, Pereira NZ, Matozo T, de Alencar BC, Duarte AJ, Sato MN (2022) Antiviral response induced by toll-like receptor (TLR) 7/TLR8 activation inhibits human immunodeficiency virus type 1 infection in cord blood macrophages. J Infect Dis 225:510–519
Shi C-S, Kehrl JH (2008) MyD88 and Trif target Beclin 1 to trigger autophagy in macrophages. J Biol Chem 283:33175–33182
Wang Y, Li Y, Zhang T, Chi Y, Liu M, Liu Y, Genistein (2018) and Myd88 activate autophagy in high glucose-induced renal podocytes in vitro, Medical Science Monitor: International Medical Journal of Experimental and Clinical Research. 24:4823
Siracusano G, Venuti A, Lombardo D, Mastino A, Esclatine A, Sciortino MT (2016) Early activation of MyD88-mediated autophagy sustains HSV-1 replication in human monocytic THP-1 cells, Scientific Reports. 6:31302
Salcedo R, Cataisson C, Hasan U, Yuspa SH, Trinchieri G (2013) MyD88 and its divergent toll in carcinogenesis. Trends Immunol 34:379–389
Liu J-H, Chen C, Li Z-Y, Zou Z-M, Gao D-C, Zhang X, Kuang X-W, Sun Z-H, Zheng W-J, Zhou P (2020) The MyD88 inhibitor TJ-M2010-2 suppresses proliferation, migration and invasion of breast cancer cells by regulating MyD88/GSK-3β and MyD88/NF-κB signalling pathways. Exp Cell Res 394:112157
Chang J, Burkett PR, Borges CM, Kuchroo VK, Turka LA, Chang C-H (2013) MyD88 is essential to sustain mTOR activation necessary to promote T helper 17 cell proliferation by linking IL-1 and IL-23 signaling, Proceedings of the National Academy of Sciences. 110:2270–2275
Song J, Li Y, Wu K, Hu Y, Fang L (2024) MyD88 and Its Inhibitors in Cancer: Prospects and Challenges, Biomolecules. 14:562
Goustin AS, Leof EB, Shipley GD, Moses HL (1986) Growth factors and cancer, Cancer research. 46:1015–1029
Cho D, Mier JW, Atkins MB (2009) PI3K/Akt/mTOR pathway: a growth and proliferation pathway, Renal cell carcinoma: Molecular targets and clinical applications. :267–285
Nojima H, Adachi M, Matsui T, Okawa K, Tsukita S, Tsukita S (2008) IQGAP3 regulates cell proliferation through the Ras/ERK signalling cascade. Nat Cell Biol 10:971–978
Schweizer M, Peterhans E (1999) Oxidative stress in cells infected with bovine viral diarrhoea virus: a crucial step in the induction of apoptosis. J Gen Virol 80:1147–1155
Virgin HW, Levine B (2009) Autophagy genes in immunity. Nat Immunol 10:461–470
Metur SP, Klionsky DJ (2021) Adaptive immunity at the crossroads of autophagy and metabolism. Cell Mol Immunol 18:1096–1105
Fu X, Ming Y, Li C, Niu Y, Lin Q, Liu L, Liang H, Huang Z, Li N (2020) Siniperca chuatsi rhabdovirus (SCRV) induces autophagy via PI3K/Akt-mTOR pathway in CPB cells, Fish & shellfish immunology. 102:381–388
Shin SU, Han DG, Cho HC, Kim EM, Choi KS (2023) Non-cytopathic bovine viral diarrhoea virus 2 induces autophagy to enhance its replication. Veterinary Med Sci 9:405–416
Li Z, Zhang Y, Zhao B, Xue Q, Wang C, Wan S, Wang J, Chen X, Qi X (2024) Non-cytopathic bovine viral diarrhea virus (BVDV) inhibits innate immune responses via induction of mitophagy, Veterinary Research. 55:1–18
Glaviano A, Foo AS, Lam HY, Yap KC, Jacot W, Jones RH, Eng H, Nair MG, Makvandi P, Geoerger B (2023) PI3K/AKT/mTOR signaling transduction pathway and targeted therapies in cancer, Molecular cancer. 22:138
Sugiura R, Satoh R, Takasaki T (2021) ERK: a double-edged sword in cancer. ERK-dependent apoptosis as a potential therapeutic strategy for cancer, Cells. 10:2509
Yamane D, Zahoor MA, Mohamed YM, Azab W, Kato K, Tohya Y, Akashi H (2009) Activation of extracellular signal-regulated kinase in MDBK cells infected with bovine viral diarrhea virus. Arch Virol 154:1499–1503
Lucas RM, Luo L, Stow JL (2022) ERK1/2 in immune signalling. Biochem Soc Trans 50:1341–1352
Charleston B, Brackenbury L, Carr B, Fray M, Hope J, Howard C, Morrison W (2002) Alpha/beta and gamma interferons are induced by infection with noncytopathic bovine viral diarrhea virus in vivo. J Virol 76:923–927
Spetter MJ, Louge Uriarte EL, Armendano JI, Morrell EL, Cantón GJ, Verna AE, Dorsch MA, Pereyra SB, Odeón AC, Saliki JT (2020) Detection methods and characterization of bovine viral diarrhea virus in aborted fetuses and neonatal calves over a 22-year period. Brazilian J Microbiol 51:2077–2086

Table1:RT-qPCR sequence of primer

Gene	Sequence(5’—3’)
β-actin:	Forward: GCAGGAGTACGATGAGTCCG
β-actin:	Revers: GCAGGAGTACGATGAGTCCG
BVDV	Forward: GCGATCCGTCTCCGTCTCC
BVDV	Revers: ACGCCCGTAGCCGTAGCC
MyD88	Forward: ACCAACCCCTGCACCCAGAAC
MyD88	Revers: ACCAACCCCTGCACCCAGAAC

Download PDF

Version 1

posted

You are reading this latest preprint version

MyD88 mediates noncytopathic bovine viral diarrhea virus replication by regulating cellular autophagy and proliferation

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Statistical analysis.

Results

Discussion

Declarations

Funding

Authors' contributions

References

Table

Status:

Version 1